ID: 920292452

View in Genome Browser
Species Human (GRCh38)
Location 1:204933345-204933367
Sequence TAGCCCATACCCAGGCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920292452_920292459 -1 Left 920292452 1:204933345-204933367 CCTTGATGCCTGGGTATGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 920292459 1:204933367-204933389 ATGAAAAGGGGTGGGTTGTAAGG 0: 1
1: 0
2: 1
3: 22
4: 262
920292452_920292462 18 Left 920292452 1:204933345-204933367 CCTTGATGCCTGGGTATGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 920292462 1:204933386-204933408 AAGGGCAATTCCCAGGTGTCTGG 0: 1
1: 0
2: 0
3: 32
4: 214
920292452_920292457 -10 Left 920292452 1:204933345-204933367 CCTTGATGCCTGGGTATGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 920292457 1:204933358-204933380 GTATGGGCTATGAAAAGGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 168
920292452_920292458 -9 Left 920292452 1:204933345-204933367 CCTTGATGCCTGGGTATGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 920292458 1:204933359-204933381 TATGGGCTATGAAAAGGGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 223
920292452_920292461 11 Left 920292452 1:204933345-204933367 CCTTGATGCCTGGGTATGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 920292461 1:204933379-204933401 GGGTTGTAAGGGCAATTCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 72
920292452_920292460 0 Left 920292452 1:204933345-204933367 CCTTGATGCCTGGGTATGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 920292460 1:204933368-204933390 TGAAAAGGGGTGGGTTGTAAGGG 0: 1
1: 0
2: 2
3: 19
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920292452 Original CRISPR TAGCCCATACCCAGGCATCA AGG (reversed) Intronic
903136718 1:21314220-21314242 TACCCGATACTCAGGCATTATGG + Intronic
904602683 1:31682541-31682563 AAGCCCATCCCCAGTCATTAGGG - Intronic
905274998 1:36811776-36811798 TAGCCCAGAGCCAGGCATACAGG - Intronic
910790485 1:91044892-91044914 TCTCCCATAGCCAGGCTTCATGG + Intergenic
912088331 1:106038722-106038744 TACACCATACCCAAGCATCAAGG - Intergenic
913585045 1:120266826-120266848 AAGCCCTTGCCCAGGCATTAGGG + Intergenic
913623138 1:120631536-120631558 AAGCCCTTGCCCAGGCATTAAGG - Intergenic
914567049 1:148878687-148878709 AAGCCCTTGCCCAGGCATTAGGG + Intronic
914605775 1:149251555-149251577 AAGCCCTTGCCCAGGCATTAGGG - Intergenic
916991894 1:170253490-170253512 AAACCCATACCCAGACATGATGG - Intergenic
918075951 1:181171716-181171738 TGGCCCATGCCCAGGAATGATGG + Intergenic
920292452 1:204933345-204933367 TAGCCCATACCCAGGCATCAAGG - Intronic
922394483 1:225182613-225182635 TACCCCAACCCCAGGCAGCACGG + Intronic
924440585 1:244082299-244082321 TACCCCTTACCCAGGGATAAGGG + Intergenic
1066432765 10:35368681-35368703 TAGCCCGGCCCCAGGCGTCAGGG + Intronic
1066648965 10:37637845-37637867 TAGCACATCCCCAGGCATGGTGG + Intergenic
