ID: 920279250

View in Genome Browser
Species Human (GRCh38)
Location 1:204830353-204830375
Sequence GGCCATACCAGCTGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920279247_920279250 -9 Left 920279247 1:204830339-204830361 CCTCTGGGGATAGGGGCCATACC 0: 1
1: 0
2: 1
3: 8
4: 75
Right 920279250 1:204830353-204830375 GGCCATACCAGCTGTGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 245
920279238_920279250 21 Left 920279238 1:204830309-204830331 CCCAGGGAAAATGTGTGTGAAGA 0: 1
1: 0
2: 4
3: 23
4: 290
Right 920279250 1:204830353-204830375 GGCCATACCAGCTGTGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 245
920279239_920279250 20 Left 920279239 1:204830310-204830332 CCAGGGAAAATGTGTGTGAAGAG 0: 1
1: 0
2: 4
3: 27
4: 268
Right 920279250 1:204830353-204830375 GGCCATACCAGCTGTGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920279250 Original CRISPR GGCCATACCAGCTGTGAGGT GGG Intronic
900625682 1:3607554-3607576 GGCCTTTCCACCTGTGAGGATGG + Intronic
900982333 1:6053354-6053376 GGCCATGGCTGCCGTGAGGTTGG - Intronic
901327915 1:8380041-8380063 TGCCATGTCAGCCGTGAGGTGGG - Intronic
902665816 1:17937195-17937217 GCCAACTCCAGCTGTGAGGTGGG - Intergenic
902668791 1:17957734-17957756 GGCCCTTCCAGCTCTGAAGTTGG + Intergenic
904248380 1:29204647-29204669 GGCCATATCAGCCTTGAGGCAGG + Intronic
905814264 1:40936536-40936558 GGCCACAGCAGCTGTGAGCTAGG + Intergenic
905915817 1:41683596-41683618 GGCCATACCAGCCCTGAGCCAGG - Intronic
906049446 1:42858270-42858292 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
908173792 1:61533775-61533797 GACCATACCAGGTGTGCAGTAGG - Intergenic
908592018 1:65645828-65645850 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
909793043 1:79700297-79700319 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
909909893 1:81247196-81247218 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
910094407 1:83504164-83504186 GGGTATGCCAGCTGTGAGGTTGG - Intergenic
911570337 1:99511394-99511416 AGCCAGACCAGCTGTGAGGAGGG - Intergenic
913251483 1:116915330-116915352 GGCCATGCCGGCTCTGAGGACGG + Intronic
915574370 1:156765896-156765918 AGGCATACTAGCTGTGAGGTAGG + Intronic
917142959 1:171855945-171855967 GGCAATACCATCTGAGACGTAGG - Intronic
917254335 1:173098268-173098290 GGCCAAACCAGCTGTGTCATGGG + Intergenic
918175309 1:182038975-182038997 GGCCTTACCAATTGTGAGGCAGG + Intergenic
918347046 1:183615405-183615427 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
918714475 1:187769450-187769472 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
919090998 1:192979090-192979112 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
920279250 1:204830353-204830375 GGCCATACCAGCTGTGAGGTGGG + Intronic
921871914 1:220150291-220150313 TCTCATCCCAGCTGTGAGGTAGG + Exonic
922001627 1:221484333-221484355 GGCGATGCCAGCTCTGGGGTAGG - Intergenic
922154138 1:223028357-223028379 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
922675346 1:227546059-227546081 GGCCATCACAGCTGTGAGTGGGG - Intergenic
1064626325 10:17265631-17265653 GGCAATATCAGCTCTGAGCTTGG - Intergenic
1065254315 10:23850247-23850269 GGCCAGCCCAGCTGTTAGCTAGG - Intronic
1065960814 10:30732620-30732642 GGCCATAGCAGATGTGAGATTGG - Intergenic
1066103466 10:32137642-32137664 GGCCAGACCAGGTATGAGGAGGG + Intergenic
1067660757 10:48234903-48234925 GGCCAGACCTGCTGTGATGGGGG - Intronic
1068058415 10:52037717-52037739 AGCCAGACCAGGTGTGAGGAGGG + Intronic
