ID: 920283999

View in Genome Browser
Species Human (GRCh38)
Location 1:204866535-204866557
Sequence GCCCTACAGCACCCTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920283993_920283999 3 Left 920283993 1:204866509-204866531 CCAGAAAGGGTAAAAGGCTTTTC 0: 1
1: 0
2: 3
3: 17
4: 192
Right 920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG 0: 1
1: 0
2: 1
3: 31
4: 232
920283990_920283999 15 Left 920283990 1:204866497-204866519 CCGATCCTGAGTCCAGAAAGGGT 0: 1
1: 0
2: 1
3: 28
4: 178
Right 920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG 0: 1
1: 0
2: 1
3: 31
4: 232
920283991_920283999 10 Left 920283991 1:204866502-204866524 CCTGAGTCCAGAAAGGGTAAAAG 0: 1
1: 0
2: 1
3: 26
4: 236
Right 920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG 0: 1
1: 0
2: 1
3: 31
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920283999 Original CRISPR GCCCTACAGCACCCTGGGGC TGG Intronic
900122667 1:1055515-1055537 GCTCCTCAGCAGCCTGGGGCTGG - Exonic
900183037 1:1320772-1320794 AGCCTACAGGACCCCGGGGCTGG + Intronic
900185502 1:1331382-1331404 GCTCTCCTGCACCCTGGGACGGG + Exonic
900599365 1:3496532-3496554 GCCCTTCAGCCCCCTCTGGCTGG - Intronic
902367896 1:15989416-15989438 CCCCTACCCCACCCTGGCGCAGG - Intergenic
902843856 1:19094041-19094063 GCCCTGGAGCACACTGGGGTTGG + Exonic
902872902 1:19325010-19325032 GCACTCCAGCACCCTGGAGGTGG - Intronic
902878172 1:19353335-19353357 TCCTTACAGCAACCTGGGCCTGG - Intronic
903044312 1:20553929-20553951 GCCCGCCCGCTCCCTGGGGCCGG - Exonic
903225078 1:21890129-21890151 GCCATCCAGCTCCCTGGGGATGG + Exonic
903335489 1:22621731-22621753 GCCCCACAGCCCCATGGGGCAGG + Intergenic
903999210 1:27328948-27328970 GCCCTACAGGACCTGGGTGCTGG - Intronic
904001653 1:27342223-27342245 ACCCTCCAGCACCTTGGGGTTGG + Intronic
904339708 1:29826854-29826876 GCCACACAGCACGTTGGGGCAGG + Intergenic
905356689 1:37389816-37389838 GCCCTTCTGCATCCTGGGCCAGG + Intergenic
905481476 1:38264947-38264969 GCCCTACTACTCACTGGGGCGGG - Intergenic
905967862 1:42114422-42114444 GCCCTGCCCCACCCTGGAGCAGG + Intergenic
906210738 1:44011092-44011114 GCCCCACAGCACCCAGTGCCAGG + Intronic
909344114 1:74565412-74565434 GGCCTCCAGCAGCCTGGGGTGGG + Intergenic
912562557 1:110561079-110561101 GCCCTCCAGCCCCGTGGGGTAGG + Intergenic
915535788 1:156534576-156534598 CTCCTACAGCACGCTGCGGCTGG - Exonic
917118770 1:171627620-171627642 GGCCTTCAGCAGCATGGGGCAGG + Intergenic
920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG + Intronic
920740849 1:208579811-208579833 GCCCTACAGCATCTTGGGACAGG - Intergenic
921908916 1:220527466-220527488 GCCCTGCAGCACCCTCGGAGTGG - Intergenic
922606426 1:226892491-226892513 GCCAGGCAGCACCCTGGAGCAGG + Intronic
1063081060 10:2767480-2767502 GACATACAGCACCCTGGGGATGG - Intergenic
