ID: 920294014

View in Genome Browser
Species Human (GRCh38)
Location 1:204944848-204944870
Sequence TCCTGATTACTCCAGCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920294014_920294022 2 Left 920294014 1:204944848-204944870 CCTCTTGGCTGGAGTAATCAGGA 0: 1
1: 0
2: 2
3: 12
4: 126
Right 920294022 1:204944873-204944895 ACACAGGCCTGGGAAGGGCTGGG 0: 1
1: 1
2: 11
3: 56
4: 536
920294014_920294021 1 Left 920294014 1:204944848-204944870 CCTCTTGGCTGGAGTAATCAGGA 0: 1
1: 0
2: 2
3: 12
4: 126
Right 920294021 1:204944872-204944894 GACACAGGCCTGGGAAGGGCTGG 0: 1
1: 3
2: 5
3: 82
4: 624
920294014_920294019 -4 Left 920294014 1:204944848-204944870 CCTCTTGGCTGGAGTAATCAGGA 0: 1
1: 0
2: 2
3: 12
4: 126
Right 920294019 1:204944867-204944889 AGGAGGACACAGGCCTGGGAAGG 0: 1
1: 0
2: 5
3: 88
4: 700
920294014_920294020 -3 Left 920294014 1:204944848-204944870 CCTCTTGGCTGGAGTAATCAGGA 0: 1
1: 0
2: 2
3: 12
4: 126
Right 920294020 1:204944868-204944890 GGAGGACACAGGCCTGGGAAGGG 0: 1
1: 1
2: 8
3: 101
4: 1385
920294014_920294017 -9 Left 920294014 1:204944848-204944870 CCTCTTGGCTGGAGTAATCAGGA 0: 1
1: 0
2: 2
3: 12
4: 126
Right 920294017 1:204944862-204944884 TAATCAGGAGGACACAGGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 247
920294014_920294018 -8 Left 920294014 1:204944848-204944870 CCTCTTGGCTGGAGTAATCAGGA 0: 1
1: 0
2: 2
3: 12
4: 126
Right 920294018 1:204944863-204944885 AATCAGGAGGACACAGGCCTGGG 0: 1
1: 0
2: 4
3: 33
4: 281
920294014_920294024 30 Left 920294014 1:204944848-204944870 CCTCTTGGCTGGAGTAATCAGGA 0: 1
1: 0
2: 2
3: 12
4: 126
Right 920294024 1:204944901-204944923 AATTATCTTTGCAAAAGACATGG 0: 1
1: 1
2: 1
3: 36
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920294014 Original CRISPR TCCTGATTACTCCAGCCAAG AGG (reversed) Intronic
905162206 1:36046316-36046338 ACCAAATTACTCCAGCCCAGTGG + Intronic
905746709 1:40424420-40424442 TCCTGACCACTCCATCCAAATGG - Intergenic
905775430 1:40664901-40664923 TGCTGCTTACTCCAGCCCTGGGG - Intronic
906935236 1:50208822-50208844 TTCTTATTCCTACAGCCAAGAGG - Intergenic
918888689 1:190234434-190234456 TCATAGTTACTGCAGCCAAGAGG + Exonic
920294014 1:204944848-204944870 TCCTGATTACTCCAGCCAAGAGG - Intronic
921320669 1:213935236-213935258 TCTTGATTACCCCATCTAAGTGG - Intergenic
921370281 1:214415780-214415802 TCCTGTTTAGTACACCCAAGAGG - Intronic
922031709 1:221807291-221807313 CCCTGATTAGTCTAGCCATGGGG + Intergenic
923744525 1:236687471-236687493 CCCTATTTATTCCAGCCAAGAGG - Intronic
1066178814 10:32939545-32939567 TCCTGAATACTGCAGGCAACTGG + Intronic
1070963739 10:80516789-80516811 ACCTGACAACTCCAGCCCAGGGG - Intronic
1073400111 10:103250545-103250567 TGGTGTTTACTCCATCCAAGGGG + Intergenic
1073645590 10:105299235-105299257 TCCTGATTACTCTAGCAAGAGGG - Intergenic
1075070881 10:119319220-119319242 TCCTGCTTTCTCCAGCCCTGGGG - Intronic
1075582610 10:123633738-123633760 TCCTGAATACCCCAGCCCCGCGG - Intergenic
