ID: 920284928

View in Genome Browser
Species Human (GRCh38)
Location 1:204872480-204872502
Sequence CTGGTGAGACAGCTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 445}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920284919_920284928 26 Left 920284919 1:204872431-204872453 CCTGGGAGCACTGTTTCTGTGGT 0: 1
1: 0
2: 0
3: 15
4: 190
Right 920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG 0: 1
1: 0
2: 4
3: 49
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920284928 Original CRISPR CTGGTGAGACAGCTGGGGCT GGG Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900318348 1:2070409-2070431 CTGGTGGGACCCCTGGGGTTTGG + Intronic
900503253 1:3016821-3016843 CGGGGGAGAATGCTGGGGCTTGG + Intergenic
900594111 1:3472648-3472670 CTGGTGCGGCAGCGGGGGCCCGG + Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900708514 1:4095647-4095669 TTGGTGAGACAACTGGGGATTGG + Intergenic
902036037 1:13458793-13458815 CTGATGGGTAAGCTGGGGCTGGG + Intergenic
902129047 1:14242745-14242767 TTTCTGAGACAGCAGGGGCTGGG - Intergenic
902163434 1:14550894-14550916 CTGGGGAGAGAGCTGGGGATGGG - Intergenic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902392986 1:16116905-16116927 CTGGGGAGACAGCAAGGGGTGGG - Intergenic
902631174 1:17705551-17705573 CTGGGGCTAGAGCTGGGGCTGGG + Intergenic
902922521 1:19675226-19675248 CAGATGAGACAACTGAGGCTCGG - Intronic
903451183 1:23454846-23454868 CAGATGAGAGACCTGGGGCTTGG + Intronic
903461963 1:23526511-23526533 CGGGGGAGACAGGTGTGGCTGGG - Intronic
903891519 1:26573321-26573343 CTGGTGGGACAGCTGGCTTTGGG - Exonic
904198537 1:28804117-28804139 CTGTTGAGTCGGCTGGGGATTGG + Intergenic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
904375778 1:30081530-30081552 CAGGTGAGTCAACTGAGGCTTGG - Intergenic
904377134 1:30088812-30088834 CAAGTGAGAATGCTGGGGCTGGG - Intergenic
904745946 1:32711192-32711214 CTGATGAGAAAACTGAGGCTTGG + Intergenic
905371592 1:37485387-37485409 GTGCAGAGACAGCGGGGGCTTGG - Intergenic
905535232 1:38715941-38715963 CTGGAGAGACCACTGGGGCTTGG - Intergenic
905959923 1:42035441-42035463 CTGGCGCGACAGCGGGGGCCGGG - Intronic
906062119 1:42955758-42955780 GGGGTGAGACATCTGGGGCAGGG + Intronic
906195635 1:43929060-43929082 CTGGTGAGAGTCCTGGGGTTAGG + Intronic
907248294 1:53121811-53121833 CTGGTGAGTCACCTGGGACGCGG + Intronic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
907485759 1:54777054-54777076 CTGTTCAGACAGCAGGGGCCAGG - Intergenic
907937618 1:59056948-59056970 CTGATGAGACAGCTGCAGTTTGG + Intergenic
909400653 1:75225899-75225921 CTTATGAGACAGCCGGGGGTGGG + Intronic
910289901 1:85589457-85589479 GTGCTGAGCCACCTGGGGCTTGG - Intergenic
910540529 1:88350858-88350880 CTGGTGAGCCAGATGGGGTGGGG + Intergenic
913130494 1:115834286-115834308 CCGCTGGGCCAGCTGGGGCTAGG + Intergenic
914343957 1:146782181-146782203 CGGGTGAGACAGCTGGGGACGGG - Intergenic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
915075402 1:153304437-153304459 CTCATTTGACAGCTGGGGCTAGG - Intronic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
917980819 1:180267887-180267909 TAGGTGAGCCAGCTGGAGCTGGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920557396 1:206914161-206914183 TTGGAGAGACGGCTGGAGCTGGG - Intronic
922803956 1:228376281-228376303 CTGGGGAGACAGCTGCTCCTGGG + Intronic
924164265 1:241265542-241265564 CAGGCAAGACGGCTGGGGCTGGG + Intronic
924886417 1:248222119-248222141 CTGGATAGACAGCTGTGCCTGGG + Intergenic
1062995131 10:1858479-1858501 CAGGTGAGAAAACTGAGGCTGGG + Intergenic
1064179549 10:13102278-13102300 CTGGTGGGTCAGTTGGGCCTGGG + Intronic
1064245619 10:13665711-13665733 CTGGAAGGACAGGTGGGGCTGGG - Intronic
1064575987 10:16747007-16747029 CTTATGAGACAGATGGGGGTTGG - Intronic
1065032520 10:21602314-21602336 CGGGGGAGCCAGCTGGGGGTAGG - Intronic
1065930292 10:30473013-30473035 CACGGGAGACAGCTGGGGCCAGG + Intergenic
1066476563 10:35752677-35752699 CACGTGGGCCAGCTGGGGCTGGG + Intergenic
1066613593 10:37275470-37275492 ATGGGGAGGCAGCTGAGGCTCGG + Intronic
1067683561 10:48454704-48454726 CTGGTGTGACAGCCAGAGCTGGG + Intronic
1067908379 10:50318332-50318354 CAGGTGAGAAAACTGAGGCTAGG - Intronic
1069411103 10:68154336-68154358 CTGCTGAAGCAGCTGGGGCCAGG - Intronic
