ID: 920267022

View in Genome Browser
Species Human (GRCh38)
Location 1:204731614-204731636
Sequence CCGCCCAGGTGAGACAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920267022_920267029 -2 Left 920267022 1:204731614-204731636 CCAGCCCTGTCTCACCTGGGCGG No data
Right 920267029 1:204731635-204731657 GGGCGCAATGGCCCCCCTGCCGG No data
920267022_920267030 2 Left 920267022 1:204731614-204731636 CCAGCCCTGTCTCACCTGGGCGG No data
Right 920267030 1:204731639-204731661 GCAATGGCCCCCCTGCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920267022 Original CRISPR CCGCCCAGGTGAGACAGGGC TGG (reversed) Intergenic
No off target data available for this crispr