1076476641 10:130758325-130758347 CCCTGATCAGCCCAGCCAAGAGG + Intergenic
1077502769 11:2916799-2916821 GCCTGCGTGCTCCAGCCAAGGGG + Intronic
1078432197 11:11296790-11296812 TTGTGATTACGCCAGTCAAGAGG - Intronic
1084429561 11:69103515-69103537 TCCTGCTTGCCCCAGCCAAGTGG - Intergenic
1085226201 11:74923386-74923408 CTCTGTTTGCTCCAGCCAAGTGG - Intronic
1086097885 11:83068822-83068844 TCCTGATAACCCTAGACAAGGGG + Intronic
1086754514 11:90542895-90542917 TCCTGATTAATCCAGGGAATTGG - Intergenic
1088454946 11:110023906-110023928 TCCTGTTTACTCCTCCCCAGTGG - Intergenic
1088657875 11:112018023-112018045 GTCTGATTACTCTAGACAAGTGG + Intronic
1090265873 11:125352549-125352571 CCCTGATGCCTCCAGCCTAGTGG + Intronic
1094030933 12:26010513-26010535 TCCTGATTACCCCGGCCCTGGGG + Intronic
1094338468 12:29385731-29385753 TGCTGATTAGTAGAGCCAAGTGG + Intergenic
1095996974 12:48095666-48095688 TTCTGAGTCCTACAGCCAAGAGG + Intronic
1096576907 12:52558588-52558610 TCATGATTGCTCCAGCCTGGTGG - Intergenic
1097516831 12:60617206-60617228 TCCTGCTTACTCCAGGAGAGTGG + Intergenic
1102009890 12:109611835-109611857 CCCTGCTGACTCCAGCCCAGTGG - Intergenic
1103443931 12:120981676-120981698 CCCTGATTGCTCCATCCAAAAGG + Intronic
1103522700 12:121547049-121547071 CCCTGATGACACCAGCCAAATGG + Intronic
1108951896 13:56104948-56104970 TCCTGAGCACCCAAGCCAAGTGG - Intergenic
1109159741 13:58957752-58957774 TCCTGATTGCTAGAGCCCAGTGG + Intergenic
1110535374 13:76645318-76645340 TACCGATGACTCCAGCCAAAGGG + Intergenic
1110995312 13:82100359-82100381 TCCTGCTTATTCCAGCCACTGGG + Intergenic
1113591366 13:111503503-111503525 TCCTGATGACCCCAGCCAAGTGG - Intergenic
1115802024 14:37005123-37005145 TCCAAATTATTCCAGCTAAGTGG + Intronic
1115815347 14:37157837-37157859 TCTTGGTTAGTCCAGCTAAGTGG - Intronic
1117036181 14:51732115-51732137 GCATGATTACTCAAGCCAAAAGG - Intergenic
1120856775 14:89219328-89219350 TCCTGAACCCTCCAGCCATGTGG + Intronic
1121616085 14:95314752-95314774 TCCTGATTACAACAGGCAAAAGG - Intronic
1126783971 15:52161692-52161714 CCATGATTCTTCCAGCCAAGTGG - Intronic
1128547286 15:68576954-68576976 TCCTGACAACTCCAGCCCAATGG - Intergenic
1130355927 15:83130326-83130348 CACTTATTACTCCAGCCAAGTGG + Exonic
1131994369 15:98120000-98120022 TCCTGATTGCTACAGGCATGGGG - Intergenic
1133142511 16:3757753-3757775 TCCTGGTTAATCCAGCCAGAGGG - Intronic
1133317608 16:4894148-4894170 AGCTGAGTCCTCCAGCCAAGGGG + Intronic
1135149183 16:19990468-19990490 TCCTCCTTACCCCTGCCAAGAGG - Intergenic
1136392915 16:29976667-29976689 TCCTGACCACTCCAGCCATTGGG - Intronic
1138013471 16:53407017-53407039 TTCTAATTATTCCAGGCAAGTGG + Intergenic
1138504754 16:57472640-57472662 TGCTGATTACCTCAGCCATGTGG - Exonic
1141686119 16:85570929-85570951 CCCAGATCACTCCAGCCAAAAGG - Intergenic
1142322577 16:89393648-89393670 ACGTGATTACTCCACCTAAGAGG - Intronic
1142341360 16:89524903-89524925 TCCTGAGTAACCCAGCAAAGGGG - Intronic