1069548975 10:69349311-69349333 CTGGTGAGGCAGGTGGGGCAGGG - Intronic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1070281158 10:75049881-75049903 CTGGAAAGCCAGCTTGGGCTGGG + Intronic
1070383849 10:75906044-75906066 CTGGGGTGAGAGCTGGGACTGGG - Intronic
1070511357 10:77164007-77164029 CTGATGAGAAAACTGGGGCCTGG - Intronic
1070644234 10:78190411-78190433 ATGGTGAGACAGGTGGGACCAGG - Intergenic
1071366303 10:84903908-84903930 CAGGTGACCCACCTGGGGCTGGG + Intergenic
1071507749 10:86242930-86242952 TTGGTGAGGCAGGTGGGGCTGGG - Intronic
1072115502 10:92366742-92366764 GTGCAGAGACACCTGGGGCTGGG + Intergenic
1072310508 10:94149828-94149850 CTTCAGAGACAGCAGGGGCTGGG + Intronic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072811173 10:98463264-98463286 CTGGAGAGGTAGCTGGAGCTGGG - Intronic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073229940 10:101960538-101960560 CTGGTGACTAAGCTGGGACTAGG + Intronic
1073321581 10:102619333-102619355 CTGGGGAGCCAGCGGGTGCTGGG - Intronic
1073327421 10:102650777-102650799 CTGGGGAGGCAGGTGGGGGTTGG + Intronic
1073441892 10:103557078-103557100 CAGGTGAGAAAACTGAGGCTCGG - Intronic
1074922089 10:118024915-118024937 CTGCAGAGATGGCTGGGGCTAGG - Intronic
1075704235 10:124489892-124489914 CCAGTGAGAAAGCTGAGGCTGGG - Intronic
1076429062 10:130388912-130388934 CAGGTGAGACTGCTGGGGTGAGG + Intergenic
1076463775 10:130664616-130664638 CTGGTGAGGCTCCTGGGGCTTGG + Intergenic
1076716775 10:132369958-132369980 ATGGAGAGACAGGTGTGGCTGGG - Intronic
1077632009 11:3817300-3817322 CTGGTAGGACACCTGGGTCTGGG - Intronic
1078105748 11:8357045-8357067 GGAGGGAGACAGCTGGGGCTTGG - Intergenic
1079096235 11:17512161-17512183 GTGGTGAGAGAGCTGGGGGAGGG - Intronic
1079152462 11:17912881-17912903 CTAATGAGAAAACTGGGGCTAGG - Intronic
1079201887 11:18383639-18383661 CTGGAGAGGAAGCTGAGGCTGGG + Intergenic
1079252243 11:18794753-18794775 CACATGTGACAGCTGGGGCTGGG - Intergenic
1081668833 11:44932156-44932178 CTGGGGAGACGGCGGGTGCTGGG - Exonic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083605451 11:63975962-63975984 AAGGAGAGACAGCTGGGGTTAGG - Intronic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1083659600 11:64246023-64246045 CTGGTAGGACGGCTGCGGCTGGG - Intronic
1083899551 11:65636950-65636972 CTGGTGTTCCAGCAGGGGCTGGG - Exonic
1084947438 11:72646115-72646137 CTGGGAGGAAAGCTGGGGCTGGG - Intronic
1085041266 11:73327743-73327765 CTGGTGAGTCAGCAAGGGCCAGG + Intronic
1085386360 11:76160451-76160473 CTGGAGAGAGACCTGGGGCCCGG + Intergenic
1086434554 11:86768558-86768580 CAGGTGAGAAAACTGAGGCTTGG + Intergenic
1088154738 11:106789871-106789893 GTGCTGAGCCACCTGGGGCTTGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090529727 11:127578193-127578215 CTCGTGAGACTCCAGGGGCTCGG + Intergenic
1090759004 11:129819351-129819373 GAGGTGAGAAGGCTGGGGCTGGG + Intronic
1091754416 12:3042338-3042360 TTGGTAAGACAGTGGGGGCTGGG - Intergenic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1092260393 12:6950498-6950520 CTGGTGGGAGTGCTGGGGCAGGG + Intronic
1092281596 12:7101794-7101816 CTTGAGTGACAGCTGAGGCTGGG - Intronic
1095420211 12:42017542-42017564 CAGATGAGACAGCTGAGGTTAGG - Intergenic
1096090227 12:48894529-48894551 CTGGTGCCACATCTGGGCCTGGG - Intergenic
1096192683 12:49630687-49630709 CTGGTGATGCAGCAGTGGCTAGG - Intronic
1096234141 12:49914324-49914346 CTTGTGAAACAGCTTTGGCTGGG - Intergenic
1096804594 12:54132925-54132947 CTTGTCAACCAGCTGGGGCTGGG - Intergenic
1097249535 12:57624947-57624969 CTGGAGTGGCACCTGGGGCTCGG + Exonic
1099975040 12:89537713-89537735 CTGGTGAGACAGTTGGGCACAGG + Intergenic
1101921960 12:108940552-108940574 CTGGGGAGATAACTGGGGATGGG - Intronic
1102008914 12:109606320-109606342 CTGGGGAGTGAGCTGGGGCATGG + Intergenic
1102025034 12:109709637-109709659 CAGGTGAGGCAACTGGGGGTGGG + Intergenic
1102207861 12:111102661-111102683 ATGGGGAGAAAGCTGAGGCTTGG + Intronic
1103632039 12:122269368-122269390 GTGGTGAGAGAGCTGGGGTGGGG - Intergenic
1103878460 12:124147645-124147667 CTGGTCAGCCAGCTGAGTCTAGG + Intronic
1103885392 12:124196578-124196600 CTGGTGAGTCAGCTGGGGGCTGG + Intronic
1104972513 12:132538370-132538392 GTGAAGAGACAGCTGGGGATGGG - Intronic
1105389453 13:19960176-19960198 CTGGTGAGGCAGCTGGGAGTGGG + Intronic
