ID: 920256914

View in Genome Browser
Species Human (GRCh38)
Location 1:204661716-204661738
Sequence CCCGGATGCCCTTGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920256897_920256914 30 Left 920256897 1:204661663-204661685 CCTAAGCGCCATCCTGCTGGGAG 0: 1
1: 0
2: 0
3: 4
4: 128
Right 920256914 1:204661716-204661738 CCCGGATGCCCTTGGCAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 171
920256898_920256914 22 Left 920256898 1:204661671-204661693 CCATCCTGCTGGGAGCCATGAGG 0: 1
1: 0
2: 28
3: 52
4: 293
Right 920256914 1:204661716-204661738 CCCGGATGCCCTTGGCAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 171
920256906_920256914 7 Left 920256906 1:204661686-204661708 CCATGAGGGGCAGCTGGGTGGCT No data
Right 920256914 1:204661716-204661738 CCCGGATGCCCTTGGCAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 171
920256902_920256914 18 Left 920256902 1:204661675-204661697 CCTGCTGGGAGCCATGAGGGGCA 0: 1
1: 0
2: 4
3: 24
4: 230
Right 920256914 1:204661716-204661738 CCCGGATGCCCTTGGCAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920256914 Original CRISPR CCCGGATGCCCTTGGCAGGG AGG Intronic
900310151 1:2029599-2029621 GGCTGATGCCCGTGGCAGGGAGG - Exonic
900413795 1:2525989-2526011 GCGGGAAGCCCTTGGCAGAGTGG - Intronic
903332475 1:22603078-22603100 CCCGGGGGCCGTTGGCAGGCAGG + Exonic
904697108 1:32336750-32336772 CCCGGCTGGCCATGGCAGGCAGG - Intergenic
905276152 1:36819482-36819504 CCCGCATGCCCTGGGCTGGGTGG + Intronic
905692609 1:39954625-39954647 CCCGGATGCCAAGGGCAGGACGG + Intergenic
907391008 1:54158248-54158270 CCCTAATGCCCCTGGCAGGCAGG - Intronic
908532917 1:65050549-65050571 CCATGATGCCCTGGGCAGTGTGG - Intergenic
909598991 1:77441649-77441671 CCCGGAAGCCCTTGCCACTGAGG - Intronic
910846050 1:91605763-91605785 TTGTGATGCCCTTGGCAGGGGGG + Intergenic
915496407 1:156285490-156285512 CCCGGATCCCCCTGGCTGGCGGG + Exonic
917508052 1:175646988-175647010 CCCAGCTGCCCTCGGCAGGCAGG + Intronic
919974942 1:202604274-202604296 CCTGGAGGCCCCTGGGAGGGGGG - Intronic
920256914 1:204661716-204661738 CCCGGATGCCCTTGGCAGGGAGG + Intronic
922502823 1:226109807-226109829 CCGGGATTCCCTGGGCAGGGAGG - Intergenic
1062963688 10:1592051-1592073 CCCGGATTCTCCTGTCAGGGTGG + Intronic
1064563973 10:16621250-16621272 CCAGGATGTCCTGTGCAGGGTGG - Intronic
1066022564 10:31318823-31318845 CGCGGCTGCCCGGGGCAGGGAGG - Intronic
1066057312 10:31694330-31694352 CCCTTATGCCCTTTGCAGAGAGG + Intergenic
1066640204 10:37548071-37548093 CCCAGGAGCCATTGGCAGGGAGG - Intergenic
1067222971 10:44357179-44357201 CCCGGACTCCCCTGGGAGGGAGG + Intergenic
1067582844 10:47456328-47456350 CCCGGGTGTGCTGGGCAGGGGGG + Intergenic
1067838212 10:49654606-49654628 CCCAGCTGCCCCTGGAAGGGAGG + Intronic
1070391801 10:75977432-75977454 CCCAGATGCCCTGGACAGAGGGG - Intronic