1151334201 17:73430478-73430500 TGCTGTTGACTCCAGGCAAGAGG - Intronic
1152488894 17:80615389-80615411 TCCTGACTCCTGCAGCTAAGGGG - Intronic
1153986420 18:10354764-10354786 TCCTGCTTACTCCAGGGAAGAGG - Intergenic
1160474868 18:79173712-79173734 TCTTGATTACTGCAGCCATCTGG + Intronic
1162533994 19:11252628-11252650 TCCTGCCTATTCCAGACAAGGGG + Intronic
1164920183 19:32083458-32083480 TCCTGATTACTGGAGCCAAGGGG - Intergenic
925671120 2:6310853-6310875 TCCTGATTTCTTCTGGCAAGAGG - Intergenic
925771143 2:7284185-7284207 TCCTCCTTCCTCCAGCCAAGTGG + Intergenic
926879085 2:17521052-17521074 TCCTGATTAATGGAGCCTAGTGG - Intergenic
929229350 2:39543272-39543294 TCATGATTACTGTAGCAAAGTGG - Intergenic
929373895 2:41260734-41260756 TCCTTATCACTACAGCCAAAAGG - Intergenic
929829627 2:45336390-45336412 TGCTGATTCCTTCTGCCAAGGGG - Intergenic
932790927 2:74654180-74654202 TCCTTCTTCCTCCAGCCAATCGG - Intergenic
936894475 2:117411870-117411892 TCCTGATTGCCCCTGCCACGTGG + Intergenic
942133863 2:172906468-172906490 TGCTGATTATCCCAGCCAAGGGG + Intronic
944144705 2:196494539-196494561 CCCAGATTCCTCCAGCCAACTGG + Intronic
948076604 2:235169795-235169817 TCCTTAATACTACAGCCAAGAGG + Intergenic
1168837757 20:888991-889013 TCCTGGTCACTCCAGCATAGTGG + Intronic
1168840609 20:907731-907753 ACATGATCACTCTAGCCAAGAGG - Intronic
1170534335 20:17325017-17325039 ACCTGAATTCTGCAGCCAAGAGG - Intronic
1172325327 20:34030004-34030026 TCCTGAGTCCTTCAGCCAGGTGG - Intronic
1179051911 21:37895664-37895686 TCCTGATTACTTCAGTAAAGAGG + Intronic
1179904958 21:44418073-44418095 TCCTGAAGACTCCGGCCAAGAGG + Exonic
1180026900 21:45169902-45169924 GCCTGATCCCTCCAGCCAGGAGG + Intronic
1181840819 22:25658875-25658897 TCCTCTGTACTCCAGCCAAACGG - Intronic
952514636 3:34091500-34091522 TCCTAATTACTCTATCCTAGAGG - Intergenic
955437430 3:58916726-58916748 TTCTGTTTCCTCTAGCCAAGGGG - Intronic
955877910 3:63513011-63513033 TACTGCTTACTGCAGGCAAGGGG + Intronic
957553171 3:81732978-81733000 TCCTGAATACTCTAGGCCAGGGG + Intronic
957729117 3:84109473-84109495 TCCTCAGTACTCTAGTCAAGAGG + Intergenic
958448771 3:94247348-94247370 TTCTGATCACTACTGCCAAGAGG - Intergenic
961014677 3:123458478-123458500 TCTTGAACACTCCAGACAAGAGG + Intergenic
963964099 3:151346224-151346246 TCCATATTAATCCAGCTAAGAGG + Intronic
964941937 3:162168925-162168947 TCCTGATTTCCCAAGGCAAGTGG - Intergenic
967469288 3:189843441-189843463 TCCTGATGGCTCCAGCCAAAGGG - Intronic
967914713 3:194570138-194570160 TCCTGCTTATTCCAGACAAGCGG + Intergenic
968032550 3:195513063-195513085 ACTTGGTTACTCCAGCAAAGTGG - Intergenic
969131104 4:4991655-4991677 TCCTGCTCACTCCTGCCCAGTGG - Intergenic
969412017 4:7034575-7034597 TCCTGAGTGCTGCAGCCCAGGGG + Intergenic
972154604 4:36143955-36143977 TCCTGATTTCTGCAGTCCAGCGG + Intronic
976219980 4:82748586-82748608 TCTTTATTACTCCAGAAAAGTGG + Intronic
984273363 4:177575475-177575497 TCATGAATACTGCAGTCAAGGGG - Intergenic