1105618753 13:22046697-22046719 CTGGTCAGATGACTGGGGCTTGG - Intergenic
1106180990 13:27369212-27369234 CAGGTGAGGCAGCCGTGGCTTGG - Intergenic
1106758486 13:32845334-32845356 CAGGTGATACAGCTTGAGCTGGG - Intergenic
1106853251 13:33818263-33818285 CTGGTGAGTCTGCGGGGGCCGGG + Exonic
1107086310 13:36431475-36431497 CGGGCGACAGAGCTGGGGCTTGG - Intergenic
1107727000 13:43308919-43308941 TTGCTGAGAAAGCTGAGGCTTGG + Intronic
1108579545 13:51817102-51817124 CAGGAGAGACACCTGGGGCGTGG + Intergenic
1109940092 13:69350440-69350462 CTGGAGAGAAATCTGGAGCTGGG + Intergenic
1112441677 13:99428657-99428679 CTGGTGAGACCGCTTGGGGCAGG - Intergenic
1114032110 14:18586981-18587003 CTAGGTAGACACCTGGGGCTTGG + Intergenic
1114221247 14:20699411-20699433 CTGCTGACCCTGCTGGGGCTGGG + Exonic
1115481238 14:33863176-33863198 CTGGTGGGTCAGCTGGGGGCTGG - Intergenic
1119264519 14:73256070-73256092 CTGGTGCCTCAGCTGGGGCCTGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119558717 14:75572937-75572959 CCAGTGAAACAGCTGGAGCTCGG + Intergenic
1120443277 14:84564191-84564213 CTGGTGTGGCAGTTGTGGCTCGG + Intergenic
1121554904 14:94829127-94829149 CAGGTGAGGCTGCAGGGGCTGGG - Intergenic
1121640079 14:95479490-95479512 CTGGTGAGACAGCTGCTGTCTGG - Intergenic
1122065514 14:99170836-99170858 CTGGTGATTCAGCTGGGTCCAGG - Exonic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1122687930 14:103518799-103518821 TAGGTGAGCCAGCGGGGGCTAGG - Intergenic
1122795059 14:104201853-104201875 GTGGTGGGCCAGGTGGGGCTGGG - Intergenic
1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG + Intergenic
1122853423 14:104548642-104548664 CTGGGGAGAACGCTGGGGCTGGG - Intronic
1122853452 14:104548714-104548736 CTGGGGAGAATGCTGGGGCTGGG - Intronic
1122853489 14:104548798-104548820 CTGGGGAGAACGCTGGGGCGGGG - Intronic
1122853509 14:104548840-104548862 CTGGGGAGAACGCTGGGGCGGGG - Intronic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1126419316 15:48454873-48454895 CTGGTGAGTGAGGTGGTGCTGGG - Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127727891 15:61768279-61768301 CTGGTGTCAGAGCTGGGGCAGGG - Intergenic
1127773261 15:62247009-62247031 CAGGTGGGTAAGCTGGGGCTGGG - Intergenic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128395242 15:67218329-67218351 CAGGTGATAAAGCTGGGGCAGGG + Intronic
1128751466 15:70153116-70153138 CTGATGAGGCACCTGGGGCTGGG - Intergenic
1129389758 15:75214662-75214684 CAGGAGAGACAGGAGGGGCTTGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129496125 15:75982826-75982848 GTGGGGAGACAGCTTGGGCTTGG - Intronic
1129722441 15:77885206-77885228 CTGGGGAGTCAGAGGGGGCTGGG + Intergenic
1130441030 15:83954865-83954887 CTGCTGAGCCACCTGGAGCTGGG + Intronic
1130857508 15:87854042-87854064 CAGGTGAGAAAACTGGGGTTTGG - Intergenic
1131191244 15:90318672-90318694 CTGGAGAGACAGGCTGGGCTGGG - Intergenic
1132464904 16:72783-72805 CTGCGGGGACACCTGGGGCTGGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133027587 16:2995435-2995457 CAGGTGAGACAGATGGGGTCTGG + Intergenic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133267659 16:4594558-4594580 CTGGTCCCACACCTGGGGCTGGG - Intronic
1134147870 16:11781879-11781901 ATGATGAGACAGCTGTGGTTTGG - Intronic
1135470191 16:22723088-22723110 GTGGGGAGGCAGCTGAGGCTTGG + Intergenic
1135511854 16:23092116-23092138 CTGGTGAGGAAGCTGAGACTTGG - Intronic
1136569150 16:31086492-31086514 CTGGTGAAAGAGACGGGGCTGGG + Intronic
1136628481 16:31476206-31476228 CTGGTGAGATAGGGCGGGCTCGG - Intronic
1137921498 16:52493600-52493622 CTGGTGAGAAAAAAGGGGCTAGG - Intronic
1138387167 16:56643580-56643602 CTGGTGCGAGACCTGGGGCGGGG + Intronic
1139015375 16:62683832-62683854 CTGTGGAGCCAGCAGGGGCTGGG + Intergenic
1139286769 16:65822373-65822395 CTGGTGAGACAGCTGTGGGCTGG + Intergenic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1139604646 16:68009470-68009492 CAGCTGGGACAGCTGGTGCTGGG - Intronic
1139990038 16:70933154-70933176 CGGGTGAGACAGCTGGGGATGGG + Intronic
1141650935 16:85392826-85392848 CTGGAGAGGCGGCTGGGGCCAGG + Intergenic
1142115267 16:88353024-88353046 CCGGTGAGACTGCAGGGTCTGGG + Intergenic
1142495748 17:305452-305474 CTGGTGGGACGTCAGGGGCTAGG - Intronic
1142613148 17:1120086-1120108 CAGGTGCGAAAACTGGGGCTCGG - Intronic