1068360713 10:55972947-55972969 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1069636620 10:69929141-69929163 AGCCACAGCAGCTGGGAGGTGGG - Intronic
1070778446 10:79123836-79123858 GGCCAGGCCTGCTGTGAGCTGGG - Intronic
1071078412 10:81782066-81782088 GGGCATACCTGGTGAGAGGTGGG - Intergenic
1074753374 10:116607703-116607725 GGCCTCACCACCTGTGAGCTCGG - Intronic
1075200271 10:120396512-120396534 TGGCATCCCAGCTGTGAAGTGGG - Intergenic
1078110857 11:8390702-8390724 GGCCTTGCCTGGTGTGAGGTGGG + Intergenic
1078977399 11:16494715-16494737 GGCAATATCAGCTGGGAGGTTGG + Intronic
1079447396 11:20569546-20569568 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1081356742 11:42122333-42122355 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1081653394 11:44840535-44840557 CTCCATCCCAGCTGTGAGCTGGG - Intronic
1082990641 11:59204910-59204932 GGCCAGAAAAGCTTTGAGGTGGG + Exonic
1084327014 11:68406362-68406384 GGCCAACCCAGCCATGAGGTCGG + Intronic
1085263867 11:75224855-75224877 GGGAAGACCAGGTGTGAGGTGGG - Intergenic
1085468152 11:76738168-76738190 GGGAATAGCAGCTGTGAGGATGG - Intergenic
1085715229 11:78866667-78866689 GGCCAACACAGCTGTGAGGCTGG + Intronic
1086133093 11:83420851-83420873 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1086780708 11:90901497-90901519 GAGCATACATGCTGTGAGGTTGG + Intergenic
1087196847 11:95311288-95311310 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1087206277 11:95398990-95399012 GGCTGCTCCAGCTGTGAGGTGGG - Intergenic
1087927312 11:103934261-103934283 GGGCATACCTACTGAGAGGTAGG - Intronic
1089953187 11:122548318-122548340 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1090128340 11:124113796-124113818 GGCCACACCAGCTTTAAGGGAGG + Intergenic
1090872027 11:130757461-130757483 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1092119415 12:6033678-6033700 GGCCAGCCCGGGTGTGAGGTGGG + Intronic
1092199425 12:6570861-6570883 GGTCCTACCTGCTGTGGGGTAGG + Exonic
1092723783 12:11466125-11466147 AGCCAGACCAGGTGTGAGGAGGG + Intronic
1092930244 12:13308941-13308963 GGCCAGAACTGCTGTGAGGCCGG - Intergenic
1093358368 12:18196686-18196708 AGCCAGACCAGGTGTGAGGAGGG - Intronic
1093578748 12:20765134-20765156 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1097626878 12:62011025-62011047 GGCCACCCCATCTGGGAGGTGGG + Intronic
1099836163 12:87911367-87911389 AGCCGTACCAGGTGTGAGGAGGG + Intergenic
1102023445 12:109699665-109699687 GGCTATAACAGGTGTGGGGTGGG - Intergenic
1104685460 12:130781784-130781806 GTCCCCTCCAGCTGTGAGGTGGG + Intergenic
1104685485 12:130781869-130781891 GTCCCCTCCAGCTGTGAGGTGGG + Intergenic
1104685499 12:130781910-130781932 GTCCCCTCCAGCTGTGAGGTGGG + Intergenic
1104685527 12:130781994-130782016 GACCCCTCCAGCTGTGAGGTGGG + Intergenic
1104685540 12:130782036-130782058 GACCCCTCCAGCTGTGAGGTGGG + Intergenic
1104685553 12:130782078-130782100 GACCCCTCCAGCTGTGAGGTGGG + Intergenic
1105894473 13:24706606-24706628 GGCCAGCCCACCTGAGAGGTTGG - Intronic
1105913188 13:24890403-24890425 GGCCATGTCAGCTGTGAGCGTGG - Intronic
1106943378 13:34800402-34800424 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1107075513 13:36318199-36318221 AGCCAGACCAGGTGTGAGGAGGG - Intronic
1107964578 13:45587569-45587591 GCCCAAAACAACTGTGAGGTAGG - Intronic
1108282140 13:48871114-48871136 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1108486579 13:50933025-50933047 GGGCACACAAGCTGTGAGGCTGG + Intronic
