ID: 920262272

View in Genome Browser
Species Human (GRCh38)
Location 1:204697015-204697037
Sequence CCCTAGCCCTGGACTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920262272_920262281 9 Left 920262272 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG No data
Right 920262281 1:204697047-204697069 GTTTTGGAGTGAGCCAAAGTGGG No data
920262272_920262280 8 Left 920262272 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG No data
Right 920262280 1:204697046-204697068 GGTTTTGGAGTGAGCCAAAGTGG No data
920262272_920262282 10 Left 920262272 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG No data
Right 920262282 1:204697048-204697070 TTTTGGAGTGAGCCAAAGTGGGG No data
920262272_920262279 -7 Left 920262272 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG No data
Right 920262279 1:204697031-204697053 GCTAGGGTTTTTAAGGGTTTTGG No data
920262272_920262284 22 Left 920262272 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG No data
Right 920262284 1:204697060-204697082 CCAAAGTGGGGATTGTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920262272 Original CRISPR CCCTAGCCCTGGACTCCTTG GGG (reversed) Intergenic