1142994454 17:3752349-3752371 CGGGTGAGGAAGCTGGGGCTCGG - Intronic
1143866073 17:9925156-9925178 CTGGTCAGAGATCTGGGGCTTGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146194330 17:30798609-30798631 CTGGTGGGTCACCTGGGGTTGGG + Intronic
1146874084 17:36394100-36394122 CTCGTGAGACTGCAGAGGCTTGG - Intronic
1146881438 17:36445011-36445033 CTCGTGAGACTGCAGAGGCTTGG - Intergenic
1147006907 17:37410628-37410650 CAGTTGAGCCACCTGGGGCTAGG + Intronic
1147065302 17:37918773-37918795 CTCGTGAGACTGCAGAGGCTTGG + Intergenic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147540181 17:41350724-41350746 CTGGTGCGGCAGCTCAGGCTGGG + Exonic
1147542196 17:41369707-41369729 CTGGTGCGGCAGCTCAGGCTGGG + Exonic
1147545409 17:41397496-41397518 CTGGTGCGGCAGCTCAGGCTGGG + Exonic
1148623933 17:49054677-49054699 CTGGAGTGAGACCTGGGGCTTGG + Exonic
1148838060 17:50476826-50476848 CTGCTGAGGCAGCTGGGGGATGG + Intergenic
1149578160 17:57728509-57728531 CTAGGGAGGCAGCTGGGGCCAGG + Intergenic
1151495416 17:74455265-74455287 GTGGTGAGAGGGCTGGGGCAGGG + Intergenic
1151828056 17:76534729-76534751 CTGGAGAGACAGCTGTGCCAGGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1151968421 17:77444453-77444475 TTGGTGAGAGGGCTGGGGGTCGG + Intronic
1152577971 17:81151273-81151295 TGGGGGAGACAGGTGGGGCTGGG - Intronic
1154199328 18:12288242-12288264 CAGCTGAGACAGCTGGGGCGGGG + Intergenic
1157320392 18:46629765-46629787 CCAGTGAGAAAGCTGGAGCTGGG - Intronic
1157409163 18:47449271-47449293 CTGCTGAGCCAGATGGGGTTGGG + Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160386740 18:78501508-78501530 CTGGTGAGGCACTTGGGGGTGGG - Intergenic
1160781332 19:879011-879033 CTGCTGGGACATGTGGGGCTGGG - Intronic
1161079790 19:2305088-2305110 CTGCTGTGACAGCAGTGGCTGGG - Intronic
1161221148 19:3118826-3118848 CTGGTGTGGCAGGAGGGGCTTGG + Intronic
1161574809 19:5049380-5049402 CAGGGGAGACAGCTGGGGCGGGG + Intronic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162997389 19:14344847-14344869 CTGATGAGGAAGCTGAGGCTGGG - Intergenic
1163125766 19:15243392-15243414 CTGGTGACACGGCTGGGGGCCGG + Exonic
1163582645 19:18147602-18147624 CTGCTGGGACATCAGGGGCTGGG - Exonic
1163691150 19:18739162-18739184 CAGGTGAAACAGCTGAGGCCTGG - Intronic
1163702617 19:18793756-18793778 CTGGTCACAGTGCTGGGGCTTGG + Intergenic
1163717366 19:18879976-18879998 CTGGTGAGATAGGTTGGGCCAGG - Intronic
1164241504 19:23393547-23393569 CTGGTAAGATAGCTGCGTCTAGG + Intronic
1165490732 19:36121381-36121403 GTGGTGGGAGACCTGGGGCTTGG + Intronic
1165825847 19:38705336-38705358 CTAGTGAGAGAGTTGGGCCTGGG + Intronic
1165879003 19:39029807-39029829 CTGGTCACACAGCCTGGGCTTGG - Intronic
1165981466 19:39727850-39727872 CGGGATAGACAGCTTGGGCTGGG + Intergenic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166310177 19:41958408-41958430 GCGGTTAGACAGCTGGGGCTGGG + Intronic
1166566297 19:43767520-43767542 CTGGTGAGGGGGCTGGGACTTGG - Exonic
1167152854 19:47719612-47719634 CTGGCGAGAAGGCTGGGCCTGGG + Intronic
1167163007 19:47779854-47779876 CAGGTGAGAAAACTGAGGCTGGG + Intronic
1167534557 19:50041484-50041506 AAGCTGTGACAGCTGGGGCTGGG - Intronic
1167705740 19:51079886-51079908 AAGGAGAGGCAGCTGGGGCTGGG - Intronic
1168254401 19:55157830-55157852 CTGGTGATCCAGCTGGAGCAGGG - Intronic
1168351968 19:55681032-55681054 CTCGTGGGGGAGCTGGGGCTTGG + Intronic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
925532986 2:4884420-4884442 CTGGGGAGGCAGCTGAGGCCCGG - Intergenic
925743236 2:7023745-7023767 CTGATGAGAAAACTAGGGCTTGG + Intronic
926084003 2:10009866-10009888 CTGTTGGGACAGCAAGGGCTGGG + Intergenic
926226366 2:10969885-10969907 CTGGAAAGACTGCTGGGTCTAGG - Intergenic
927397122 2:22665352-22665374 CTCGAGAGACAGTTGGGGGTAGG - Intergenic
927473817 2:23397002-23397024 CTTGTCAGACACCTGGGGCCAGG - Intronic
927851613 2:26503378-26503400 CTGGTGAGAGCGCTTGGGCGAGG + Intronic
928170248 2:28998748-28998770 CTGGTGTGTCTGCTGGGGGTGGG + Intronic
928680772 2:33700151-33700173 CTGGTTGGGCAGCTGAGGCTGGG - Intergenic
928714762 2:34047605-34047627 CAGATGAGAAAACTGGGGCTTGG + Intergenic
929363239 2:41120358-41120380 CTGGTGAAACAGGTAGAGCTAGG + Intergenic
930103083 2:47617999-47618021 CGGGTGGGAGAGTTGGGGCTAGG + Intergenic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
