ID: 920269142

View in Genome Browser
Species Human (GRCh38)
Location 1:204750219-204750241
Sequence GAGACTCAAGTGCCTCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920269139_920269142 18 Left 920269139 1:204750178-204750200 CCTGAATTATCTGAGATTGAGAT No data
Right 920269142 1:204750219-204750241 GAGACTCAAGTGCCTCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920269142 Original CRISPR GAGACTCAAGTGCCTCTAGT GGG Intergenic
No off target data available for this crispr