ID: 920262281

View in Genome Browser
Species Human (GRCh38)
Location 1:204697047-204697069
Sequence GTTTTGGAGTGAGCCAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920262278_920262281 -2 Left 920262278 1:204697026-204697048 CCAGGGCTAGGGTTTTTAAGGGT No data
Right 920262281 1:204697047-204697069 GTTTTGGAGTGAGCCAAAGTGGG No data
920262274_920262281 8 Left 920262274 1:204697016-204697038 CCCAAGGAGTCCAGGGCTAGGGT No data
Right 920262281 1:204697047-204697069 GTTTTGGAGTGAGCCAAAGTGGG No data
920262272_920262281 9 Left 920262272 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG No data
Right 920262281 1:204697047-204697069 GTTTTGGAGTGAGCCAAAGTGGG No data
920262267_920262281 23 Left 920262267 1:204697001-204697023 CCTCAAATCCATCTCCCCAAGGA No data
Right 920262281 1:204697047-204697069 GTTTTGGAGTGAGCCAAAGTGGG No data
920262269_920262281 15 Left 920262269 1:204697009-204697031 CCATCTCCCCAAGGAGTCCAGGG No data
Right 920262281 1:204697047-204697069 GTTTTGGAGTGAGCCAAAGTGGG No data
920262275_920262281 7 Left 920262275 1:204697017-204697039 CCAAGGAGTCCAGGGCTAGGGTT No data
Right 920262281 1:204697047-204697069 GTTTTGGAGTGAGCCAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920262281 Original CRISPR GTTTTGGAGTGAGCCAAAGT GGG Intergenic