ID: 920294803

View in Genome Browser
Species Human (GRCh38)
Location 1:204949388-204949410
Sequence CCATGGCTTTGCCCTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920294798_920294803 17 Left 920294798 1:204949348-204949370 CCACATCTCACTCAAGTCAAGTA 0: 1
1: 0
2: 0
3: 11
4: 121
Right 920294803 1:204949388-204949410 CCATGGCTTTGCCCTGATGCTGG 0: 1
1: 0
2: 0
3: 25
4: 235
920294796_920294803 29 Left 920294796 1:204949336-204949358 CCAGAATCCTCGCCACATCTCAC 0: 1
1: 0
2: 0
3: 12
4: 166
Right 920294803 1:204949388-204949410 CCATGGCTTTGCCCTGATGCTGG 0: 1
1: 0
2: 0
3: 25
4: 235
920294795_920294803 30 Left 920294795 1:204949335-204949357 CCCAGAATCCTCGCCACATCTCA 0: 1
1: 0
2: 2
3: 12
4: 127
Right 920294803 1:204949388-204949410 CCATGGCTTTGCCCTGATGCTGG 0: 1
1: 0
2: 0
3: 25
4: 235
920294797_920294803 22 Left 920294797 1:204949343-204949365 CCTCGCCACATCTCACTCAAGTC 0: 1
1: 0
2: 0
3: 9
4: 121
Right 920294803 1:204949388-204949410 CCATGGCTTTGCCCTGATGCTGG 0: 1
1: 0
2: 0
3: 25
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920294803 Original CRISPR CCATGGCTTTGCCCTGATGC TGG Intronic
900089406 1:913295-913317 CCAGAGCTCTGCCCTGCTGCTGG + Intergenic
901512595 1:9724864-9724886 CCACCTCTTTGCCCTGATGCGGG + Exonic
901814851 1:11788188-11788210 CCATGGCTCTGCCCTCCTTCTGG + Exonic
902728051 1:18350342-18350364 CCTTGGCCTTGCCCTGACCCAGG - Intronic
904887903 1:33755393-33755415 AACTAGCTTTGCCCTGATGCAGG - Intronic
905452030 1:38063095-38063117 CCAGGGCTTTGCACTGCTCCAGG + Intergenic
905898404 1:41564271-41564293 CCATTGCTTTGCCTTTTTGCTGG - Intronic
910427085 1:87129115-87129137 CCTTTGCTTTGGCCTGAGGCTGG + Intronic
911512176 1:98820323-98820345 CCTTCCCTTTGCCCTGACGCTGG - Intergenic
911646064 1:100338204-100338226 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
911948605 1:104142694-104142716 CCCAGGCTTTGCCCTCATGTTGG + Intergenic
911965253 1:104360526-104360548 CCATTGCTTTGCCTTGCTGCTGG - Intergenic
912388898 1:109288013-109288035 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
913317679 1:117566328-117566350 TCCTGGCTTTGTCCTGATTCTGG - Intergenic
914341429 1:146763607-146763629 CTCTGGCTATGCCCTAATGCTGG + Intergenic
915023201 1:152801582-152801604 CCATGCCTCTGCCTTCATGCAGG - Intronic
915074294 1:153296152-153296174 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
915312285 1:155010730-155010752 CCATGGCTTTGGCCTGCGTCTGG - Intronic
916231086 1:162541957-162541979 CTCTGGCTTTGCTCAGATGCTGG + Intergenic
916400114 1:164438596-164438618 CCTTGGCTTTGCCCTTGAGCTGG + Intergenic
919358703 1:196562096-196562118 CCAGGTCTTTTCCCTGATCCAGG - Intronic
919830241 1:201535828-201535850 CCATGCCTTGGTTCTGATGCTGG - Intergenic
920294803 1:204949388-204949410 CCATGGCTTTGCCCTGATGCTGG + Intronic
920444142 1:206002900-206002922 GCAGGGTTTTGCCCTCATGCAGG + Intronic
921393863 1:214647647-214647669 CCAAAGCTTTGCCCTTATGTAGG - Intronic
923012112 1:230096077-230096099 CCAGGGATTTGCCCTGCTGCAGG + Intronic
923147737 1:231209804-231209826 CTGTGGCTTTGCCCTGAGACTGG + Intronic
923328766 1:232903222-232903244 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
923893838 1:238246773-238246795 CCAGGGCTTTTCCTTGATGGTGG - Intergenic
1064156857 10:12909640-12909662 TCATTGCTTTGCCCTGACACCGG - Intronic
1065976975 10:30850152-30850174 CCAGAACTATGCCCTGATGCAGG - Exonic
1073094677 10:100972359-100972381 CTATCGCTTTGCTCTGATGCAGG - Intronic
1074019762 10:109570340-109570362 CAGTGGCTTTGCCGTTATGCAGG - Intergenic
1074906182 10:117865824-117865846 CCCTGGCTGTGCCCTGAAGGAGG - Intergenic
1075998317 10:126895669-126895691 CCATGGCTGGGCCCTGAATCAGG - Intergenic
1076422387 10:130340602-130340624 CCATGGCTCTCCCCTGCTCCTGG + Intergenic