1071055693 10:81505932-81505954 CCCGCAAGCCCTGGGCAGTGAGG + Intergenic
1072047046 10:91667288-91667310 CACGGATGACCTTGGCCAGGGGG + Intergenic
1072317948 10:94222010-94222032 CCAGGAGGCCGTGGGCAGGGAGG - Intronic
1073002351 10:100295045-100295067 CCAGGATGTCCTTGGCACAGCGG + Exonic
1073019203 10:100427627-100427649 CATGGATGCAGTTGGCAGGGGGG + Intergenic
1075376033 10:121978643-121978665 GCCGGCTGCCCTGGGCAGTGAGG - Intergenic
1076494837 10:130890156-130890178 CCCGGCTTCCCTAGGCAGAGAGG - Intergenic
1076990506 11:271075-271097 CCCTGATGGCCTTGGCAGCTGGG + Intergenic
1077530680 11:3093411-3093433 CCAGGATGTCCCTGGCAGGGAGG - Intronic
1078315413 11:10289697-10289719 ACCCGGTGCCCTCGGCAGGGTGG + Intronic
1078856148 11:15207610-15207632 CCCAGAGGCCCTGGGCAGGAGGG + Intronic
1082872109 11:57953222-57953244 CAGGGATGCCCTTCGCAGAGAGG + Intergenic
1084733811 11:71091720-71091742 CCCGCAGGCCCATGTCAGGGAGG - Intronic
1084794385 11:71495460-71495482 CCCGTGTGCCCTTGGGAGGAAGG + Intronic
1085514436 11:77104156-77104178 TCCGGATGACCTTGGCCTGGGGG + Intronic
1089120928 11:116134465-116134487 CCCAGATGCCCTTGACAGCCTGG + Intergenic
1089202333 11:116731942-116731964 CCAGGATGCCCTGGCCAGAGGGG - Intergenic
1089654269 11:119935568-119935590 CCCAGCTGCCCTTGACATGGTGG + Intergenic
1090803172 11:130187342-130187364 CATGGATACCCTTGGCAGGGAGG + Intronic
1090805807 11:130201401-130201423 CTCAGCTGCCCTTTGCAGGGAGG + Intronic
1091172397 11:133530397-133530419 CCAGGATTCCCTTGGGATGGGGG + Intronic
1091724152 12:2834164-2834186 CCCTGATGCCCTGGGAAGGATGG + Intronic
1091970249 12:4780634-4780656 CCAAGATGCCTGTGGCAGGGTGG + Intronic
1098784697 12:74737439-74737461 CCCAGATGCCCTTGACAGCTGGG + Intergenic
1101517152 12:105447137-105447159 CTGGAATGCCCTTGGCCGGGAGG - Intergenic
1104269150 12:127266759-127266781 TGCGGAAGCCCTGGGCAGGGAGG + Intergenic
1105067170 12:133210696-133210718 CCTGGGGACCCTTGGCAGGGGGG - Exonic
1106479012 13:30123063-30123085 GACGGCTGTCCTTGGCAGGGTGG - Intergenic
1108518325 13:51222720-51222742 CCGCGCTGCCCTGGGCAGGGCGG + Intronic
1113767238 13:112889080-112889102 AGCGGATGCCCTGGGCAGGCTGG - Intergenic
1119702613 14:76765539-76765561 CCAGGGTGCCAGTGGCAGGGTGG + Intronic
1119719938 14:76883774-76883796 CATGGAGGGCCTTGGCAGGGAGG - Intergenic
1122548769 14:102539036-102539058 ACCTGATGCCCCTGTCAGGGTGG + Intergenic
1122836422 14:104433060-104433082 CCCGGGTGCCCTTCCCACGGGGG + Intergenic
1122878755 14:104680543-104680565 CCCTGCTGCCCGGGGCAGGGCGG + Intergenic
1122893273 14:104742738-104742760 CCCAGCTGCCCATGGCAGGAGGG + Intronic
1123051872 14:105547933-105547955 CCCGCCTGCCCTGGGCAGTGAGG + Intergenic
1126109810 15:45168560-45168582 CACATATGCCCTTGGCAGGAGGG + Intronic
1128245682 15:66131172-66131194 CCCTGATGGACTGGGCAGGGCGG + Intronic
