ID: 920287276

View in Genome Browser
Species Human (GRCh38)
Location 1:204889675-204889697
Sequence ACAAGGATATTGCACACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920287276_920287281 -1 Left 920287276 1:204889675-204889697 CCCCCAGTGTGCAATATCCTTGT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 920287281 1:204889697-204889719 TTTCCTTTCCTCAATTAGAATGG 0: 1
1: 0
2: 3
3: 51
4: 436
920287276_920287283 2 Left 920287276 1:204889675-204889697 CCCCCAGTGTGCAATATCCTTGT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 920287283 1:204889700-204889722 CCTTTCCTCAATTAGAATGGAGG 0: 1
1: 0
2: 0
3: 36
4: 647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920287276 Original CRISPR ACAAGGATATTGCACACTGG GGG (reversed) Intronic
905385516 1:37600904-37600926 ACAAGGATATAGCAAACTAGTGG + Intergenic
906785768 1:48614612-48614634 GCAAGGGTAATGCAAACTGGGGG - Intronic
908934301 1:69356071-69356093 AAATGGACATGGCACACTGGTGG + Intergenic
917999894 1:180483329-180483351 AGAAGGATAGGGCACACAGGAGG - Intronic
920083360 1:203394221-203394243 GCAAGGATATTGTACACTTGAGG - Intergenic
920287276 1:204889675-204889697 ACAAGGATATTGCACACTGGGGG - Intronic
920508602 1:206534463-206534485 ACAAGGATCTTGCAAACAAGAGG - Intronic
922538520 1:226401541-226401563 AAACTGATATGGCACACTGGTGG + Intronic
924596281 1:245447674-245447696 AAACGGACATGGCACACTGGTGG - Intronic
1064540758 10:16403034-16403056 AAACTGATATGGCACACTGGTGG + Intergenic
1067464549 10:46487885-46487907 ACAAAGATAATGCTCACTGAAGG - Intergenic
1067622646 10:47896768-47896790 ACAAAGATAATGCTCACTGAAGG + Intergenic
1074918877 10:117986754-117986776 ACAATTATAGTGCACACTGTTGG - Intergenic
1078196749 11:9143069-9143091 ACAAGGAGATTCTCCACTGGAGG + Intronic
1078349504 11:10581075-10581097 CCAAGGATAGAGCACAGTGGTGG + Intronic
1078763544 11:14271939-14271961 AGAAGGAGACTGAACACTGGAGG - Intergenic
1084382836 11:68824413-68824435 ACAGGCATTTTGCATACTGGTGG - Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1090615269 11:128508490-128508512 ATAATGATATTCCTCACTGGAGG - Intronic
1091139250 11:133221221-133221243 ACAAGGTGATTGCTCACTTGAGG + Intronic
1091400937 12:180173-180195 ACAGGGAAAGTTCACACTGGGGG + Intergenic
1092480779 12:8857423-8857445 TCAAGGATATGGGACACTTGAGG - Intronic
1095538748 12:43283311-43283333 ACAAGAATATGAAACACTGGTGG - Intergenic
1101327464 12:103728629-103728651 ACACTGATATTCCACAATGGAGG + Intronic
1105981353 13:25519397-25519419 TCAAGGAAATTGCACTCTAGAGG - Intronic
1109157061 13:58924448-58924470 ACAAGGATATTGCACAGATATGG + Intergenic
1116281291 14:42911856-42911878 ATGAGTATATTGCACCCTGGTGG - Intergenic
1120716257 14:87844194-87844216 AAAAGTAGATTGCACAATGGGGG - Intronic
1131296850 15:91156789-91156811 GCAAAGATACTGCACCCTGGAGG - Intronic
1131335192 15:91542297-91542319 GTAAGAATATTGCACACTGAGGG + Intergenic
1133376086 16:5288559-5288581 ACAAGGATCTTCTACTCTGGAGG - Intergenic
1133864831 16:9632879-9632901 ACACTGACATGGCACACTGGTGG - Intergenic
1134283358 16:12837834-12837856 AAAAAATTATTGCACACTGGAGG + Intergenic
1135476152 16:22777423-22777445 AAAAGGATATTGAACACAGAAGG + Intergenic
1141166760 16:81666062-81666084 ACAAGGAGACTCCCCACTGGGGG + Intronic
1143053620 17:4146183-4146205 ACAAGAATATTGAACCCGGGAGG - Intronic
1149664714 17:58357700-58357722 CCAAGGATATGCCACACTGGGGG + Exonic
1150062192 17:62078010-62078032 AAACTGATATGGCACACTGGTGG - Intergenic