1067536323 10:47112910-47112932 TAGAACAAACCCAGGCATGAAGG - Intergenic
1069632295 10:69904351-69904373 TAGACCAGACTCAGGCATCACGG + Intronic
1070481172 10:76884234-76884256 TAGCCCACACCCAGTTATCTGGG - Intronic
1072631371 10:97149143-97149165 AAGCCCACAGCCAGGCACCAGGG + Intronic
1076485481 10:130813009-130813031 AAGCACATACCCAGACATTAGGG + Intergenic
1078792657 11:14560012-14560034 TAGTCCATGCCCAGGTATTAAGG - Intronic
1078993231 11:16670211-16670233 TTCCCCAGACCAAGGCATCAGGG - Intronic
1079443666 11:20540046-20540068 TAGTCCAGACCCAGGCTTCGAGG + Intergenic
1081378483 11:42387353-42387375 TCACCCATAGCCAGGAATCATGG + Intergenic
1083280963 11:61627107-61627129 AAGCCCATCCCCAGGCCCCAGGG - Intergenic
1083407943 11:62471750-62471772 TCTCCCACACCCAGGCCTCAGGG - Intronic
1084363365 11:68683471-68683493 CACCCCATTCCCAGGCATCAGGG - Intergenic
1085299598 11:75450398-75450420 CAGGCCATGCCCAGGCCTCAGGG + Intronic
1090215546 11:124959933-124959955 TATTCCATCCCCAGGCATCAGGG - Exonic
1090925056 11:131242336-131242358 TAGCGCATGCCCAGGCTGCAAGG - Intergenic
1091017977 11:132071452-132071474 TAACAGATACACAGGCATCAAGG - Intronic
1091654894 12:2338212-2338234 TAGCCCCTTGCCAGACATCAAGG - Intronic
1094303788 12:28995362-28995384 TAGCTCTTCCCCAGGCAGCAAGG + Intergenic
1102573221 12:113840346-113840368 TGACCCATCCACAGGCATCAGGG - Intronic
1103159008 12:118711994-118712016 TAGCACAGTGCCAGGCATCATGG + Intergenic
1106972372 13:35157257-35157279 TAGCCCATTCCAAGGTAACACGG + Exonic
1107808296 13:44175190-44175212 TCCCCCATCCCCAGGCAGCATGG - Intergenic
1108321927 13:49298179-49298201 TGGCCCATCCCCAGGGAACAGGG - Intergenic
1111790801 13:92852183-92852205 TAGCCCATCCACAAGCACCAAGG - Intronic
1113807523 13:113118339-113118361 CAGCCCATCCCCATGCACCAGGG + Intronic
1121444426 14:93969671-93969693 TAGGCCTTGCCCAGCCATCAGGG + Intronic
1124499785 15:30217413-30217435 CAGCCAACACCCAGGCACCATGG - Intergenic
1124743794 15:32321251-32321273 CAGCCAACACCCAGGCACCATGG + Intergenic
1125966562 15:43879988-43880010 GAGCCCTTATCCAGGCCTCAGGG - Intronic
1126320411 15:47416308-47416330 CAGACCATACCCAGGCTTGAAGG - Intronic
1126786434 15:52180631-52180653 GAGCCCACGCCCAGGCATCTCGG + Intronic
1130865511 15:87930192-87930214 TACCCCAGACCCATGCTTCAAGG - Intronic
1132551245 16:554710-554732 TAGGCCCTGCCCAGGCATCCCGG + Intergenic
1136482135 16:30548665-30548687 AAGCCCTTACCTAGGCACCACGG - Intronic
1143922798 17:10344141-10344163 TAGTGCATACCCATGCTTCATGG + Intronic
1146400522 17:32497089-32497111 CAGCCCGAACCCCGGCATCAAGG - Intronic
1147976004 17:44248415-44248437 AAACCTATTCCCAGGCATCAAGG + Exonic
1148115351 17:45171955-45171977 CACCCCTTACCCAGGAATCAGGG - Intergenic
1148638950 17:49170472-49170494 GAGCCCATGCCAAGGCATGATGG + Intergenic
1151360258 17:73584430-73584452 CATCCTATACCCGGGCATCAGGG - Intronic
