ID: 920262280

View in Genome Browser
Species Human (GRCh38)
Location 1:204697046-204697068
Sequence GGTTTTGGAGTGAGCCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920262274_920262280 7 Left 920262274 1:204697016-204697038 CCCAAGGAGTCCAGGGCTAGGGT No data
Right 920262280 1:204697046-204697068 GGTTTTGGAGTGAGCCAAAGTGG No data
920262267_920262280 22 Left 920262267 1:204697001-204697023 CCTCAAATCCATCTCCCCAAGGA No data
Right 920262280 1:204697046-204697068 GGTTTTGGAGTGAGCCAAAGTGG No data
920262269_920262280 14 Left 920262269 1:204697009-204697031 CCATCTCCCCAAGGAGTCCAGGG No data
Right 920262280 1:204697046-204697068 GGTTTTGGAGTGAGCCAAAGTGG No data
920262278_920262280 -3 Left 920262278 1:204697026-204697048 CCAGGGCTAGGGTTTTTAAGGGT No data
Right 920262280 1:204697046-204697068 GGTTTTGGAGTGAGCCAAAGTGG No data
920262275_920262280 6 Left 920262275 1:204697017-204697039 CCAAGGAGTCCAGGGCTAGGGTT No data
Right 920262280 1:204697046-204697068 GGTTTTGGAGTGAGCCAAAGTGG No data
920262272_920262280 8 Left 920262272 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG No data
Right 920262280 1:204697046-204697068 GGTTTTGGAGTGAGCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920262280 Original CRISPR GGTTTTGGAGTGAGCCAAAG TGG Intergenic