ID: 920261727

View in Genome Browser
Species Human (GRCh38)
Location 1:204692912-204692934
Sequence CCTCAGGTTCTGCAAGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920261727_920261733 7 Left 920261727 1:204692912-204692934 CCCTGTACTTGCAGAACCTGAGG No data
Right 920261733 1:204692942-204692964 GCCTCCTTAACTTTTGGCCTAGG No data
920261727_920261732 1 Left 920261727 1:204692912-204692934 CCCTGTACTTGCAGAACCTGAGG No data
Right 920261732 1:204692936-204692958 TTGAGTGCCTCCTTAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920261727 Original CRISPR CCTCAGGTTCTGCAAGTACA GGG (reversed) Intergenic
No off target data available for this crispr