ID: 920262279

View in Genome Browser
Species Human (GRCh38)
Location 1:204697031-204697053
Sequence GCTAGGGTTTTTAAGGGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920262274_920262279 -8 Left 920262274 1:204697016-204697038 CCCAAGGAGTCCAGGGCTAGGGT No data
Right 920262279 1:204697031-204697053 GCTAGGGTTTTTAAGGGTTTTGG No data
920262267_920262279 7 Left 920262267 1:204697001-204697023 CCTCAAATCCATCTCCCCAAGGA No data
Right 920262279 1:204697031-204697053 GCTAGGGTTTTTAAGGGTTTTGG No data
920262275_920262279 -9 Left 920262275 1:204697017-204697039 CCAAGGAGTCCAGGGCTAGGGTT No data
Right 920262279 1:204697031-204697053 GCTAGGGTTTTTAAGGGTTTTGG No data
920262265_920262279 30 Left 920262265 1:204696978-204697000 CCGAATGAGGAGATAGGAGAAAA No data
Right 920262279 1:204697031-204697053 GCTAGGGTTTTTAAGGGTTTTGG No data
920262272_920262279 -7 Left 920262272 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG No data
Right 920262279 1:204697031-204697053 GCTAGGGTTTTTAAGGGTTTTGG No data
920262269_920262279 -1 Left 920262269 1:204697009-204697031 CCATCTCCCCAAGGAGTCCAGGG No data
Right 920262279 1:204697031-204697053 GCTAGGGTTTTTAAGGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920262279 Original CRISPR GCTAGGGTTTTTAAGGGTTT TGG Intergenic