1109499232 13:63214880-63214902 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1110256745 13:73441292-73441314 GGCCTTACCAACTGTGAAGCTGG - Intergenic
1111126107 13:83912236-83912258 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1111630375 13:90841202-90841224 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1113324269 13:109267101-109267123 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1113835793 13:113327816-113327838 TGCCACACCACCTGTGGGGTTGG - Intronic
1116534843 14:46016359-46016381 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1117702554 14:58427952-58427974 TGCCCTACCAGCTCTGGGGTTGG + Intronic
1122828739 14:104385068-104385090 GGCCCTCCCAGCTGAGAGCTGGG - Intergenic
1122844612 14:104485999-104486021 GGCCACACCAGGGGTGAGGATGG - Intronic
1122938335 14:104970172-104970194 GGCCATACAAGGTGTGTGGCAGG - Intronic
1124619447 15:31265533-31265555 GGCCACCCAAGCTGTGAGCTAGG + Intergenic
1125045707 15:35240527-35240549 AGCCAGACCAGGTGTGAGGAGGG - Intronic
1126912470 15:53430789-53430811 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1127489168 15:59445975-59445997 TGCCCTTCCAGCTGTGAGCTCGG - Intronic
1128355305 15:66922295-66922317 GACCACACTAGCTGTGAGGGGGG + Intergenic
1128579000 15:68795798-68795820 GTCTATACCAGCTGGAAGGTAGG - Intronic
1128647684 15:69389065-69389087 AGACAGACCAGCTGAGAGGTTGG - Intronic
1130838052 15:87671303-87671325 TGCACTACCACCTGTGAGGTGGG - Intergenic
1134342246 16:13356520-13356542 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1135077478 16:19406548-19406570 GGCCTTACCAGTTGTGAAGCTGG + Intergenic
1138512079 16:57514774-57514796 GGGCCTCCCAGCTGTGAAGTGGG + Intronic
1139280787 16:65768698-65768720 GGCCATATGGGCTGGGAGGTTGG + Intergenic
1139485786 16:67255888-67255910 GGCCATTTCAGCAGTGAGGTAGG - Exonic
1142242202 16:88952691-88952713 GGCCATTCCTGCTGGGAGGCAGG + Intronic
1142358110 16:89613638-89613660 GGCCAGCCCAGCTGTGAGCCTGG + Intronic
1144648161 17:16989378-16989400 GGCCACACCTGCTTTGTGGTGGG - Intergenic
1149029299 17:52065676-52065698 GGCCATACCAACTGGGAGTTTGG - Intronic
1153967382 18:10194302-10194324 GGCCATGCCTGTTGTGGGGTGGG + Intergenic
1156971630 18:43163724-43163746 GGCCTTACCAGTTGTAAAGTTGG - Intergenic
1157722286 18:49934525-49934547 GGCCAGACCAGCTGTGGCCTTGG - Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1158960596 18:62584756-62584778 GGTCATCACAGCTGTGAAGTGGG + Intronic
1160994062 19:1873682-1873704 GGCCATACCAAGTGGGAGGTGGG + Intergenic
1163664899 19:18598591-18598613 GGCCATACCACCTGCGGGGATGG + Exonic
1163673166 19:18640938-18640960 GGCCATACCAGGTGTTAGTGAGG - Intronic
1164152907 19:22569999-22570021 AGCCGGACCAGCTGTGAGGAGGG - Intergenic
1166905869 19:46108039-46108061 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1167913202 19:52720691-52720713 GGCCACGCCATCTGGGAGGTGGG - Intronic
1168632324 19:57967163-57967185 GGCCATATTAGCTGTGTGGTGGG + Intronic
925828889 2:7876613-7876635 AGCCAGACCAGGTGTGAGGGGGG + Intergenic
925901814 2:8514215-8514237 GCCCATGCCAGCAGTGAGGGAGG - Intergenic
928877533 2:36057572-36057594 TGCCATACCAGCTGTGAAATTGG + Intergenic
928928501 2:36600794-36600816 AGCCAGACCAGGTGTGAGGAGGG - Intronic
929600585 2:43201875-43201897 GTCCATGCCAGCGGGGAGGTGGG - Intergenic
929684603 2:44023019-44023041 AGCCAGACCAGATGTGAGGAGGG + Intergenic
930955031 2:57194727-57194749 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