1064306091 10:14167862-14167884 GCCCTATAGCTCCCTGAGCCTGG - Intronic
1065879793 10:30028642-30028664 GCCCCACAGCCACCGGGGGCTGG + Exonic
1069565657 10:69461740-69461762 ACCCTACTGCACCCAGGGGATGG - Intronic
1069740666 10:70685169-70685191 GGCCTGTACCACCCTGGGGCTGG - Intronic
1069748123 10:70728850-70728872 GCCCTACAGTACCCCGGCCCTGG - Intronic
1070244771 10:74720580-74720602 GCTCTACAGCAACCTGAGCCAGG - Intergenic
1071365796 10:84899560-84899582 GACTTCCAGAACCCTGGGGCTGG + Intergenic
1074121788 10:110498569-110498591 GCCCTCCTACACCCTGGGACCGG + Intronic
1074562210 10:114544497-114544519 GACCCAGAGCACCCTGTGGCCGG - Intronic
1075056628 10:119223488-119223510 GCTCTATAGAACCCTGGAGCTGG + Intronic
1075561699 10:123473043-123473065 GCCCGGCAGAGCCCTGGGGCAGG - Intergenic
1077011700 11:381659-381681 TGCCTGCAGGACCCTGGGGCCGG - Exonic
1077196562 11:1283899-1283921 GCCCTCCAGCTTCCTGAGGCTGG - Intronic
1077341769 11:2029400-2029422 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1078413618 11:11147693-11147715 AGCATGCAGCACCCTGGGGCTGG - Intergenic
1081567901 11:44270968-44270990 CCCCTGCAGCCCCCTGGAGCAGG + Intronic
1083264842 11:61541974-61541996 GCCCTAGAGCACTGAGGGGCAGG + Intronic
1084276220 11:68052227-68052249 TCCCTAAACCACCCTGGGCCCGG - Intergenic
1084546429 11:69817320-69817342 GCACCACAGCACCCCTGGGCTGG - Intronic
1084673536 11:70621496-70621518 CCCCTACAGCACCCTTGGCGAGG + Intronic
1084734218 11:71094038-71094060 TCCCCCCAGCACCCTGTGGCGGG - Intronic
1084959780 11:72710317-72710339 GCCCTAGGTCAGCCTGGGGCAGG + Intronic
1088053296 11:105544923-105544945 GTTCTTCTGCACCCTGGGGCAGG + Intergenic
1088582547 11:111330094-111330116 GACCCAAAGCACCCTGGAGCTGG - Intergenic
1089349589 11:117814806-117814828 CCCCTCCTGCCCCCTGGGGCGGG + Intronic
1089809524 11:121120442-121120464 TCCCCACATCACCCTGGGTCGGG - Intronic
1090438219 11:126704429-126704451 CCCCTACAGCCAGCTGGGGCTGG - Intronic
1090735643 11:129610319-129610341 GCCCATCAGCACCCTGGCGGTGG - Intergenic
1202824755 11_KI270721v1_random:84589-84611 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1091687858 12:2576339-2576361 GCTCTACAGCACCCGGGTGCCGG - Intronic
1094036924 12:26081723-26081745 GCCCTGCAGAACCATGGGGGTGG - Intergenic
1095950434 12:47778982-47779004 GCTCTGGAGCACCCTGGGGATGG + Intronic
1096650683 12:53060666-53060688 ACCCTACAGCACCCGGCGACAGG + Exonic
1096847482 12:54415747-54415769 GTCCTACAGCAGCATGGGCCAGG + Intronic
1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG + Intergenic
1100915074 12:99411172-99411194 GCCTTACAAAACCCTGGGCCAGG + Intronic
1101399105 12:104372927-104372949 CCCGTGCAGCACCCAGGGGCTGG - Intergenic
1101866802 12:108526314-108526336 GCCCTACAGCATGCAGGAGCCGG - Exonic