931142968 2:59484204-59484226 CTGGTGAGGGAGCTGTGCCTGGG - Intergenic
931784624 2:65608083-65608105 CTGGTGATGCAGGTGGGGCAGGG - Intergenic
932571328 2:72940015-72940037 CTGGTGAGGAAGATGGGGCCTGG - Intergenic
933842554 2:86299113-86299135 CTGGTGGGACACCTGCAGCTAGG - Intronic
935203995 2:100881981-100882003 ATGCTGAAACTGCTGGGGCTGGG + Intronic
935553591 2:104483377-104483399 CTGGTGGGGAAGGTGGGGCTGGG + Intergenic
935837928 2:107075643-107075665 CTGGTGAGGCAGGTGGTGCAGGG + Intergenic
936634912 2:114244916-114244938 CTGGGAAAGCAGCTGGGGCTAGG - Intergenic
937004794 2:118501445-118501467 GTGGTGAGGCAGGTGGGGCTGGG + Intergenic
937430773 2:121836191-121836213 CTGGAGAGACCCCTGGGGCAGGG - Intergenic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938294936 2:130172201-130172223 GTGCTAAGACAGCTGGGGATGGG + Intronic
938461690 2:131501634-131501656 GTGCTAAGACAGCTGGGGGTGGG - Intergenic
938491489 2:131763521-131763543 CTAGGCAGACACCTGGGGCTTGG + Intronic
938583299 2:132667693-132667715 CTGATAAGACAGCTGGGGTAGGG + Intronic
938630801 2:133165064-133165086 CGGGTGTCACAGCTGGGGATGGG + Intronic
940737223 2:157467080-157467102 ATGGTGAGGCAGCTGGAGGTGGG + Intronic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
943913210 2:193594073-193594095 GTGCTGAGACACCTGGAGCTGGG - Intergenic
946371859 2:219285964-219285986 CTGGGGAGAGAGCAGGGGCGGGG - Exonic
946429218 2:219615704-219615726 CAGGTGAGGAAGCTGAGGCTTGG + Intronic
947602412 2:231462287-231462309 CAGATGAGAAAGTTGGGGCTTGG - Intronic
947764011 2:232624295-232624317 CTGGGGGGCAAGCTGGGGCTGGG - Intronic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948284601 2:236773924-236773946 CTGGGGAACCAGCTGTGGCTGGG + Intergenic
948964475 2:241366815-241366837 CAGTTGAAAAAGCTGGGGCTGGG + Intronic
1168955657 20:1832584-1832606 CCGGAGAGGGAGCTGGGGCTCGG + Intergenic
1169089520 20:2850092-2850114 CTGGTGGGTCAGCTGGGGTCAGG + Intronic
1169926146 20:10786329-10786351 CTGATGAGAAAGCTTGGGTTTGG + Intergenic
1170268148 20:14491633-14491655 CTGGTTAAACAGATGGGCCTTGG + Intronic
1171245326 20:23606140-23606162 GTGCTGGGGCAGCTGGGGCTGGG - Intergenic
1172273900 20:33669583-33669605 CTGATGGGACAGGTTGGGCTGGG - Intronic
1172781002 20:37437099-37437121 GTGGCCAGACAGCTGGGTCTGGG - Intergenic
1172910997 20:38408709-38408731 CTGGAGAAACAGCTGGGCTTTGG - Intergenic
1174421151 20:50399925-50399947 CAGGTGAGAGAGGTGGGGCTGGG - Intergenic
1174457955 20:50662755-50662777 CAGGTGAGAAAGCTGAGGCTTGG - Intronic
1174972606 20:55293306-55293328 GTGGAGAGACAGTTTGGGCTGGG + Intergenic
1175499349 20:59438891-59438913 CTGGCTGGACAGCTGGGGCCAGG - Intergenic
1176064489 20:63187607-63187629 CTGGAGAGACTGCAGAGGCTGGG - Intergenic
1176195688 20:63835579-63835601 CTGGAGCGGCAGTTGGGGCTTGG - Intergenic
1176368025 21:6045408-6045430 CTGATGAGTCAGCTGGTGCCAGG - Intergenic
1176412551 21:6457045-6457067 CAGGTGAGGCACCTGGGGCCTGG - Intergenic
1176708602 21:10132371-10132393 CTAGGCAGACACCTGGGGCTTGG + Intergenic
1179688045 21:43065367-43065389 CAGGTGAGGCACCTGGGGCCTGG - Exonic
1179755494 21:43493134-43493156 CTGATGAGTCAGCTGGTGCCAGG + Intergenic
1179960593 21:44765237-44765259 CTGGCCAGCCTGCTGGGGCTTGG - Intergenic
1180177897 21:46098888-46098910 CTGGTGGAACCGCTGGGCCTGGG + Intronic
1180456224 22:15514038-15514060 CTAGGTAGACACCTGGGGCTTGG + Intergenic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG + Intronic
1180698802 22:17770710-17770732 CTGGTGGGACAGGCTGGGCTTGG - Intronic
1181179507 22:21056922-21056944 CTGGTGAGGCTGCTGGGTCAGGG - Intronic
1181275954 22:21687768-21687790 TTGGTGGGACATCGGGGGCTGGG + Intronic
1181298486 22:21861545-21861567 GAGTTGAGACAGCTGGGGGTAGG - Intronic
1183344343 22:37298868-37298890 CAGATGAGGAAGCTGGGGCTGGG + Intronic
1183465850 22:37980073-37980095 CCTCTGAGAAAGCTGGGGCTAGG - Intronic
1183667671 22:39254794-39254816 CTGGAGAGAAAGCTGGGCCAAGG - Intergenic
1184205053 22:42996858-42996880 CAAGTGAGAAAGCTGGGCCTAGG - Intronic
1184257392 22:43294991-43295013 CAGGTGAGAAAACTGGGGCCTGG + Intronic
1184519196 22:44982422-44982444 CAGATGAGAAACCTGGGGCTCGG + Intronic
1185074488 22:48676001-48676023 CTGCTGAGGCAGCTGGCGGTGGG + Intronic
