ID: 920266724

View in Genome Browser
Species Human (GRCh38)
Location 1:204729651-204729673
Sequence GGCTGCTGCTGACCTGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920266712_920266724 26 Left 920266712 1:204729602-204729624 CCACCTTACCATGCTGAGGAGGA No data
Right 920266724 1:204729651-204729673 GGCTGCTGCTGACCTGGAACTGG No data
920266715_920266724 18 Left 920266715 1:204729610-204729632 CCATGCTGAGGAGGATTTGGCTC No data
Right 920266724 1:204729651-204729673 GGCTGCTGCTGACCTGGAACTGG No data
920266722_920266724 -4 Left 920266722 1:204729632-204729654 CCACAAGAGAGGGGAGGGAGGCT No data
Right 920266724 1:204729651-204729673 GGCTGCTGCTGACCTGGAACTGG No data
920266710_920266724 27 Left 920266710 1:204729601-204729623 CCCACCTTACCATGCTGAGGAGG No data
Right 920266724 1:204729651-204729673 GGCTGCTGCTGACCTGGAACTGG No data
920266713_920266724 23 Left 920266713 1:204729605-204729627 CCTTACCATGCTGAGGAGGATTT No data
Right 920266724 1:204729651-204729673 GGCTGCTGCTGACCTGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920266724 Original CRISPR GGCTGCTGCTGACCTGGAAC TGG Intergenic
No off target data available for this crispr