1102168839 12:110826803-110826825 GCCTTACAGGACCCTGGGGATGG + Intergenic
1103255833 12:119540694-119540716 GCCCTACAGCGCCCTGAGGTAGG + Exonic
1103557373 12:121774825-121774847 GGCCCACAGCATCCTGGGGCCGG + Intronic
1103867545 12:124064748-124064770 ACCCAACAGCCCCCTGGGGCAGG - Intronic
1104945908 12:132414826-132414848 GCTCCACAGCTCCCTGGGGTGGG - Intergenic
1105525845 13:21177069-21177091 GCCCTACATGACCCGGGAGCAGG + Exonic
1113268508 13:108645924-108645946 ACCTTCCTGCACCCTGGGGCAGG - Intronic
1113850530 13:113415067-113415089 GCCCAGCAACCCCCTGGGGCAGG + Intergenic
1114487612 14:23072296-23072318 GCCCGAGTGGACCCTGGGGCAGG - Intronic
1114648023 14:24266506-24266528 GGCCTGCAGCACCTGGGGGCAGG + Exonic
1115754204 14:36517368-36517390 GCCCTGCAGCGCCGCGGGGCTGG + Exonic
1117495341 14:56296743-56296765 GCCCCACAGGACACTGAGGCCGG - Exonic
1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG + Intergenic
1118401265 14:65381726-65381748 GCCCTGGAGCAGCCTGGGGTGGG - Intergenic
1118760953 14:68879897-68879919 GCCCTCCAGGGCCCTGGGGCAGG + Intronic
1121536528 14:94694912-94694934 GCCCTGCAACAACCTAGGGCTGG + Intergenic
1121801936 14:96781742-96781764 GCCCAGCAACACCCGGGGGCAGG + Intergenic
1122930048 14:104928948-104928970 GCCCCACCGCATCCTGGTGCTGG + Intronic
1123499243 15:20865747-20865769 GCCCCACACCACCCTGGGTGTGG - Intronic
1123556478 15:21439366-21439388 GCCCCACACCACCCTGGGTGTGG - Intronic
1123592719 15:21876712-21876734 GCCCCACACCACCCTGGGTGTGG - Intergenic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1124223809 15:27871556-27871578 GCCCGGCAGACCCCTGGGGCTGG + Intronic
1124249627 15:28098360-28098382 GCCATCCAGGACCCTGGGACGGG - Intronic
1125914668 15:43474894-43474916 CCCCAACAGCAACCTGAGGCTGG + Intronic
1127591283 15:60426013-60426035 GCTCTACAACAACCTGGGCCTGG + Intronic
1127849517 15:62900928-62900950 ACCCCACAGCAGTCTGGGGCTGG + Intergenic
1127861925 15:63000918-63000940 GTCCTACAGCAATCTGGGGTTGG + Intergenic
1129772826 15:78213577-78213599 GCCCTAGGGCAGGCTGGGGCGGG - Intronic
1130094357 15:80844867-80844889 GCCCATGGGCACCCTGGGGCTGG - Intronic
1131922930 15:97350091-97350113 ACTTTGCAGCACCCTGGGGCAGG + Intergenic
1202964820 15_KI270727v1_random:166555-166577 GCCCCACACCACCCTGGGTGTGG - Intergenic
1132502194 16:289498-289520 CCCCTACCGCACCCTGGTGAGGG - Exonic
1132582698 16:692810-692832 GCCCTGGAGCTTCCTGGGGCTGG + Exonic
1133006049 16:2882543-2882565 GCCCCACAGCTCCCTGTGCCCGG + Intergenic
1133412620 16:5580793-5580815 GCCCTACAGCTTCCTGGGTCTGG - Intergenic
1135828619 16:25753421-25753443 GCCTCACAGCTCCCTGGTGCTGG + Intronic
1136360124 16:29773905-29773927 GCCCTACAGCTCCTTGAGGTCGG + Intergenic
1138105116 16:54283968-54283990 GGCCCACAGGCCCCTGGGGCGGG - Intronic
1141678749 16:85531627-85531649 GCCATACAGCAGTGTGGGGCCGG - Intergenic