949726124 3:7047447-7047469 CTGGTGAGAGAGATGGTGGTTGG - Intronic
950114806 3:10443948-10443970 TTAGTGACACAGCTGAGGCTGGG + Intronic
950523035 3:13507682-13507704 CCAGTGAGCCAGCTGAGGCTTGG + Intergenic
950525322 3:13519608-13519630 TTGGAGAGACTGCTGGGGCTGGG + Intergenic
950542036 3:13618556-13618578 CTGGGGAGATAGCTGGGTTTTGG - Intronic
951711630 3:25589794-25589816 TTGGTGAGACAGCCTGGCCTAGG + Intronic
952007705 3:28861232-28861254 TGGGAGTGACAGCTGGGGCTGGG - Intergenic
952404216 3:32991215-32991237 CTGGTGAGACCACCGGGGCCTGG + Intergenic
952507993 3:34024931-34024953 CTGATGGGTCAGCTGGGGCCTGG + Intergenic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953690534 3:45114137-45114159 CTGCTGACAGAGCTGAGGCTGGG - Intronic
953877175 3:46673072-46673094 CTGATGAGGCAGCTGAGGCACGG + Intronic
954083772 3:48228065-48228087 GTGGTGTGACAGCTGGGGTTGGG - Intergenic
954365782 3:50145312-50145334 CTGGTGGGGCAGCTGGGGCAAGG + Intergenic
954440090 3:50516978-50517000 CTGTGGGGAAAGCTGGGGCTGGG + Intergenic
954633900 3:52061212-52061234 CTGGTGAGAGTGCAGGGCCTGGG + Intergenic
954675260 3:52311994-52312016 CTGGGGAGGGAGCTTGGGCTGGG - Intergenic
954718308 3:52538256-52538278 CTGGTGGGACACCTGGGGCAGGG + Intronic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
954914973 3:54140895-54140917 CAGCTGAGAAAACTGGGGCTTGG + Intronic
955402769 3:58605218-58605240 TGGGAGAGTCAGCTGGGGCTGGG - Intronic
955411920 3:58661343-58661365 CTGGTGAGAGACATGGGGGTGGG - Intronic
955824115 3:62926791-62926813 CCGATGAGAAAGCTGAGGCTGGG + Intergenic
956837110 3:73104409-73104431 CAGGAGAGACATTTGGGGCTGGG - Intergenic
957083095 3:75655552-75655574 CTGCTGGGCCAGCTCGGGCTGGG + Intergenic
960936517 3:122907484-122907506 CTGCTGAGCCAGCTGGGACAAGG + Intergenic
961032668 3:123620160-123620182 CTGGTGAGAAAGAAAGGGCTGGG - Intronic
961506163 3:127371887-127371909 CAGAGGAGACAGATGGGGCTGGG + Intergenic
961794888 3:129402417-129402439 CTGGCACAACAGCTGGGGCTCGG - Intronic
961813251 3:129533775-129533797 CTGGTGGGATGGCTGTGGCTGGG - Exonic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962234059 3:133692932-133692954 CCGATGAGCCAGCTGGGGCTGGG + Intergenic
962343746 3:134605325-134605347 CTGGGGAGGTTGCTGGGGCTGGG - Intronic
963248479 3:143083989-143084011 CAGGTGGGACAGCCAGGGCTGGG + Intergenic
963806660 3:149729337-149729359 CTGGTGACTCAGCTGGGGGCAGG + Intronic
963969727 3:151416331-151416353 CTGGGGAGGCTGCTGGGGCTGGG - Exonic
964872018 3:161323653-161323675 CTGGTGAGACAGCTGCGTAGTGG + Intergenic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
967758131 3:193193449-193193471 GTGCTGAGCCAGCTGGGGTTTGG - Intergenic
968503486 4:961568-961590 CTTATGCGGCAGCTGGGGCTCGG - Exonic
968573379 4:1353950-1353972 CTTGGGAGGAAGCTGGGGCTGGG - Intronic
968747236 4:2366446-2366468 TTGGTGAGACAGCAGGTGCAGGG - Intronic
969265340 4:6060833-6060855 TTGGTCAGAGAGCTGGGCCTGGG - Intronic
969538089 4:7768950-7768972 CTGGTGTCACAGCTGGAGATGGG + Exonic
970652773 4:18196909-18196931 CTGGAGAGACAGCTCCAGCTGGG + Intergenic
971158340 4:24106804-24106826 CTGGTGGGTCAGCTGGGGGCTGG - Intergenic
971265318 4:25091678-25091700 CTGGTGAGGCAGCTGGGCTCTGG + Intergenic
972094142 4:35327411-35327433 CTGGTAAGAAAGTAGGGGCTGGG + Intergenic
973720824 4:53721617-53721639 CAGGTGAGAGAGTTGGGGATTGG + Intronic
974286777 4:59879108-59879130 CTGGAGAGACAGCTCCAGCTGGG - Intergenic
975348204 4:73318393-73318415 CTGGTGACACAGCTGGGCATTGG - Intergenic
976361270 4:84181534-84181556 CTGGGTAGACAACTGGGGGTTGG - Intergenic
976647273 4:87399638-87399660 CTTGTGACAGCGCTGGGGCTGGG - Intergenic
979670653 4:123357218-123357240 TTGGGGAGCCAGCTGGGGCGAGG - Intergenic
981548496 4:145918707-145918729 CTGGGGTGAGAGCTGGGGGTGGG - Intronic
981558493 4:146022423-146022445 GTTCTGAGACACCTGGGGCTGGG + Intergenic
982313235 4:154006732-154006754 CTAGTGAGATGGCTGGGGGTTGG + Intergenic
983504086 4:168533684-168533706 CTGGAGAGATAGCTGGGCCATGG + Intronic
984187744 4:176566873-176566895 CAGTTGAGACATCTGGGGGTGGG - Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985683098 5:1266846-1266868 ACGGTAAGAAAGCTGGGGCTGGG + Intronic
986431901 5:7689570-7689592 CTGCTGAGAGAGCTGAGGGTGGG - Intronic
989466437 5:41761239-41761261 TTGGTGAGACAACTGGGCTTTGG + Intronic