1129667967 15:77590130-77590152 CCCCTGTGCCCTTGGCAGGCAGG - Intergenic
1132560927 16:593475-593497 AGTGGGTGCCCTTGGCAGGGAGG + Intronic
1132689585 16:1176599-1176621 CCCGGAACCCCTTGGTTGGGGGG - Intronic
1132726554 16:1341412-1341434 CCTGGATGCACTTGGCAGGCAGG - Exonic
1133100638 16:3477400-3477422 ACCTCATGCTCTTGGCAGGGCGG + Intronic
1135424652 16:22326290-22326312 CCCCCATGCCCCTGGCAGGCAGG - Intronic
1139676417 16:68526854-68526876 CCCGCAAGCCCTGGGCAGTGAGG + Intergenic
1139891512 16:70255874-70255896 CCTGGCAGCCCTTGGCTGGGGGG + Intronic
1142132342 16:88436785-88436807 CCCGCCTGCCCTTGGCCGGCCGG - Exonic
1142884039 17:2901774-2901796 CCTGGCTGTCCTTGGGAGGGTGG + Intronic
1144676085 17:17162586-17162608 CGCAAATGACCTTGGCAGGGAGG - Intronic
1145242580 17:21248480-21248502 CCCGGAGGCCCTGGGCAGAAAGG - Intronic
1149995553 17:61404447-61404469 CCCGGAAGCCCTTGGCAAACGGG - Exonic
1150283322 17:63941874-63941896 TCCGGATGCCCTTGGCCCCGCGG + Exonic
1151682076 17:75627578-75627600 CCAGGAGGCACTTGGGAGGGTGG - Intronic
1151833176 17:76567808-76567830 CACCTATGCCCTTGGCAGTGTGG - Intronic
1153824754 18:8865144-8865166 CCAGCGTCCCCTTGGCAGGGAGG - Intergenic
1156610498 18:38718639-38718661 CCCGCAAGCCCTGGGCAGTGAGG - Intergenic
1157907776 18:51585046-51585068 CACTGATGCCCTTGGAAGAGAGG + Intergenic
1159952517 18:74495962-74495984 CCCGGTTGCTCTTGGGTGGGCGG - Intronic
1160007307 18:75076829-75076851 CCAGGATGCCCCTGCCAGGAGGG - Intergenic
1160680376 19:409277-409299 CCCGGAGGCTGGTGGCAGGGAGG + Intergenic
1161079326 19:2302760-2302782 CGCAGAGGCCTTTGGCAGGGGGG + Intronic
1161270799 19:3388202-3388224 CCCGGGTGCCCTGGAGAGGGTGG + Intronic
1161351219 19:3793000-3793022 CCCGGAGTCCCCTGGCTGGGGGG - Intronic
1161576681 19:5058362-5058384 CCCGGGAGCCCTTGGGATGGAGG + Intronic
1161589168 19:5121062-5121084 CACGGCTGCCCCTGGCAGGTGGG - Intronic
1162590111 19:11585896-11585918 CACGGATGACCTTGGCCGGAGGG - Intronic
1163724285 19:18913664-18913686 CCAGGGTGCCCATGGCAGGTGGG + Intronic
1165739103 19:38195187-38195209 GCAGGATGCCCTGAGCAGGGAGG - Intronic
1167381553 19:49141205-49141227 CTGGGATGCCCTTGGTAAGGTGG - Intronic
925329968 2:3051055-3051077 CCAGGGTGTCCCTGGCAGGGAGG - Intergenic
926170149 2:10548101-10548123 CCCGGGTGGCAGTGGCAGGGCGG - Intergenic
927696456 2:25242715-25242737 CCGGGAAGCCCTTGGCTGGGGGG + Intronic
929000701 2:37344790-37344812 CCTGGATGCCCAGGGCAGGGCGG - Exonic
929776444 2:44933716-44933738 CCCCCACGCCCATGGCAGGGTGG + Intergenic
930707296 2:54517198-54517220 CCGGGATGCCCTTGGCCAAGAGG + Intronic
931818917 2:65932225-65932247 CCTGGAGGCTCTTGGGAGGGTGG + Intergenic
932732489 2:74231166-74231188 AGCGGATGCCTTAGGCAGGGAGG - Intronic
933060841 2:77734993-77735015 CCCGCAAGCCCTGGGCAGTGAGG - Intergenic