1142029124 16:87829704-87829726 CCCCTGCAGCTCCCTGGGACTGG + Intergenic
1143486684 17:7259148-7259170 TCCCCAGAGCACCCTGGGCCTGG + Intronic
1143862547 17:9901545-9901567 TCCCTTCAGCCCCCTGGTGCTGG + Intronic
1144495189 17:15741379-15741401 GTCCTACAGCAGCCTGGGTCTGG + Intronic
1144639037 17:16927518-16927540 GTCCCACAGCAGCCTGGGTCTGG - Intergenic
1144779472 17:17800606-17800628 TCCCTACACCACGCGGGGGCTGG + Intronic
1144944162 17:18961323-18961345 CCCCTTCAGAAGCCTGGGGCTGG - Intronic
1148677448 17:49453456-49453478 GCCCTTCATCTCCCTGGGGGAGG + Intronic
1148794382 17:50190096-50190118 GGCCGTCAGCACCCTGGGGGAGG + Exonic
1150682295 17:67293623-67293645 GCCGTTCAGGACCCTGGGGCAGG - Intergenic
1150682890 17:67297319-67297341 GCCGTTCAGGACCCTGGGGCAGG - Intergenic
1151433636 17:74081146-74081168 GCCCCACAGCACCTCGGGGTGGG + Intergenic
1151551394 17:74824456-74824478 GCCCGAGAGCTCCCTGCGGCGGG - Intronic
1151579165 17:74968479-74968501 ACCCTGCAGCTCCCTGGGGTGGG - Intronic
1152039915 17:77896347-77896369 TCCCTACAGCCCTCTGTGGCGGG - Intergenic
1152140575 17:78534170-78534192 GCCCTAAATCACCCAGGGTCAGG + Intronic
1152623691 17:81378965-81378987 GGCCTGCTGCACCCTGGGGAGGG - Intergenic
1153550021 18:6252905-6252927 GCCTTAAAACCCCCTGGGGCCGG + Intronic
1154457286 18:14542501-14542523 GCCCCACACCACCCTGGGTGTGG - Intronic
1156991967 18:43419805-43419827 GCCCTGCAGCTCTCTGTGGCAGG - Intergenic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1161067832 19:2247292-2247314 GCCCTCCAGCAGCCTGGCCCAGG - Intronic
1162325757 19:9998137-9998159 TCTCTCCAGCACCCTGGGGTGGG + Exonic
1162957205 19:14106015-14106037 GCCCTTCTGACCCCTGGGGCTGG + Intronic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1164436180 19:28231685-28231707 GCCCAAGACCACACTGGGGCAGG - Intergenic
1165110509 19:33499487-33499509 GCCCTACATGTCCCTGGGACTGG + Intronic
1166813388 19:45527247-45527269 GCCCTTCACCACCCTAGGGGAGG + Intergenic
1167395327 19:49224660-49224682 GCCCTGGAGCAACTTGGGGCTGG - Intergenic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1167661709 19:50799346-50799368 GCCCTTCAGCACCTGGAGGCAGG + Exonic
1168076107 19:53981742-53981764 GCCCTACACCACCTGGGGGATGG + Intronic
925061387 2:893521-893543 GTCCTCCAGCAGCCTGGGGTGGG - Intergenic
925752999 2:7106523-7106545 GCCCTAAAGCACCCTGGAGGCGG + Intergenic
925998394 2:9310613-9310635 GCACTGCAGCTCCCTGGGGTGGG + Intronic
926873760 2:17452209-17452231 GCCTTGCAGCATCTTGGGGCAGG - Intergenic
927926792 2:27019239-27019261 ATCCTACAGCACCCTGGGCACGG - Intronic
928235656 2:29537311-29537333 GGGCAACAGCACCCTGGGCCTGG - Intronic
928360552 2:30658968-30658990 CCTCTACAGCACCCTGGGAAGGG + Intergenic
931839145 2:66130258-66130280 GCTCTCCTGCACCGTGGGGCAGG + Intergenic
