ID: 920272686

View in Genome Browser
Species Human (GRCh38)
Location 1:204778105-204778127
Sequence GAAATGTGCAGACCTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920272686_920272695 29 Left 920272686 1:204778105-204778127 CCTCAGCAAGGTCTGCACATTTC No data
Right 920272695 1:204778157-204778179 ATCGCCTGTCAGGTATCTCTGGG No data
920272686_920272696 30 Left 920272686 1:204778105-204778127 CCTCAGCAAGGTCTGCACATTTC No data
Right 920272696 1:204778158-204778180 TCGCCTGTCAGGTATCTCTGGGG No data
920272686_920272694 28 Left 920272686 1:204778105-204778127 CCTCAGCAAGGTCTGCACATTTC No data
Right 920272694 1:204778156-204778178 AATCGCCTGTCAGGTATCTCTGG No data
920272686_920272691 19 Left 920272686 1:204778105-204778127 CCTCAGCAAGGTCTGCACATTTC No data
Right 920272691 1:204778147-204778169 ACCCTAGCAAATCGCCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920272686 Original CRISPR GAAATGTGCAGACCTTGCTG AGG (reversed) Intergenic
No off target data available for this crispr