933997502 2:87680441-87680463 CATGGGGGCCCTTGGCAGGGTGG + Intergenic
934062493 2:88308099-88308121 CCAGGATTCTCTGGGCAGGGAGG - Intergenic
934567111 2:95347010-95347032 CCTGGATGCCCATGGCAAGCCGG - Intronic
936296350 2:111270471-111270493 CATGGGGGCCCTTGGCAGGGTGG - Intergenic
938931463 2:136089977-136089999 TCTGCATGGCCTTGGCAGGGTGG + Intergenic
940112655 2:150171281-150171303 CCCGGAAGCCCCGGGCAGTGAGG - Intergenic
942123581 2:172801967-172801989 TCCAGATGCCCTTTGGAGGGAGG - Intronic
945069636 2:205977333-205977355 CCCGCAAGCCCTGGGCAGTGAGG + Intergenic
946021692 2:216644481-216644503 CCCGGAAGGCCTTGGTAGGTGGG + Intronic
947543090 2:230991778-230991800 TCCTGCTGCCCCTGGCAGGGTGG - Intergenic
948321842 2:237076167-237076189 CCCGGAAGCCCCAGGCAGGAAGG - Intergenic
948901049 2:240957070-240957092 CGAGGGTGCCCTGGGCAGGGAGG + Intronic
1169227441 20:3865414-3865436 CCTGGAAGCCTTTGGTAGGGCGG - Intronic
1171750402 20:29043553-29043575 CCAGGCTGCCCTTGCCAGAGTGG - Intergenic
1172759201 20:37310161-37310183 CCAGGATGCGCTTGGCAGGCGGG - Intronic
1175264204 20:57692669-57692691 GCCGGGTGCCACTGGCAGGGCGG + Intronic
1175319527 20:58075382-58075404 CTGGGATGCCCTTGGTAGGAGGG + Intergenic
1175445736 20:59018244-59018266 CCTGGATGCCCTTGCCTGGTTGG + Intergenic
1175818909 20:61897977-61897999 GACGGATGACCCTGGCAGGGAGG + Intronic
1176168630 20:63687289-63687311 CCCGTGTGCTCTTGGCGGGGTGG + Intronic
1176673934 21:9759242-9759264 CCTGGATGCCGTTGACAAGGAGG + Intergenic
1178779418 21:35587523-35587545 CCCCGATCCCCATGGCAGAGAGG - Intronic
1179732666 21:43376281-43376303 CCTGGAGGCCTTTGGCATGGGGG - Intergenic
1180172656 21:46067830-46067852 CCCCGAGACCCCTGGCAGGGAGG - Intergenic
1182301633 22:29340371-29340393 CCAGGAGACCCTGGGCAGGGAGG - Intronic
1183429310 22:37756105-37756127 CCCAGATGCCCATGGCGGGCTGG + Intronic
1183489181 22:38107754-38107776 ACCAGATGCCCTTCCCAGGGAGG - Intronic
1184714691 22:46274139-46274161 TCCTGATGCCCTTGGGACGGGGG + Intronic
950471522 3:13189415-13189437 CCCAGATGCCCTGGGCAGCAGGG + Intergenic
951235156 3:20226421-20226443 CTGGGATTCCCTGGGCAGGGTGG + Intergenic
958523202 3:95217941-95217963 CCTGGAAGCCCCTGGCTGGGGGG + Intergenic
961042793 3:123689167-123689189 GCTGGATGCCCTGGCCAGGGTGG + Intronic
963292253 3:143503779-143503801 CATGGATGGCCTTGGCTGGGAGG + Intronic
968552107 4:1229130-1229152 ACTGGGAGCCCTTGGCAGGGTGG - Intronic
975991736 4:80265722-80265744 CCAGGATCCCCGTGGCAGGAAGG - Intergenic
981775967 4:148368127-148368149 TCCTGATGCCCTTGTGAGGGTGG + Intronic
985627889 5:999466-999488 GCCGGATGTCCAAGGCAGGGAGG + Intergenic
997613846 5:135232977-135232999 CCTTGGGGCCCTTGGCAGGGCGG + Intronic
999223574 5:150001124-150001146 CCCGGAGGCGCTTGGCCCGGCGG - Exonic
999731303 5:154478284-154478306 CCCGGGAGCCAATGGCAGGGGGG + Intergenic
