ID: 920262284

View in Genome Browser
Species Human (GRCh38)
Location 1:204697060-204697082
Sequence CCAAAGTGGGGATTGTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920262269_920262284 28 Left 920262269 1:204697009-204697031 CCATCTCCCCAAGGAGTCCAGGG No data
Right 920262284 1:204697060-204697082 CCAAAGTGGGGATTGTTGACTGG No data
920262278_920262284 11 Left 920262278 1:204697026-204697048 CCAGGGCTAGGGTTTTTAAGGGT No data
Right 920262284 1:204697060-204697082 CCAAAGTGGGGATTGTTGACTGG No data
920262274_920262284 21 Left 920262274 1:204697016-204697038 CCCAAGGAGTCCAGGGCTAGGGT No data
Right 920262284 1:204697060-204697082 CCAAAGTGGGGATTGTTGACTGG No data
920262275_920262284 20 Left 920262275 1:204697017-204697039 CCAAGGAGTCCAGGGCTAGGGTT No data
Right 920262284 1:204697060-204697082 CCAAAGTGGGGATTGTTGACTGG No data
920262272_920262284 22 Left 920262272 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG No data
Right 920262284 1:204697060-204697082 CCAAAGTGGGGATTGTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920262284 Original CRISPR CCAAAGTGGGGATTGTTGAC TGG Intergenic