1153258294 18:3195275-3195297 AGATGGATATTCCCCACTGGGGG - Intronic
1154142825 18:11840781-11840803 ACATGGCTCTTGCTCACTGGAGG - Intronic
1155981255 18:32182379-32182401 AAATGTATATTGCACACTGTAGG - Intronic
1159069160 18:63604120-63604142 AAACTGATATGGCACACTGGTGG - Intronic
1159613749 18:70555399-70555421 ACTAGGATTTTCCCCACTGGCGG + Intergenic
1160346466 18:78136300-78136322 ACAAGGGGCTTGCACTCTGGTGG + Intergenic
1161615099 19:5265694-5265716 AGAATGATATTTCTCACTGGGGG + Intronic
1163132194 19:15281404-15281426 ACAAGGATCTTGCAGTCAGGAGG + Intronic
1166220442 19:41360852-41360874 ACAGGGACCTTGCACACTGCTGG + Intronic
928704173 2:33929979-33930001 ATAGGTATATTGCATACTGGTGG + Intergenic
929346586 2:40890962-40890984 ACAAGCATATATCACCCTGGAGG + Intergenic
930275891 2:49310731-49310753 ATGAGTATATTGCATACTGGTGG + Intergenic
932792905 2:74671419-74671441 ACAGGGCTCATGCACACTGGGGG - Intronic
935620588 2:105126166-105126188 ACAAGGAGATTCCCCACTGAGGG - Intergenic
936589461 2:113789347-113789369 GCAAGGCTATTTCACAGTGGTGG - Intergenic
936630732 2:114200109-114200131 AAACTGATATGGCACACTGGTGG + Intergenic
940907550 2:159182922-159182944 ACAAGGCTGTTGCAGACAGGAGG + Intronic
942387072 2:175453575-175453597 ACAAGGATATTGCCAGCTGATGG + Intergenic
943961899 2:194275048-194275070 ACAAGCCTAATGCACTCTGGTGG + Intergenic
944442634 2:199757966-199757988 CCAAGGATATTCCACTGTGGAGG - Intergenic
945919806 2:215744264-215744286 CCATGGTTATTGCACACTGTAGG - Intergenic
1170356813 20:15501328-15501350 CCAAGGATATGCCCCACTGGAGG + Intronic
1171252668 20:23661213-23661235 CCAATGACATTGGACACTGGAGG + Intergenic
1175645115 20:60664342-60664364 ACAAGGACATTGCAAACTTGGGG + Intergenic
1177557831 21:22714987-22715009 AAAATGACATGGCACACTGGTGG - Intergenic
1178470375 21:32887016-32887038 ACAAGGATGCTGCAGACTGTGGG - Intergenic
1179506207 21:41843496-41843518 ACAAGGATGTTTCACAGTGCTGG - Intronic
1180005125 21:45017214-45017236 ACAAGGATGGTGCACAGTGATGG - Intergenic
1183440283 22:37819028-37819050 ACAAGGACATTGCGCCCTTGGGG - Intergenic
1183676582 22:39302163-39302185 AAACTGATATGGCACACTGGTGG - Intergenic
952023276 3:29048637-29048659 AGAAGGAGAATGGACACTGGAGG - Intergenic
952057117 3:29461215-29461237 GTAAGCATATTGCACACTGAAGG - Intronic
952164885 3:30736989-30737011 ACAAGGAGACTGCACAATGCTGG - Intronic
953384794 3:42500404-42500426 ACAAGGTTCTTGGACACTTGAGG - Intronic
956079632 3:65544349-65544371 GCAGGGATAATGCACACTGTGGG + Intronic
960094215 3:113672707-113672729 AAAAGTATGTTGAACACTGGTGG - Intronic
962562622 3:136623129-136623151 ACAAGCATAATACATACTGGAGG + Exonic
965989243 3:174796271-174796293 ATGAGTATATTGCATACTGGTGG + Intronic
966509868 3:180749684-180749706 ACAGGGATATTGCTCACTCCAGG - Intronic
967535906 3:190603102-190603124 ACAAGGACAGTGCAGATTGGAGG + Intronic
970689481 4:18606089-18606111 ACAAAGATATTGCACATTTAAGG + Intergenic
971871695 4:32249216-32249238 ACAATGATATTGCTCAAGGGAGG + Intergenic
973984246 4:56335158-56335180 TCCTGGATATAGCACACTGGTGG + Intergenic
974819078 4:67043659-67043681 ACAGGGATATTGCATTATGGGGG - Intergenic
976725394 4:88211264-88211286 ATAAGCAGATTGCATACTGGTGG + Intronic
979744040 4:124187380-124187402 ATAAGGAACTTGAACACTGGTGG - Intergenic
982993729 4:162314765-162314787 ATGAGTATATTGCATACTGGTGG + Intergenic
984250850 4:177332659-177332681 ACAAGGAGAATACACACTCGTGG - Intronic
991936583 5:71808012-71808034 ACATGGACATTGGACACTGATGG + Intergenic