933013026 2:77090136-77090158 AGCCAGACCAGGTGTGAGGAGGG - Intronic
933131231 2:78676439-78676461 GGCCTTACCAGTTGTGAAGCTGG + Intergenic
937243289 2:120476259-120476281 GGCCATACCAGGTGGGTGGCAGG - Intergenic
940675870 2:156724020-156724042 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
941695295 2:168544638-168544660 GTCCATACCAGCAGTGTGATCGG - Intronic
942839077 2:180337706-180337728 GGCCTTACCAGTTGTGAAGCTGG - Intergenic
943200180 2:184812649-184812671 GGCTCTACCTGCTGGGAGGTGGG + Intronic
943412997 2:187564429-187564451 AGCCAGACCAGGTGTGAGGAGGG + Intronic
943461262 2:188173182-188173204 AGCCGGACCAGCTGTGAGGAGGG + Intergenic
943806581 2:192132179-192132201 AGCCAGACCAGGTGTGAGGAGGG - Intronic
943865281 2:192919791-192919813 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
943951368 2:194134875-194134897 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
944250960 2:197579861-197579883 AGCCAGACCAGGTGTGAGGAGGG - Intronic
944899062 2:204196042-204196064 AGCCCTCCCAGCTGTGAGGTGGG + Intergenic
945858048 2:215091311-215091333 AGCCAGACCAGGTGTGAGGAGGG - Intronic
946335139 2:219031010-219031032 GGCCAGGCCAGATGGGAGGTGGG + Intronic
946871832 2:224091826-224091848 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1174052693 20:47778341-47778363 GGCCATAACAACTCTGAGTTTGG + Intronic
1174354143 20:49987251-49987273 GGCCTAACCAGCTTGGAGGTGGG + Intronic
1174974814 20:55319898-55319920 GGAGATACCAGTTATGAGGTTGG + Intergenic
1177840815 21:26232018-26232040 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1179238583 21:39568608-39568630 AGCCATCCCAGCAGAGAGGTCGG - Intronic
950479117 3:13233817-13233839 GGCCATACCACATGTGAGCAGGG - Intergenic
951845777 3:27082713-27082735 GGACATTCCAACTGTGATGTGGG + Intergenic
953077199 3:39581751-39581773 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
955097838 3:55817349-55817371 AGCCTTTCCAGCAGTGAGGTGGG + Intronic
955612927 3:60776582-60776604 GGCCTTACCAGTTGTGAAGCTGG - Intronic
956172347 3:66442874-66442896 GGGAACACCAGCTGTGGGGTTGG - Intronic
958406427 3:93761851-93761873 GGCCATCCCATCTGTGATATGGG - Intergenic
958406447 3:93761927-93761949 GGCCACCCCATCTGGGAGGTGGG - Intergenic
958406560 3:93762339-93762361 GGCCATCCCATCTGGGATGTGGG - Intergenic
963058548 3:141206698-141206720 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
963319663 3:143799006-143799028 AGCCAGACCAGGTGTGAGGAGGG - Intronic
964906580 3:161725822-161725844 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
964941029 3:162158132-162158154 AGCCGGACCAGCTGTGAGGAGGG + Intergenic
964979917 3:162666165-162666187 GGCCTTACCAGCTGTGAAGCTGG - Intergenic
965027825 3:163325463-163325485 GGCCCTACCAGTTGTGAAGCCGG - Intergenic
965379904 3:167975288-167975310 GTACACACCAGCTGTGGGGTAGG + Intergenic
965624951 3:170676495-170676517 AGCCAGACCAGGTGTGAGGAGGG + Intronic
966066773 3:175829467-175829489 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
966279230 3:178209263-178209285 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
966688182 3:182719089-182719111 GGCCTTACCAGTTGTGAAGCAGG + Intergenic
968002218 3:195213935-195213957 GGCAATACCAGATGTGATTTTGG + Intronic
972071208 4:35020762-35020784 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
973021188 4:45207551-45207573 GGCCACCCCATCTGGGAGGTGGG + Intergenic
974428466 4:61768244-61768266 AGCCAGACCAGGTGTGAGGAGGG + Intronic