990077326 5:51865131-51865153 CTGGTGGCTCAGCTGGGACTTGG - Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
990780171 5:59351946-59351968 CTGGTGAGGAAGCTGGAGGTGGG + Intronic
992606881 5:78466575-78466597 ATGGTGTGTGAGCTGGGGCTAGG + Intronic
995145908 5:108787020-108787042 CTGCAGAGCCAGCAGGGGCTGGG + Intronic
998420110 5:141977084-141977106 CAAGAGAGGCAGCTGGGGCTGGG - Intronic
999198975 5:149802681-149802703 CAGATGGGGCAGCTGGGGCTGGG + Intronic
1000138971 5:158382640-158382662 CTGGTGAGTCAGCTGGGGGCTGG + Intergenic
1001451311 5:171826863-171826885 CTGGTGAGACACCTTGGGCCAGG - Intergenic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1002193156 5:177489325-177489347 GTGGGCAGACAGGTGGGGCTGGG + Intronic
1002545983 5:179945552-179945574 CTGGTGAGAAAACAGAGGCTGGG + Intronic
1002915691 6:1526185-1526207 GTGGACAGACAGGTGGGGCTGGG - Intergenic
1003015175 6:2462316-2462338 CTGGTGAGAAAGCTGAGGAAGGG + Intergenic
1005367872 6:25097678-25097700 CTGGGTGGAGAGCTGGGGCTGGG - Intergenic
1006227598 6:32553467-32553489 CAGGTGGGAGATCTGGGGCTGGG - Intronic
1006230255 6:32580338-32580360 CAGGTGGGAGATCTGGGGCTGGG - Intronic
1006387495 6:33739453-33739475 CTGGAGCTTCAGCTGGGGCTGGG + Intronic
1006902194 6:37510469-37510491 CTGGAGAGACAGATGTGCCTGGG + Intergenic
1007041288 6:38724864-38724886 CTGGTGAGAGAGTTGGGGTGAGG + Intronic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007401690 6:41606143-41606165 CTGGGGACCAAGCTGGGGCTTGG + Intergenic
1008639632 6:53448575-53448597 TAGATGAGACAGCTGAGGCTTGG + Intergenic
1009559258 6:65218716-65218738 CTGGTGAGACATCTGAAGTTTGG - Intronic
1010211182 6:73363736-73363758 CTGGAGAGACTGCTGGGTCCCGG - Exonic
1010873742 6:81074824-81074846 CTTGAGAGAGAGCTGGGACTGGG + Intergenic
1010980618 6:82365122-82365144 CTGGTCCGGCAGCGGGGGCTGGG - Exonic
1011291066 6:85778304-85778326 CTGCTGAGCCACCTGGAGCTGGG + Intergenic
1011649430 6:89492180-89492202 CTGGAGAGAGCGCCGGGGCTGGG + Intronic
1014503400 6:122222731-122222753 CTGGTAAGACAGCAGAGGATGGG - Intergenic
1014545730 6:122733298-122733320 CTGGAGAGCCGGCTGGTGCTAGG - Intergenic
1014693963 6:124595908-124595930 CTGATTTGGCAGCTGGGGCTTGG + Intronic
1015657674 6:135538145-135538167 GAGGTAAGACAGCTGGGGGTGGG - Intergenic
1016034935 6:139375002-139375024 CGAGTGAGAAAGCTGGGGGTGGG - Intergenic
1016377932 6:143443186-143443208 CATGTGAGAGAGCTGGGACTAGG + Intronic
1016727281 6:147387906-147387928 CTGGGGAGACAGCTGAGGAAAGG + Intergenic
1017442702 6:154478413-154478435 CTGGTGAGGAAGCTGGTGCGTGG - Intronic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1018729844 6:166640494-166640516 CTCGGGAGGAAGCTGGGGCTGGG + Intronic
1019404764 7:877527-877549 CTGGGGAGAGAGCCGGGGTTGGG - Intronic
1019519335 7:1453625-1453647 ATGGTGAGACGGCTGGAACTGGG + Intronic
1019707896 7:2505100-2505122 GTGGTGGGCCAGCTGGGGCCTGG + Intergenic
1021852078 7:24818029-24818051 CAGGTGAGAGAGGTGGGTCTGGG + Intronic
1022649585 7:32262330-32262352 CTGGTGAGTGAGCAGGTGCTGGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023156279 7:37255868-37255890 CTGGTGAGAGAGTGGGGCCTGGG - Intronic
1023562634 7:41491658-41491680 CTGGGGAGACAGCAGTGGGTAGG - Intergenic
1023877412 7:44294462-44294484 ATGGTGGGAGTGCTGGGGCTTGG + Intronic
1023967014 7:44967975-44967997 CTGGTGAGGGAGCAGGGGCGGGG + Intronic
1024176707 7:46847685-46847707 CTGGTCAGACTGCAGTGGCTAGG - Intergenic
1024485698 7:49916303-49916325 CTGGTGAGACTTCTGGGCCCTGG + Exonic
1026078267 7:67193408-67193430 CTGATGACAGAGCTGGGACTTGG - Intronic
1026698553 7:72618563-72618585 CTGATGACAGAGCTGGGACTTGG + Intronic
1026897073 7:74015522-74015544 CTGGTGAGCCAGCTGTTCCTGGG - Intergenic
1029124765 7:98288260-98288282 GTGGGGACACAGCTGGTGCTTGG + Intronic
1029604257 7:101589159-101589181 CTGGAGAGAGAGCATGGGCTGGG + Intergenic
1029728970 7:102426829-102426851 CTGGGGAGGGTGCTGGGGCTTGG + Intergenic
1031480252 7:122269490-122269512 AGGGTGAGAATGCTGGGGCTTGG + Intergenic
1033163167 7:139015265-139015287 CTGGTGACAGAGCAGGGGCTGGG + Intergenic
1033225760 7:139560908-139560930 CTGGTGAGACGGCAGGGCCTGGG + Intergenic
1033324731 7:140368107-140368129 GTGGTAAGAAAGGTGGGGCTGGG - Intronic
1034436514 7:151065124-151065146 CTGATGAGGAACCTGGGGCTTGG - Intronic