992757476 5:79921925-79921947 ACAAGTATATTGCATACTGGTGG - Intergenic
992770032 5:80038695-80038717 ACAAGAATATTAGACACTAGTGG - Intronic
993962099 5:94311065-94311087 ATAAACCTATTGCACACTGGAGG - Intronic
994739421 5:103599416-103599438 TCAAGAATCTTGCACAGTGGAGG + Intergenic
996264795 5:121525869-121525891 AATAGAATATTGCACACTGGTGG + Intergenic
999062611 5:148652756-148652778 ATAAGGATATTTCCCACAGGAGG + Intronic
1000165159 5:158641176-158641198 ACAAGGATCTAATACACTGGAGG + Intergenic
1000229831 5:159305271-159305293 ACAAGGATCTGGGACACTGAGGG + Intergenic
1008843131 6:55928625-55928647 ACAAGGAAAAAGAACACTGGGGG - Intergenic
1010598176 6:77790500-77790522 ATAAGTATATTGCATAGTGGTGG - Intronic
1013821469 6:114158061-114158083 ACAATGAGTTTGCACAGTGGAGG - Intronic
1016548036 6:145246229-145246251 AAATTGATATGGCACACTGGTGG - Intergenic
1016617571 6:146070186-146070208 ACAAGTTTATTGCTCAGTGGTGG + Intronic
1018219867 6:161567001-161567023 ACAAGGACAGTGAATACTGGAGG - Intronic
1020506799 7:9000800-9000822 TCCAGGATATTGCACTGTGGTGG - Intergenic
1034387019 7:150748422-150748444 ACATGGATTGTTCACACTGGAGG + Intronic
1036248677 8:7142977-7142999 ACAAGGATCTTCTACTCTGGAGG - Intergenic
1037124835 8:15335368-15335390 AAAATGACATGGCACACTGGTGG - Intergenic
1037318086 8:17617736-17617758 GCATGCAGATTGCACACTGGTGG + Intronic
1037716022 8:21400927-21400949 AAACGGACATGGCACACTGGTGG + Intergenic
1039904102 8:41773638-41773660 ACATGGAGTTTTCACACTGGGGG - Intronic
1040075292 8:43223156-43223178 ACAATGACAGTGCACACTTGGGG + Intergenic
1041214217 8:55583802-55583824 ATGAGTATATTGCATACTGGTGG - Intergenic
1041303974 8:56440945-56440967 ACAAGGATATTATGCACTTGGGG + Exonic
1041325663 8:56661063-56661085 AAAAGGATATGGCACAATGGGGG + Intergenic
1042013944 8:64285618-64285640 AGAAGCATATTGGACAGTGGGGG + Intergenic
1044998010 8:97855708-97855730 ACAAGGATATCAGACTCTGGAGG - Intergenic
1045688089 8:104732290-104732312 AAATCGATACTGCACACTGGAGG - Intronic
1046868431 8:119176768-119176790 AGAAGGAGATGGAACACTGGTGG - Intronic
1047291207 8:123531966-123531988 CCATGGATATTGCACCCTGGGGG - Exonic
1047474590 8:125214462-125214484 ACAAGGAAATGGGTCACTGGCGG + Intronic
1048132803 8:131716392-131716414 AAAAAGAGATTGGACACTGGAGG - Intergenic
1048255756 8:132904047-132904069 ACCAGGCTAATGCCCACTGGAGG - Intronic
1048255887 8:132904878-132904900 ACATGCATCTAGCACACTGGTGG + Intronic
1048478529 8:134765983-134766005 ATAATGCTATTGCACACTGGAGG + Intergenic
1049627440 8:143631819-143631841 AAACTGATATGGCACACTGGTGG + Intergenic
1049678599 8:143904880-143904902 AAAATGACATGGCACACTGGTGG - Intergenic
1050446762 9:5731118-5731140 AAAAGTATATTGAATACTGGAGG - Intronic
1050991919 9:12166724-12166746 AAAATGACATGGCACACTGGTGG + Intergenic
1058632111 9:107000020-107000042 ACAAGGATATCGAACACAGGAGG + Intronic
1058834957 9:108852828-108852850 AGAGGGATGTTGCAGACTGGAGG - Intergenic
1062177531 9:135172289-135172311 ACATGGACACTGGACACTGGTGG - Intergenic
1185737956 X:2507371-2507393 AGAAGGATATTGCAGGGTGGGGG + Intergenic
1189508845 X:41640500-41640522 ACAAAGATATAGAACAATGGAGG - Intronic
1190441760 X:50481884-50481906 AGAAGGATATTCCAGCCTGGAGG + Intergenic
1191119938 X:56892842-56892864 TCCAGAATATTGCACACTGTTGG - Intergenic
1194616578 X:96110984-96111006 ACCATGTTATTGGACACTGGAGG - Intergenic
1198792105 X:140356939-140356961 ACAAGATCATTGCACACTGGAGG + Intergenic