1001843946 5:174904350-174904372 CCCTGTTGCCATTGGCTGGGTGG - Intergenic
1002173446 5:177387981-177388003 CGCGAAGGCCCTGGGCAGGGAGG - Exonic
1002817735 6:694864-694886 CACGGAAGCCCATGGCGGGGGGG - Intergenic
1003880636 6:10476833-10476855 CCCTGAAGCCCTTGACTGGGAGG + Intergenic
1006220311 6:32484277-32484299 ACTGGGCGCCCTTGGCAGGGCGG - Intergenic
1006434631 6:34019849-34019871 CCCTGATGCCCATGGCAGGAGGG - Intronic
1007726996 6:43922538-43922560 ACCGGCTGCCCTAGCCAGGGAGG - Intergenic
1009170644 6:60395008-60395030 CCAGGGTTCCCTTGGCTGGGGGG - Intergenic
1009800716 6:68533540-68533562 CCCGCAAGCCCCTGGCAGTGAGG + Intergenic
1017644462 6:156526374-156526396 GCCGGAGACCCTGGGCAGGGTGG - Intergenic
1020098139 7:5379837-5379859 CCCGGAAGCCCTGGGAAGGCCGG - Intronic
1022269643 7:28793652-28793674 CCCCCAAGCCCTTGGGAGGGCGG - Intronic
1024243540 7:47453240-47453262 CCCTCAGGCCCTTGGCAGGCTGG - Intronic
1024657647 7:51465309-51465331 CCCAGAGCCCCTTGGAAGGGAGG - Intergenic
1030325922 7:108218157-108218179 CACGGCTTCCCTTGGCTGGGGGG + Intronic
1033569400 7:142612817-142612839 CCTGGATGGCCTTGGCAATGTGG - Intergenic
1034444315 7:151104950-151104972 CCCAGGTGCCCCTGGCGGGGCGG + Intronic
1036024517 8:4890378-4890400 CCAGGATGCCCATGGCTGTGAGG - Intronic
1036024563 8:4890624-4890646 CCAGGATGCCCATGGCTGTGAGG - Intronic
1044726551 8:95199296-95199318 CGCGGATGCCTTTGGCAGTCTGG - Intergenic
1047063717 8:121256800-121256822 CCTGGATGTCCTTGGGAGAGTGG - Intergenic
1049042535 8:140123507-140123529 CCCAGATGCCCATGGCAGAGTGG - Intronic
1049204834 8:141358884-141358906 CCCGTCTGGCCTGGGCAGGGGGG + Intronic
1049306236 8:141905836-141905858 CCCGGAAGCCAGGGGCAGGGCGG - Intergenic
1049340423 8:142109426-142109448 CTTGGATGCCCTTGGTAGGTTGG + Intergenic
1049444055 8:142621968-142621990 TCAGGATGCCCGTGCCAGGGAGG + Intergenic
1049542991 8:143216842-143216864 CCAGGATGAACTTGGCAGGCCGG - Intergenic
1052358500 9:27529387-27529409 CCCGGAAGCCCGTGGCCGGCGGG + Intronic
1057786936 9:98094744-98094766 CACTGAGGCCCTTGGCTGGGCGG - Intronic
1061284325 9:129613545-129613567 CTCGGACGCCACTGGCAGGGCGG + Exonic
1062222461 9:135424685-135424707 CTGGAATGCCCTTGGCAGAGCGG - Intergenic
1062360717 9:136186660-136186682 CCGGGATGCCCTTCCCAGGTGGG + Intergenic
1062393277 9:136342513-136342535 CCGGGCTGCCCTGGGCGGGGAGG - Intronic
1186293179 X:8121695-8121717 CCCGCAAGCCCCTGGCAGTGAGG + Intergenic
1188562647 X:31487001-31487023 CCAGGATGTACATGGCAGGGTGG + Intronic
1193919323 X:87406591-87406613 CTCTGAAGCCCTTGGCAGAGAGG + Intergenic
1199688913 X:150291254-150291276 CCAGGATGCCCCTGGCCAGGAGG + Intergenic
1200076794 X:153555214-153555236 CCCTGAGGCCATGGGCAGGGGGG - Intronic
1200129351 X:153832453-153832475 CACTGAGGCCCTTTGCAGGGTGG - Intergenic