935616998 2:105096488-105096510 GGCCTACAAGATCCTGGGGCAGG - Intronic
936251663 2:110872659-110872681 GCCCTGCAGCCTCCTGGAGCTGG - Intronic
938030851 2:127991908-127991930 GCCATATAGCACCGTGTGGCAGG + Intronic
938277163 2:130037198-130037220 GCCCTACGGCGCCCTGGAGCTGG + Intergenic
938328134 2:130427971-130427993 GCCCTAGGGCGCCCTGGAGCTGG + Intergenic
938361815 2:130693507-130693529 GCCCTAGGGCGCCCTGGAGCTGG - Intergenic
938412610 2:131077417-131077439 GCCCCAGAGCACCCGTGGGCTGG + Intronic
938438221 2:131300191-131300213 GCCCTACGGCGCCCTGGAGCTGG - Intronic
942641306 2:178063647-178063669 GCCCTAAATCACCCAGGGCCAGG - Intronic
946411481 2:219517325-219517347 GCCCTCTGGTACCCTGGGGCTGG + Intronic
946690872 2:222307288-222307310 GCCCAGCAGCACAATGGGGCAGG - Intergenic
947116647 2:226778740-226778762 GCCCTAGAGAAGACTGGGGCTGG - Intronic
948577914 2:238965973-238965995 GCCCTCCAGCCCCCGTGGGCAGG + Intergenic
948947012 2:241225771-241225793 GGCTCACAGCGCCCTGGGGCTGG + Intergenic
1169198137 20:3694251-3694273 GGCCTCCAACACCCTGGGCCAGG - Exonic
1172658390 20:36550270-36550292 GCCCTCCACCTGCCTGGGGCTGG - Exonic
1172767701 20:37359540-37359562 GCCATGCAGCTCCCTGGGGAGGG + Intronic
1172775031 20:37402359-37402381 GCCACAGAGCACTCTGGGGCTGG - Intronic
1172973335 20:38888979-38889001 GCCCTACTGAGCCCTGGGGAAGG - Intronic
1173906259 20:46631932-46631954 GTTCTCCAGGACCCTGGGGCAGG + Intronic
1175423678 20:58851419-58851441 GACCTGCAGAACCCTGGGGGAGG - Intronic
1175895052 20:62332467-62332489 CCCCCACAGCACCCTGTGCCGGG - Exonic
1175926521 20:62474167-62474189 GCCTCACAGCCCCCTGGGGCCGG + Intronic
1175938147 20:62524599-62524621 GACTTACAGCAGCCTGGGGGAGG - Intergenic
1176816873 21:13610852-13610874 GCCCCACACCACCCTGGGTGTGG + Intronic
1177765334 21:25450805-25450827 GTCCTACAGAACTCTAGGGCAGG + Intergenic
1179889875 21:44330124-44330146 ACCCTCCAGCTCCCGGGGGCTGG + Exonic
1179996756 21:44977759-44977781 GCCCTGCAGGGCCCTGGGACGGG - Intergenic
1180190241 21:46159458-46159480 GCCCTCAATCACCCTGGGGCAGG + Intergenic
1180303234 22:11054006-11054028 GCCCGACAGCCTCCTGAGGCTGG - Intergenic
1180848386 22:18997205-18997227 CCCCTACAGTTCCATGGGGCAGG - Intergenic
1183172625 22:36199133-36199155 GCCCCCCAGAACCCTGGGTCAGG + Intronic
1183210602 22:36449067-36449089 GACCTACAGCTTCTTGGGGCGGG - Intergenic
1183376364 22:37467728-37467750 GCCCTGCAGCCCCGTGGGGCTGG - Intergenic
1183743439 22:39680414-39680436 GCCCTGCAGCCACCTGAGGCTGG - Intronic
1183829764 22:40411551-40411573 GCCCAGCAGCACCATGGGCCTGG - Exonic
1184259885 22:43308705-43308727 GCCCAGCTGCACCCTGGGGGAGG - Intronic
1184407553 22:44308615-44308637 GCCCGAGATCACCCTGGGGACGG - Intronic
1184446551 22:44550858-44550880 GCCCTCCTGAAGCCTGGGGCAGG + Intergenic
1185087851 22:48750225-48750247 GCCTGACAGTCCCCTGGGGCAGG - Exonic