974840150 4:67289994-67290016 TGCAATACCAGCTGTGAGAAGGG + Intergenic
974885184 4:67809518-67809540 GGCAATAGCAGCTGAGAGGCTGG - Intergenic
975865156 4:78717813-78717835 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
976696467 4:87923624-87923646 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
977010246 4:91625846-91625868 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
977062576 4:92275447-92275469 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
977198501 4:94088579-94088601 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
977217223 4:94297169-94297191 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
978421518 4:108538314-108538336 GGCCAGACAAGCTGTCAGGGAGG - Intergenic
979434562 4:120673413-120673435 GGCCATACCAGCAGACAGGGAGG + Intergenic
979850376 4:125565591-125565613 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
979895233 4:126149092-126149114 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
980284881 4:130769089-130769111 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
980722642 4:136717808-136717830 GGCCTTACCAGTTGTGAAGCTGG - Intergenic
982084035 4:151816557-151816579 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
983055417 4:163094845-163094867 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
984099118 4:175465389-175465411 AGCCACACCAGGTGTGAGGAGGG + Intergenic
984322117 4:178208876-178208898 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
984437193 4:179722172-179722194 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
985351124 4:189062294-189062316 GGCTATCCCAGCAGTGTGGTGGG - Intergenic
987487437 5:18540063-18540085 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
987890152 5:23865553-23865575 GGCCTTACCAGTTGTGAAGCAGG - Intergenic
989659850 5:43787859-43787881 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
990083053 5:51940533-51940555 GGCCATACCAGATATTAGGATGG + Intergenic
990660222 5:58005719-58005741 GGCAATACTAGCTCTGAGTTAGG - Intergenic
994489297 5:100420917-100420939 GGCCTTACCAATTGTGAGGCAGG - Intergenic
994532609 5:100988209-100988231 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
994989479 5:106980135-106980157 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
995555509 5:113324066-113324088 GGCCATACCAGGCCTGAGTTTGG - Intronic
996574250 5:124964164-124964186 GGCCATACCAGTTGTGAAGCCGG - Intergenic
997157162 5:131573222-131573244 AGCCAGACCAGGTGTGAGGAGGG - Intronic
997769744 5:136543567-136543589 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
997772708 5:136569287-136569309 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
997977122 5:138446993-138447015 TGCCACACCAGCTGACAGGTGGG + Intergenic
999133232 5:149300232-149300254 GGACATGCCAGCTGTGAAGGAGG - Intronic
999218205 5:149953995-149954017 GGCCATACCAGCTTAGATGTGGG - Intergenic
999618935 5:153453665-153453687 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
999723524 5:154416628-154416650 GGCAATACCAGCTGCAAGGGAGG + Intronic
999730344 5:154472865-154472887 GGCTTTTCCAGCTGTGCGGTGGG + Intergenic
1000519480 5:162279332-162279354 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1005188613 6:23192096-23192118 TGCCCTACCATCTGTGAGGCTGG + Intergenic
1006037173 6:31222932-31222954 GGCCAGCTCAGCTGTGTGGTGGG - Intergenic
1006075513 6:31529757-31529779 GGCCAGCTCAGCTGTGCGGTGGG - Exonic
1006998444 6:38285130-38285152 GGCCATATCAGATGTGTGGGAGG + Intronic
