ID: 920293589

View in Genome Browser
Species Human (GRCh38)
Location 1:204941747-204941769
Sequence TAGCCAGAGGGTCCCTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920293583_920293589 -6 Left 920293583 1:204941730-204941752 CCTCCTGTGATGCCTTCTAGCCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 920293589 1:204941747-204941769 TAGCCAGAGGGTCCCTCCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
920293582_920293589 1 Left 920293582 1:204941723-204941745 CCAAAGACCTCCTGTGATGCCTT 0: 1
1: 0
2: 2
3: 21
4: 185
Right 920293589 1:204941747-204941769 TAGCCAGAGGGTCCCTCCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
920293584_920293589 -9 Left 920293584 1:204941733-204941755 CCTGTGATGCCTTCTAGCCAGAG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 920293589 1:204941747-204941769 TAGCCAGAGGGTCCCTCCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
920293581_920293589 27 Left 920293581 1:204941697-204941719 CCATCTTAGAGAGTTGGGAAGGT 0: 1
1: 0
2: 1
3: 14
4: 111
Right 920293589 1:204941747-204941769 TAGCCAGAGGGTCCCTCCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920293589 Original CRISPR TAGCCAGAGGGTCCCTCCTT GGG Intronic
900942393 1:5808393-5808415 TGGGGTGAGGGTCCCTCCTTGGG + Intergenic
902734342 1:18390402-18390424 TAACCAGTGGGTCCCTCTTTAGG + Intergenic
904052412 1:27647737-27647759 AAGCAAGGGGGTCTCTCCTTCGG - Intergenic
904411221 1:30326068-30326090 GAGCTAGAGGGGCCATCCTTGGG + Intergenic
914427758 1:147594068-147594090 TAGATAGAGGGGCCCTCATTGGG + Intronic
919710877 1:200726832-200726854 TAGCAAGTGGGTCCCTTCATAGG + Intergenic
920293589 1:204941747-204941769 TAGCCAGAGGGTCCCTCCTTGGG + Intronic
922258305 1:223912380-223912402 TAAGCAGAGGGCCCCACCTTCGG - Intergenic
1067583400 10:47460760-47460782 TATCCAGCGAGTCCATCCTTAGG - Intronic
1067633403 10:47986110-47986132 TATCCAGCGAGTCCATCCTTAGG - Intergenic
1069587946 10:69621012-69621034 TAGCCAGAGGGTCCCAGCCCAGG - Intergenic
1075325380 10:121527753-121527775 TAGGCAGGAGGTCCCTCCCTAGG + Intronic
1075488512 10:122847149-122847171 TAGCCAGAGGGTTTCACCCTAGG - Intronic
1077998707 11:7475884-7475906 TTCCCAGAGAGTTCCTCCTTGGG - Intergenic
1081336584 11:41874275-41874297 TAAATGGAGGGTCCCTCCTTTGG - Intergenic
1081779963 11:45703422-45703444 TACCCAGAGGATCTCTACTTGGG - Intergenic
1083478871 11:62930730-62930752 TTGCCAAAGGCTCCCTCCTAGGG + Intergenic
1084455710 11:69267119-69267141 TAACCAGATGGTCCCATCTTAGG - Intergenic
1084757580 11:71249481-71249503 GAGTCTGAGGGCCCCTCCTTGGG - Intronic
1085065732 11:73494043-73494065 TAGCCAGTGGGGCACTCCATAGG - Intronic
1086254989 11:84865055-84865077 TGGCCAGAGGTACCCTGCTTAGG + Intronic
1086926806 11:92649528-92649550 TTGCCAGTGGGTCCCTGCTCTGG + Intronic
1086956488 11:92939038-92939060 TAACCAGAGGCTTCCTCATTTGG - Intergenic
1087279686 11:96196630-96196652 TAGCAGGAGGTTCACTCCTTAGG + Intronic
1091582415 12:1797632-1797654 TTTGCAGAGGGTCCCTCCTCAGG + Intronic
1093197572 12:16146805-16146827 TATCCAAAGTGTCCCTCTTTAGG + Intergenic
1095954132 12:47796919-47796941 TAGACAGGGGTCCCCTCCTTAGG - Intronic
1100361640 12:93884918-93884940 TAGACAGAGATGCCCTCCTTAGG - Intronic
1102256015 12:111415430-111415452 TGGCCAGAGGGCCTTTCCTTAGG - Intronic