950128038 3:10522729-10522751 GCCTCACAGCAGCCTGGGGCAGG + Intronic
952284176 3:31952495-31952517 GCCCACCAGCAACTTGGGGCAGG + Intronic
952485689 3:33807544-33807566 CACCTACGGCCCCCTGGGGCAGG + Intronic
954708155 3:52492042-52492064 CCCCTGCAGCACCCAGGGGGTGG - Exonic
954754050 3:52829493-52829515 ACCCTACAGCACCACAGGGCAGG + Intronic
954849778 3:53590420-53590442 GCCCTATACAACCCTGGGCCAGG - Intronic
955701195 3:61683978-61684000 GCCCTACGGTACCATGGAGCTGG - Intronic
956182684 3:66532283-66532305 GCCCTAAATCACACTGGGCCAGG + Intergenic
956775806 3:72564600-72564622 CCCTTACAGCACCGTGGGTCAGG - Intergenic
958004290 3:87792776-87792798 GCCCTCCCGCGCCCCGGGGCTGG + Intergenic
961205211 3:125076254-125076276 GGCCTGCAGCAGCCTGAGGCAGG - Intergenic
961373834 3:126449498-126449520 CACCTGCAGCAGCCTGGGGCAGG - Intronic
962479803 3:135788466-135788488 GCTCTGCACCACCCTGGGGGTGG + Intergenic
968451263 4:677094-677116 CCCCTGCAGCACCGAGGGGCAGG + Intronic
968509428 4:988851-988873 GGCCTCCAGCTCCCTGTGGCGGG + Exonic
968653708 4:1769881-1769903 GCCCTTCAGCCCCCCGAGGCAGG + Intergenic
968896931 4:3409780-3409802 GCCCCACTGCACGCTGTGGCTGG - Intronic
968907718 4:3462395-3462417 GGCCTCCACCACCCTGGGGTTGG - Intergenic
969463050 4:7338925-7338947 GACCAACAGCTCCCTGGTGCGGG - Intronic
969868543 4:10091048-10091070 GCCTTGCAGCACCCAGGTGCGGG - Intronic
970152160 4:13101275-13101297 GCCCTACAGCATCTTGGGGCAGG + Intergenic
972533012 4:39977411-39977433 TCCCTCCAGCAGCCTAGGGCGGG + Intronic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
976609118 4:87011136-87011158 GCCCTTCTCCACCCTGGGGCAGG + Intronic
977093752 4:92713629-92713651 GACCTACAGCTCCATGTGGCTGG + Intronic
981010862 4:139923263-139923285 GCCCTACTGCAGGGTGGGGCTGG - Intronic
982201730 4:152968136-152968158 TCCCAGCAGCACCCCGGGGCTGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
985958669 5:3283310-3283332 ACCTCACAGCACCCTGGGGGTGG - Intergenic
989802946 5:45566758-45566780 GCCCTTCTGCACTCTGGGACGGG + Intronic
997198237 5:131993871-131993893 GCTCTGCAGCAGCCTTGGGCAGG - Intronic
998006301 5:138659300-138659322 TCCCATCAGCACCCTGGGGTGGG - Intronic
998424166 5:142012909-142012931 GCCCTACGGCACTCGGGGTCGGG - Intronic
1001292313 5:170472337-170472359 GACCTACAGGACTGTGGGGCAGG - Intronic
1002042867 5:176527576-176527598 GCCCCACGGCAGGCTGGGGCGGG + Exonic
1002070738 5:176677681-176677703 TCCCTACAGGGCACTGGGGCTGG - Intergenic
1002279511 5:178122275-178122297 GCCCTTCGGGACCTTGGGGCTGG - Exonic
1002327817 5:178420982-178421004 GCCCTGCGGCTCCCTGGGGTTGG - Intronic
1003113464 6:3267370-3267392 GCCCTTCAGAACCCTGGGTCTGG + Intronic
1006358662 6:33575428-33575450 CTCCTACAGCACCATGGGGCAGG - Exonic
1006359619 6:33579958-33579980 TCCCTGCCCCACCCTGGGGCTGG + Intronic