1009464272 6:63951653-63951675 AGCCAGACCAGGTGTGAGGAGGG - Intronic
1009868943 6:69432547-69432569 GGCCACCCCATCTGGGAGGTGGG - Intergenic
1010894611 6:81349085-81349107 AGCCAGACCAGTTGTGAGGAGGG + Intergenic
1012689507 6:102294680-102294702 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1013410389 6:109878452-109878474 GGCCCTACCAGTTGTGAAGCTGG - Intergenic
1013891633 6:115033639-115033661 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1014454940 6:121624394-121624416 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1016853200 6:148641554-148641576 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1018040567 6:159918276-159918298 GGCCATACCAGCTGGGCAGGAGG - Intergenic
1019518527 7:1450201-1450223 GGCTAAGCCAGCTGTGAGGCCGG + Intronic
1028361847 7:89977237-89977259 GGCCATGCCAGCTCAGAGTTAGG - Intergenic
1030602713 7:111609882-111609904 AGCCATCCCATCTGGGAGGTGGG + Intergenic
1031399918 7:121317326-121317348 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1033797845 7:144869238-144869260 AGCCATAATAGCTGGGAGGTGGG + Intergenic
1038707027 8:29903805-29903827 CCACATAGCAGCTGTGAGGTTGG - Intergenic
1044762431 8:95535763-95535785 GGCCATACCCGATGGGAGGAGGG - Intergenic
1046443182 8:114283747-114283769 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1046594783 8:116248595-116248617 GGCCATACAACCTGTGTGTTTGG + Intergenic
1047829610 8:128615864-128615886 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1048175803 8:132151126-132151148 GGCCTTACCAGTTGTGAAGCTGG - Intronic
1048497110 8:134944519-134944541 GCTAATACCAGCTGTTAGGTTGG + Intergenic
1049568322 8:143355087-143355109 TGCCATCCCGGCTGTGAGCTGGG - Intronic
1049827863 8:144681672-144681694 GCCCATCCCAGCAGAGAGGTAGG + Intergenic
1050140400 9:2511143-2511165 AGCCGGACCAGGTGTGAGGTGGG - Intergenic
1050258181 9:3815154-3815176 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1050273668 9:3973440-3973462 GGCCACACCAGATATTAGGTTGG - Intronic
1050895998 9:10886483-10886505 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1052163014 9:25289427-25289449 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1052218761 9:25996092-25996114 AGCCATATCAGGTGTGAGGAGGG - Intergenic
1055809978 9:80139164-80139186 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1056061089 9:82885512-82885534 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1056323814 9:85460401-85460423 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1056363629 9:85882410-85882432 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1056437309 9:86587266-86587288 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1056882910 9:90414330-90414352 AGCCGGACCAGCTGTGAGGAGGG - Intergenic
1059574552 9:115475117-115475139 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1189616782 X:42792429-42792451 GGCCTTACCAGTTGTGAAGCAGG + Intergenic
1192334300 X:70204599-70204621 GCCCATCCCAGATGTGAGTTGGG - Intronic
1192764723 X:74129142-74129164 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1196572434 X:117280917-117280939 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1196992757 X:121346970-121346992 AGCCAGACCAGGTGTGAGGAGGG + Intergenic
1197793572 X:130278783-130278805 AGCCAGACCAGGTGTGAGGAGGG - Intergenic
1198302525 X:135345375-135345397 GGGCTGACCAGCTGTGAGGCTGG + Intronic
1201234318 Y:11895123-11895145 AGCCAGACCAGGTGTGAGGAGGG + Intergenic