986812028 5:11370307-11370329 TTCTGATTAGGTCAGCCAAGTGG + Intronic
986985696 5:13499061-13499083 TCCTGTGTACTCTAGCCAAATGG + Intergenic
988995117 5:36707409-36707431 TCCTGATCACACCACACAAGAGG - Intergenic
992459980 5:76951830-76951852 TCCTGATTAAACCAACAAAGAGG + Intergenic
994619869 5:102150394-102150416 TCCTGCTTATTTCAGCTAAGAGG + Intergenic
999382427 5:151130968-151130990 ACCTGATCCCTCCAGCCAAATGG - Intronic
1001905728 5:175471553-175471575 TCTTGGCTACTCCAGACAAGTGG + Intergenic
1004599184 6:17131210-17131232 TCCTGTTTACTCCTGCCTTGTGG + Exonic
1006395184 6:33782598-33782620 TCCTGACTGCTCCAGCTAAAAGG + Intronic
1007069973 6:39029349-39029371 TCCTGAGCACTCCAGCCACAGGG + Intronic
1007924666 6:45641587-45641609 TGCTGATTTCTCCAGATAAGGGG - Intronic
1012747459 6:103111477-103111499 TGCTGATGACTCCAGAGAAGAGG - Intergenic
1013233392 6:108176146-108176168 ACCTGGCTACTCCAGCCCAGAGG + Intronic
1017003929 6:150015700-150015722 TCCTGGTTTCTTCAACCAAGGGG + Intergenic
1017523182 6:155220072-155220094 GGCTGATTCCTCCTGCCAAGTGG + Intronic
1018457008 6:163961909-163961931 TCCTGCTTCCTCCAGCCTGGTGG + Intergenic
1020765743 7:12318228-12318250 TTCTGATAACACCAGACAAGGGG - Intergenic
1021609490 7:22443815-22443837 TCCTGGTGGCTCCAGCCGAGTGG - Intronic
1023837229 7:44075424-44075446 TCCTGACTACTCTTGCCATGGGG + Intronic
1024209815 7:47193518-47193540 TACTGCTTTCTCCAGCCCAGTGG + Intergenic
1027579563 7:79976934-79976956 TGCTGATTGCTAGAGCCAAGTGG + Intergenic
1027666055 7:81043856-81043878 TCCTGATTGGTAGAGCCAAGTGG - Intergenic
1030872097 7:114768387-114768409 TCCTGATAACTCCTGTCAAGAGG - Intergenic
1035038119 7:155908529-155908551 CCCAGATTACTCCAGCCCCGAGG + Intergenic
1036226241 8:6960156-6960178 TCCAGATGACCCCAGCCATGAGG - Intergenic
1038117152 8:24570013-24570035 TCCTAATGATACCAGCCAAGTGG + Intergenic
1038474651 8:27856638-27856660 TCCAGGTGAGTCCAGCCAAGAGG + Intergenic
1039324832 8:36473709-36473731 TCCTGACTACTCCATTCTAGTGG - Intergenic
1041611203 8:59851373-59851395 TTCTGCTTACTCTAGCCAAAGGG - Intergenic
1042117629 8:65449436-65449458 TCCTCATTAATCCCCCCAAGTGG - Intergenic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1046607834 8:116390480-116390502 TGCTGTTTACTCCAGCAAAGTGG - Intergenic
1047799739 8:128296460-128296482 TCCTATTTGTTCCAGCCAAGAGG + Intergenic
1052944158 9:34154222-34154244 TCCCTACTTCTCCAGCCAAGTGG + Intergenic
1061377489 9:130235031-130235053 GGCTGAATGCTCCAGCCAAGGGG - Exonic
1062439830 9:136564685-136564707 TCCTGTTTACTGCACCCCAGAGG - Intergenic
1187118437 X:16378923-16378945 TCCTGACTTCTCCAGAAAAGTGG - Intergenic
1188897041 X:35681510-35681532 TCCTGGTTACTCCATTAAAGTGG + Intergenic
1189410369 X:40765182-40765204 ACCTCATCACTCCAGCCAACTGG - Intergenic
1190111981 X:47596179-47596201 TCCTGAATACTCCACTCATGGGG + Intronic
1190152066 X:47957197-47957219 TCCTGGTTCCTCCTCCCAAGCGG + Intronic
1195763827 X:108275497-108275519 TCTTGATTCCACCAGCCATGAGG + Intronic