1104658714 12:130593182-130593204 TGGGTGGAGGGTCCCTCCTTGGG - Intronic
1104859846 12:131918234-131918256 TACCCAGAGGGTCCCTTGGTGGG + Intronic
1110998047 13:82138755-82138777 TTGCCAGATGGTGCCTCCTCAGG + Intergenic
1116553799 14:46277383-46277405 TAGCAATAGAATCCCTCCTTAGG + Intergenic
1116679388 14:47946424-47946446 TAAGTAGAGGGTACCTCCTTAGG - Intergenic
1118169243 14:63370078-63370100 TATCCAGAGGTTCTCTCATTTGG + Intergenic
1118985345 14:70749794-70749816 TGCCCAGAGGATTCCTCCTTAGG + Intronic
1119700720 14:76752740-76752762 TGGCCAGATGCTCCCTGCTTTGG - Intergenic
1123071265 14:105643606-105643628 TACCCCGCGGGTCCCACCTTTGG + Intergenic
1123096558 14:105769640-105769662 TACCCCGCGGGTCCCACCTTTGG + Intergenic
1127294692 15:57598927-57598949 TATCCCGAGGGTCCTTCCTGAGG + Intronic
1127867986 15:63047472-63047494 TAGCCAGAGGCTCTCTCATAGGG + Intronic
1132425511 15:101712923-101712945 GACCCAGAGGGTCAGTCCTTAGG + Intronic
1133967165 16:10539839-10539861 AAGCCAGAGGGTCACCACTTGGG - Intronic
1141395775 16:83703060-83703082 TAACAAGAGCGTTCCTCCTTGGG + Intronic
1141538301 16:84699249-84699271 CAGCCAGTGGGTCCACCCTTGGG - Intergenic
1142112049 16:88338202-88338224 GAGCCAGAGGGTCTCTCCCCAGG - Intergenic
1147605300 17:41770846-41770868 AAGCCTGAGGGCCCCTCGTTGGG - Intronic
1148835103 17:50461798-50461820 TACGCAGAGTGTCCTTCCTTAGG + Intronic
1151906738 17:77053926-77053948 TGGCCAGTGGGCCTCTCCTTAGG + Intergenic
1152444400 17:80332833-80332855 TAGCCAGAGGGAGTTTCCTTGGG + Intronic
1155242294 18:23875460-23875482 CAGCCTGAGGGACTCTCCTTGGG - Intronic
1155840832 18:30640612-30640634 CAGCTAGATGGTCCCTTCTTGGG - Intergenic
1157819288 18:50753673-50753695 TAGCCAATTGGTGCCTCCTTAGG - Intergenic
1163674551 19:18648905-18648927 CAGCCAGCGGGACCCTCCTAAGG + Intronic
1167225426 19:48236160-48236182 TGACCAGAGGGTCCTGCCTTGGG + Intronic
1168403529 19:56099254-56099276 CAACCAGAGGGTCCCGTCTTGGG - Intronic
935061328 2:99610584-99610606 CAGCCAGAATGTCCCTCATTGGG - Intronic
936635929 2:114258171-114258193 TTCCCAGATGGACCCTCCTTAGG + Intergenic
936891418 2:117374133-117374155 TAGGCAGAGAGTCCATCCTCAGG - Intergenic
937097034 2:119242207-119242229 TGTCCAGAGGGTTCCTACTTAGG + Intronic
938176744 2:129140260-129140282 CAGCCAGAGGGTCTTTCCATGGG - Intergenic
938379614 2:130829224-130829246 AAAACAGAGGGTCCCTCCTCAGG + Intergenic
938765865 2:134460157-134460179 CAGCCAGAGGGACCCTCTGTCGG + Intronic
941087502 2:161134770-161134792 TAGAAATAGGTTCCCTCCTTCGG - Intergenic
946223027 2:218245470-218245492 TAGCCACAGGGAACCTCCTCTGG + Exonic
947341751 2:229147938-229147960 TCTCCAGAGAGTCCCTCCATGGG + Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1172325532 20:34031564-34031586 TAGCCAGCTGTTTCCTCCTTTGG - Exonic
1172672535 20:36644266-36644288 AAGCCAGAGGTTCTCTCCCTGGG - Intronic
1172838750 20:37889242-37889264 TGGCCAGAGGTGGCCTCCTTGGG + Intergenic
1172964693 20:38826140-38826162 TAGCCACAGGTGGCCTCCTTTGG + Intronic
1173327967 20:42050838-42050860 TAGCCAGTGGGTCCCTCTCAGGG - Intergenic
1174992926 20:55533685-55533707 TTGCCAGAGCTTCCCTCCATAGG - Intergenic
1175833325 20:61978730-61978752 AGGCCAGACGGTGCCTCCTTGGG + Intronic
1180007171 21:45028128-45028150 CAGACAGACGGTCCCTCCTCAGG - Intergenic