1006514405 6:34538078-34538100 GGCCTTCGGGACCCTGGGGCAGG - Exonic
1007252031 6:40502290-40502312 GACCTACACCACCCTGGCTCTGG - Intronic
1010316086 6:74452219-74452241 GCCCCACAGCATCCGGGGGTGGG - Intergenic
1011259562 6:85456925-85456947 ACCCCACAGCACCCTAGGGGTGG - Intronic
1013072227 6:106739700-106739722 GCACTGCAGCACCCAGGCGCTGG - Intergenic
1017792031 6:157808749-157808771 GCCCTGCAGAAGCCTGGTGCTGG - Intronic
1018197679 6:161369018-161369040 GCCCCCCAGGTCCCTGGGGCTGG - Intronic
1019505539 7:1388697-1388719 TACCTACTGCACACTGGGGCAGG - Intergenic
1022514816 7:30968920-30968942 GCCCAACACCACCCTGGGTATGG + Exonic
1025198192 7:56947706-56947728 TCTCAACAGCCCCCTGGGGCGGG - Intergenic
1026524190 7:71140315-71140337 GTCCTCCAGCACCCTGGCCCTGG - Intronic
1029187062 7:98746876-98746898 TCCCCACTGGACCCTGGGGCAGG + Intergenic
1030329791 7:108259037-108259059 GCCCAACAGCCACATGGGGCTGG + Intronic
1031483207 7:122302137-122302159 GCACGACAGCAGCCTGGGGCTGG - Exonic
1034412869 7:150950409-150950431 GCCCTTCAGCACCTGGGGGCAGG + Exonic
1034474649 7:151275471-151275493 GTCCCGCAGGACCCTGGGGCCGG - Intronic
1034704668 7:153129907-153129929 GCCCTAAATCACCCAGGGCCAGG + Intergenic
1037579450 8:20235982-20236004 GACCCCCAGCACCCTGGGGGTGG - Intergenic
1041724406 8:61004737-61004759 CCCGTAACGCACCCTGGGGCAGG + Intergenic
1042847984 8:73187325-73187347 GCCTCACTCCACCCTGGGGCTGG - Intergenic
1048188984 8:132271221-132271243 GCCCTTGACCACCCTGTGGCAGG - Intronic
1049303656 8:141885288-141885310 GCCCTGCAGGATTCTGGGGCTGG + Intergenic
1049374116 8:142280962-142280984 ACCCTGCTGCTCCCTGGGGCGGG - Intronic
1049688119 8:143947131-143947153 CACCTAGAGCACCCTGTGGCTGG + Intronic
1049726224 8:144147732-144147754 GGACTGCAGCACCCCGGGGCTGG + Intergenic
1053470589 9:38343524-38343546 TCCCCAGAGCACTCTGGGGCTGG + Intergenic
1056042499 9:82682755-82682777 GCCCCACTGCACCCTGTGGGAGG + Intergenic
1056822184 9:89851073-89851095 GCCCCACAGACCCCAGGGGCAGG + Intergenic
1057442146 9:95090602-95090624 CCTCGCCAGCACCCTGGGGCCGG + Intergenic
1059539813 9:115118789-115118811 GCCCTGCAGGACACTGGGGCTGG - Intergenic
1061072938 9:128322907-128322929 GGCCTACAGCGGCCTGCGGCAGG + Exonic
1061538956 9:131267037-131267059 GCACCACACCTCCCTGGGGCCGG + Intronic
1190292235 X:49000739-49000761 GCCCTATAGGACCCTGAGGCTGG + Intronic
1192269483 X:69565215-69565237 GCCCTAGAGCATCTTGGAGCAGG - Intergenic
1197706954 X:129641024-129641046 TCCCTACAGGTCCCTGGGTCAGG + Intergenic
1197750654 X:129961432-129961454 GCCCTAGGGCAAGCTGGGGCAGG + Intergenic
1200123889 X:153804180-153804202 GCCCGAGAGCCCCCTGCGGCGGG - Exonic
1200281485 X:154780871-154780893 GCCATACTGCACCCCAGGGCGGG + Intronic
1202018294 Y:20435049-20435071 GCCCTCTTGCAGCCTGGGGCAGG + Intergenic