1157509737 18:48262327-48262349 TGGCCCATAACCAAGCAACAGGG + Intronic
1162591038 19:11591797-11591819 TATACCATAACCAGGCATAATGG - Intronic
1164605570 19:29595625-29595647 AAGGGCATCCCCAGGCATCAGGG + Intergenic
1167291926 19:48629317-48629339 AGGCCCCTACCCGGGCATCAGGG - Exonic
926208016 2:10847721-10847743 AAGCCCACACCCAGGCTTCCAGG - Intronic
929497972 2:42463282-42463304 TAGCCAAGAAGCAGGCATCAGGG + Intronic
929827139 2:45317730-45317752 TAGCCCATACCCCGATATGAGGG + Intergenic
930595828 2:53387067-53387089 TAGCCAAAACCCAGACATGATGG - Intergenic
930999788 2:57765844-57765866 CACCACATACCCAGGCATCATGG + Intergenic
931911063 2:66900941-66900963 TCGCCAATAGACAGGCATCAAGG - Intergenic
933942834 2:87259507-87259529 GAGCCCATGAGCAGGCATCACGG - Intergenic
936096059 2:109531041-109531063 TAGCCCACACCCAGGCCTTGTGG + Intergenic
936337385 2:111602055-111602077 GAGCCCATGAGCAGGCATCACGG + Intergenic
937581878 2:123497711-123497733 TATCCCATAGCCAGGATTCATGG - Intergenic
938555848 2:132423547-132423569 CAACCCATACACAGGCAGCATGG - Intronic
938779150 2:134569239-134569261 TAACTCATAACCAGGTATCAGGG + Intronic
945934044 2:215885229-215885251 AATCCCCTACCCAGACATCAGGG + Intergenic
947392773 2:229656034-229656056 GAGGCCATAGTCAGGCATCAAGG - Intronic
1169273359 20:4217188-4217210 TAGCTCACACCCAGTCATCCTGG - Intergenic
1170119880 20:12900316-12900338 TGCCCCATGCCCAGGTATCAGGG - Intergenic
1173875356 20:46367116-46367138 TGGCCCAATCCCAGGCTTCATGG + Exonic
1174987262 20:55469052-55469074 TAACTCAGAGCCAGGCATCAAGG + Intergenic
1178812117 21:35893803-35893825 TGGCACCTTCCCAGGCATCAAGG + Intronic
1182861827 22:33566979-33567001 CACCCTACACCCAGGCATCATGG + Intronic
949727221 3:7063148-7063170 AGACCCATACCCATGCATCAGGG - Intronic
950740530 3:15047531-15047553 TAGCCCAGAGACAGGCGTCACGG + Exonic
950801446 3:15554940-15554962 TACTTAATACCCAGGCATCAGGG + Intergenic
953656101 3:44856105-44856127 AAGCCCAAACCCAGGAATTATGG + Intronic
955655327 3:61239384-61239406 TAGCCTATACCAAGGCCTTAAGG - Intronic
958934498 3:100242038-100242060 TCTCCCATAGCCAGGCTTCACGG + Intergenic
960952678 3:123009854-123009876 CAGCCCAAAGCCAGGCACCAAGG - Intronic
961649287 3:128409507-128409529 TGGCCCAGACCCAGGCAGCAGGG + Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
964532087 3:157679657-157679679 AAGCCCATAGCCAGGCACGATGG - Intergenic
964884799 3:161469370-161469392 TTGCCCATAACCAGCCATCCTGG - Intergenic
970329769 4:14967897-14967919 AAGCCCATACCCAGAGATGATGG - Intergenic
971051385 4:22866576-22866598 AAGCCAATACCCTGGCAGCAAGG - Intergenic
971252759 4:24986892-24986914 TAGCCCATACAGAGACCTCAAGG - Intergenic
972212065 4:36850237-36850259 AACGCCATCCCCAGGCATCAGGG + Intergenic
978029577 4:103923827-103923849 AAGCCGATACCCAGTCTTCAGGG - Intergenic
978727326 4:111984548-111984570 CAGACCACACCCAGGCAGCAAGG + Intergenic