1180007236 21:45028376-45028398 CAGACAGACGGTCCCTCCTCAGG - Intergenic
1180007286 21:45028592-45028614 CAGACAGACGGTCCCTCCTCAGG - Intergenic
1181501140 22:23316198-23316220 TAGCCTGGGGTTCCCTCCCTGGG - Exonic
1181651013 22:24259220-24259242 TAGCCTGGGGTTCCCTCCCTGGG + Intergenic
1184099868 22:42336393-42336415 CAGCCAGAGGTTCCCTGCTCAGG + Intronic
1203215846 22_KI270731v1_random:5383-5405 TAGCCTGGGGTTCCCTCCCTGGG - Intergenic
1203274779 22_KI270734v1_random:80008-80030 TAGCCTGGGGTTCCCTCCCTGGG + Intergenic
950648418 3:14392338-14392360 TTCCCAGAGGGGCCCTCCTGTGG + Intergenic
954367459 3:50154262-50154284 TGGGCAGAGGGTCCCTTCCTGGG + Intergenic
966886261 3:184379698-184379720 TAGCCTGAGGCTCCCTTCCTGGG + Intronic
973554180 4:52065730-52065752 TAGACATAGGGAACCTCCTTGGG - Intronic
976865618 4:89722768-89722790 TAGCCTGTGGGTGCCTCCTTTGG + Intergenic
980340127 4:131533558-131533580 TAGCCAGAGGGGCCCTACCTAGG - Intergenic
981641993 4:146955184-146955206 AAGCTAGATGGCCCCTCCTTGGG - Intergenic
982886404 4:160788101-160788123 TAGGCAAAGAGTCCCTACTTGGG + Intergenic
983303191 4:165953863-165953885 TTGCCACAGGATCCCTTCTTGGG - Intronic
983646801 4:169999824-169999846 TAGCCAAGGGGTTGCTCCTTTGG + Intronic
984542753 4:181060733-181060755 TAGCAAGATATTCCCTCCTTTGG - Intergenic
985685344 5:1279047-1279069 AATCCAGTGGGACCCTCCTTGGG + Intronic
995985258 5:118163458-118163480 TACTCAGAGGGTTCCTCCTAAGG - Intergenic
1000452788 5:161411005-161411027 CATCCAGTGGGTACCTCCTTAGG + Exonic
1002792038 6:443986-444008 TAGCCACAGGGTCACTCTCTGGG + Intergenic
1005216409 6:23533429-23533451 AAGCCAAAGGGTCTCTACTTAGG - Intergenic
1007392912 6:41560931-41560953 CAGCCCGTGGGTCCCCCCTTTGG + Intronic
1012731927 6:102894108-102894130 AAGCCAGAGGTTCCCTGCTCAGG + Intergenic
1018748429 6:166780572-166780594 AAGCCAGAGGTTCCCTTCATGGG + Intronic
1021313538 7:19118537-19118559 TGGCCACAGGGTCTCTCCCTTGG - Intergenic
1023696516 7:42853133-42853155 GAGCCAGAGAATCCCTCCTCTGG - Intergenic
1023696946 7:42857250-42857272 CAGCCAGAGGGCCCCTTCCTGGG - Intergenic
1024470813 7:49767446-49767468 TAGCCACAGATTTCCTCCTTTGG + Intergenic
1026273714 7:68858755-68858777 TAGCCTGGGGGTCCCAGCTTGGG - Intergenic
1026630002 7:72029886-72029908 AAATCAGAGGTTCCCTCCTTGGG - Intronic
1032464170 7:132133466-132133488 GAGCCAGAGGGTCCCAACTCGGG + Intronic
1033356124 7:140601737-140601759 CAGCCAGAGGGTCCACCCCTCGG - Exonic
1033755805 7:144397683-144397705 TAGCCTCAGGGTCTGTCCTTAGG + Intronic
1035309156 7:157953771-157953793 TGGCCAAAGGATCCCTCCTGAGG + Intronic
1036588397 8:10146402-10146424 TGGCCAGAGGTTCTCTCCCTGGG + Intronic
1037766613 8:21776098-21776120 TAGGCAGAGGGTGCCTGCCTGGG - Intronic
1049545811 8:143230010-143230032 AAGGCAGAGGTTCCTTCCTTAGG - Intergenic
1052835880 9:33249612-33249634 TAGACAGAGACTCCCTCCTGTGG + Intronic
1058493298 9:105526090-105526112 AAACCAGAGGTTCCCTTCTTTGG + Intronic
1060771510 9:126335475-126335497 TGGCCACAGGTTCCCTCCTTGGG + Intronic
1061053187 9:128207914-128207936 TGGGCAGAGGGTCGCTCCTCAGG - Intronic
1061964452 9:134005124-134005146 AAGCCAGCAGGTCCCTCCTGGGG - Intergenic
1062325894 9:136012348-136012370 TGGTCAGAGGGTCCCCCTTTCGG + Intronic