1034513882 7:151558524-151558546 CGGGTGGGACAGCTGGGACTTGG + Intronic
1035110644 7:156478765-156478787 CCTCCGAGACAGCTGGGGCTGGG - Intergenic
1035734927 8:1881155-1881177 CTGGGGAGGCAGCCAGGGCTGGG + Intronic
1036700568 8:11011056-11011078 CAGATGAGAAAGCTGAGGCTTGG + Intronic
1038515987 8:28188144-28188166 GGAGTGAGACAGCTGAGGCTGGG - Intronic
1038973092 8:32659710-32659732 CTGGGGAGACAGCTGGAGTTAGG - Intronic
1038984246 8:32791570-32791592 CTGGTGGGATGGCTGGGGCTTGG - Intergenic
1039911272 8:41828816-41828838 CTGGGGAGAGAGTTGGGCCTGGG + Intronic
1041696606 8:60742724-60742746 CTGGTGAGATGGCTGAGGATGGG - Exonic
1041717375 8:60944363-60944385 TTGGAGGGACAGCTGAGGCTTGG + Intergenic
1042659306 8:71135915-71135937 CAGGTGAGGCAGCTGAGGCTTGG - Intergenic
1043148316 8:76682390-76682412 CTGGGGTGAACGCTGGGGCTGGG + Intronic
1043725978 8:83611304-83611326 GTGGGGAGACAGCTGAGGCCCGG + Intergenic
1045058538 8:98391523-98391545 CTGGTCAGAAAGCTGGGCTTTGG + Intergenic
1046915590 8:119675004-119675026 CTGATGAGAAAACTGAGGCTTGG - Intergenic
1049099817 8:140570721-140570743 CAGGTGAGGCAGTTGAGGCTTGG + Intronic
1049545592 8:143229210-143229232 GTGGTGAGCCAGCTGGGGGTGGG - Intergenic
1049740899 8:144240395-144240417 CTGGTGAGCCAACTGTGGCATGG + Intronic
1049957757 9:709304-709326 CGGCTGAGAAAGCTGGGGCATGG - Intronic
1051186975 9:14470586-14470608 CTGCTTAGGCAGCAGGGGCTTGG + Intergenic
1051326748 9:15980381-15980403 CTGGAGAGATCACTGGGGCTAGG - Intronic
1051836258 9:21341479-21341501 CAGGGGAGACAGCAGGGCCTAGG - Intergenic
1053760139 9:41345643-41345665 CTAGGCAGACACCTGGGGCTTGG - Intergenic
1054326592 9:63715785-63715807 CTAGGCAGACACCTGGGGCTTGG + Intergenic
1055907531 9:81311400-81311422 CAGATGAGAAAGCTGAGGCTCGG + Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1060092758 9:120758689-120758711 CAGATGAGAAAGCTGTGGCTTGG - Exonic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060514620 9:124258083-124258105 CCGGTGAGTCGCCTGGGGCTGGG + Exonic
1060548980 9:124476404-124476426 CCGGAGAGACAGGTGAGGCTGGG + Exonic
1060985701 9:127817919-127817941 CTGGTGGGACTGCTGTGTCTGGG - Intronic
1061153837 9:128845333-128845355 CTGGTGAGCCAGCTGGGCTGGGG - Exonic
1061238948 9:129358107-129358129 CAGGTGAGAGGGCTGAGGCTGGG + Intergenic
1061415164 9:130443702-130443724 CTGGTGAGCCACGTGGGGCTGGG - Intergenic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062077943 9:134602295-134602317 TTGGTGAGACACCAGGAGCTGGG - Intergenic
1062178603 9:135178565-135178587 CTGGTGAGGAAGCTGGAGTTTGG + Intergenic
1062283135 9:135760709-135760731 CTGGTGCCACAGCTTTGGCTTGG - Intronic
1062326461 9:136014849-136014871 CTGGTGGGACACCTGGGGTGTGG - Intronic
1062334101 9:136057371-136057393 GGGGAGGGACAGCTGGGGCTGGG + Intronic
1062533512 9:137011768-137011790 CTGGTGAGAGACCCGGGGCAGGG + Intronic
1202793363 9_KI270719v1_random:101340-101362 CTAGGCAGACACCTGGGGCTTGG + Intergenic
1185765932 X:2725906-2725928 ATGGAAAGAGAGCTGGGGCTGGG - Intronic
1189071851 X:37872126-37872148 CTGGTGAGTCAGCTGGTGGCTGG + Intronic
1189221126 X:39373118-39373140 CAGATGAGAAAGCTGAGGCTTGG + Intergenic
1189333963 X:40158661-40158683 CTGCCGAGGCAGCTGGGGGTGGG + Intronic
1189761060 X:44322060-44322082 CTGGTGATACAGCTGGGGGTGGG - Intronic
1189883038 X:45511550-45511572 CTGGTCAGAAAGCAGGGGATGGG - Intergenic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1191659594 X:63635979-63636001 CTGGGGAGAGGGCCGGGGCTCGG - Exonic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1193993391 X:88337231-88337253 CCTGTGAGCCACCTGGGGCTGGG - Intergenic
1196007161 X:110849283-110849305 GTGGTGAGAGAGCTGGGGTGGGG + Intergenic
1196736361 X:118984163-118984185 CAGGTGAGACAGATGAAGCTGGG + Intronic
1198375932 X:136040143-136040165 CTGGTGAGGCACCTGGCGATGGG - Exonic
1198411320 X:136372353-136372375 CTGGTGAGAGAAATGGGGCTAGG - Intronic
1199894243 X:152116501-152116523 CTGGAGTGACAGCAGGGGCAGGG + Intergenic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200972466 Y:9167909-9167931 CTGGTGAGAGAGCTTGGGCTTGG + Intergenic
1201329671 Y:12804029-12804051 CTGGTGGGCCAGCTCGGGCTTGG + Intronic
1201963382 Y:19706774-19706796 CTGGTAAGACAGGTGTGGTTTGG - Exonic
1202138551 Y:21696341-21696363 CTGGTGGAAGAGCTTGGGCTTGG - Intergenic