982623145 4:157731462-157731484 TTTCCCATACCCAGGATTCATGG - Intergenic
990744416 5:58944131-58944153 TAGGCCATGCCCAGGAATGAAGG + Intergenic
998036417 5:138920711-138920733 TAGCCAATATCCAGGCCCCATGG - Intronic
999486083 5:151997741-151997763 TTCCCCATCCCCAGGCCTCAAGG - Intergenic
999971211 5:156865466-156865488 TATCCCATTCCCAGGCAACTTGG + Intergenic
1001356571 5:171031482-171031504 TAGCCTAGAGCCAGGCATTATGG + Intronic
1002177368 5:177408876-177408898 CAGCCCATACCCTGCCCTCAAGG + Intronic
1002407433 5:179046778-179046800 TTGGCCATTACCAGGCATCAGGG - Intergenic
1006209096 6:32377380-32377402 TTGCCAATACCTAGGCATTAAGG + Intergenic
1006713808 6:36100375-36100397 TAGCACATAGGCAGGCCTCAAGG - Intronic
1007031450 6:38631411-38631433 TAGCCCATACTCAGGGAGGAAGG - Intronic
1007120852 6:39379782-39379804 TAGCACTTTGCCAGGCATCATGG - Intronic
1008136927 6:47787752-47787774 TACCCAATACCCAGACTTCAAGG - Intronic
1008621165 6:53272792-53272814 TAGCCCATTACTAGGCAGCAAGG - Intronic
1014954650 6:127599946-127599968 TAGCACATACCCAGGGCACATGG + Intergenic
1028987974 7:97022738-97022760 CAGCCCCTCCCCAGGCTTCAAGG + Intronic
1029285522 7:99463094-99463116 TAGCTCATAACCAGGCAGAAAGG - Intronic
1029647475 7:101867345-101867367 TCGCCCTGCCCCAGGCATCAAGG + Intronic
1029862890 7:103593691-103593713 TAGCACATATCCAGGTTTCAGGG + Exonic
1033875330 7:145810647-145810669 TCACCCAAACCCAGGCAGCATGG + Intergenic
1034196256 7:149250430-149250452 TAGCCCATACTCCTGCAGCAGGG - Exonic
1035353477 7:158263495-158263517 TGCCCCAAACCCAGGCAGCATGG - Intronic
1037631589 8:20661878-20661900 TAGACAATATCCAGGCATTAAGG - Intergenic
1037984994 8:23284926-23284948 TGGCCAATAGCCAGGCACCAAGG - Intronic
1045440090 8:102200595-102200617 TGACCCCAACCCAGGCATCATGG - Intergenic
1046907057 8:119584992-119585014 TAGCCCAAAACCAGGCATGTTGG - Intronic
1048799214 8:138180912-138180934 TGGCCCATTCCCATACATCATGG + Intronic
1053259724 9:36651856-36651878 TACCCCATTCACAGACATCAAGG + Exonic
1057412502 9:94829552-94829574 TGCCCCGTACCCTGGCATCATGG - Intronic
1058343942 9:103935696-103935718 AAGCCCAAACCCCAGCATCATGG + Intergenic
1059575810 9:115487083-115487105 TAGGACTTACCCAGCCATCACGG + Intergenic
1060878317 9:127099269-127099291 TAGTCCATACGCAGGCACTAGGG + Intronic
1060983714 9:127808148-127808170 TAGCCCAGACCCAGGGATGTGGG + Intronic
1061388796 9:130305919-130305941 GAGCACATCCCCAGGCAACATGG - Intronic
1186056440 X:5654519-5654541 TAAGCCATCCCCAGGCAGCAGGG - Intergenic
1187046338 X:15651011-15651033 GAGCTAATACCCAGGCAACAGGG + Intronic
1187393836 X:18903559-18903581 GAGCCCATGCCCAGGCCTGAGGG + Intronic
1193881121 X:86922392-86922414 AAGCCCAAACCCTAGCATCATGG + Intergenic
1194179415 X:90694510-90694532 TCTCCCATAGCCAGGAATCATGG - Intergenic
1200526080 Y:4276683-4276705 TCTCCCATAGCCAGGAATCATGG - Intergenic