1076812027 10:132891626-132891648 CCAGGGCTTTTCCCTGAGCCAGG + Intronic
1076832466 10:133003067-133003089 CCAAGTCTTTTCCCTGATCCAGG - Intergenic
1078046572 11:7918636-7918658 CCATGTCTTTTCCCTGATCCAGG + Intergenic
1079108125 11:17587374-17587396 CGATGAATGTGCCCTGATGCTGG + Intronic
1083539723 11:63504191-63504213 CCAAGTCTTTTCCCTGATCCAGG + Intergenic
1084045216 11:66564290-66564312 CCAGGGCTTCTCCCTGAGGCTGG - Intronic
1084429352 11:69102590-69102612 CCCAGGCTCTGCTCTGATGCTGG - Intergenic
1084654712 11:70508357-70508379 CCAGGACTTAGCCCTGATGGTGG - Intronic
1085766978 11:79291721-79291743 CCAGGGCTTTGCCCTTTTGGAGG - Intronic
1086758341 11:90593909-90593931 CCATTTCTTTGCCCTCAGGCTGG + Intergenic
1088330101 11:108642502-108642524 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
1089650721 11:119911014-119911036 CCTTGGCTTTGGCCTCTTGCTGG - Intergenic
1089773146 11:120817485-120817507 CCATTGCTTTTCCCTGGAGCAGG - Intronic
1090372242 11:126264510-126264532 CCAAGGCTTTGACGTGGTGCTGG - Exonic
1090820172 11:130335012-130335034 CCTTGGCTCTGCCCTGAAGCTGG + Intergenic
1091043207 11:132301540-132301562 GCATGGTTTTGCTCAGATGCTGG - Intronic
1091386143 12:96419-96441 CCAGGTCTTTTCCCTGATCCAGG - Intronic
1095314682 12:40745669-40745691 CCAGGCCTTTTCCCTGATCCAGG - Intronic
1095947982 12:47764653-47764675 GGATGGCTCTGCTCTGATGCTGG - Intronic
1098138469 12:67427833-67427855 GGCTGGCTTTGCCCAGATGCTGG + Intergenic
1098876620 12:75872418-75872440 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
1098999902 12:77167349-77167371 CATTGGCTTTGCCCTCATACTGG + Intergenic
1100863815 12:98834326-98834348 CCATGGCTTTACATTTATGCAGG + Intronic
1102196445 12:111028838-111028860 AAATGGCTTTCCCCTGTTGCTGG - Intergenic
1103035030 12:117649677-117649699 CCATGGCTTTGCCCTGGGAGTGG + Intronic
1104049260 12:125185436-125185458 CCGTGGCTTTGCCCTGGTTGGGG + Intergenic
1105869905 13:24495629-24495651 CCATGGCTTTGAGCTGGGGCAGG - Intronic
1108613699 13:52109548-52109570 CCAAGGCTTTTTCCTGATCCAGG + Intronic
1112443214 13:99440241-99440263 CCCTGACTTTCCCCTGAAGCAGG + Intergenic
1113042569 13:106120668-106120690 CAATGGCTCTCCCCTGGTGCTGG + Intergenic
1114347136 14:21808056-21808078 CCATGGAGTTGCACAGATGCGGG - Intergenic
1114355269 14:21900751-21900773 TCTTGGCTTTGCCCTGAGGGAGG - Intergenic
1115303444 14:31910631-31910653 CCATGTCTTTTCCCTGATCCAGG - Intergenic
1120195577 14:81478757-81478779 CCATTTCTTTTCACTGATGCTGG + Intronic
1121447244 14:93987031-93987053 CCAGGGCTGTGCCCTGAGGGTGG + Intergenic
1122058232 14:99119465-99119487 GCATGGCTCTGCCCTAATGTTGG - Intergenic
1122470044 14:101960368-101960390 CCAAGGCTTGGCCCTCAGGCTGG - Intergenic
1122707464 14:103629827-103629849 CCCCGGCTTGGCCCTGCTGCGGG + Intronic
1122848958 14:104516379-104516401 CCATGCCTTGGCCCTGCTCCAGG - Intronic
1123934821 15:25188980-25189002 CCCTGGCTATGCCCTACTGCAGG - Intergenic
1124116471 15:26847858-26847880 CCATGGCATTGTCCTGTTACCGG + Intronic
1124203536 15:27698459-27698481 CCATGCTTTTGCCCTGACCCTGG - Intergenic
1124603488 15:31153148-31153170 CCAGGTCTTTTCCCTGATACAGG + Intronic
1126558991 15:50022784-50022806 CCAAGGCTTTCCCCTGTTCCAGG - Intronic
1128819980 15:70643076-70643098 CCATTTCATTGCCCTGATCCGGG - Intergenic
1128898629 15:71398764-71398786 GCATGGGTCTGCCCTGGTGCTGG - Intronic
1131157646 15:90084892-90084914 CCATAGGTTTGCCCAGATGCTGG - Exonic
1132070619 15:98773855-98773877 CAATGGCTTTGTCCTTAGGCTGG - Intronic
1132536451 16:483666-483688 CCAGGTCTTTTCCCTGGTGCAGG + Intronic
1132665894 16:1081175-1081197 CCTTGGCCTTGCTCTGAGGCTGG + Intergenic
1134463876 16:14455865-14455887 TCTTGCCTTTGACCTGATGCTGG + Intronic
1135490666 16:22906529-22906551 CCAAGGCTCTGCCCTGTGGCTGG - Intronic
1135894609 16:26387509-26387531 CCTGGGCTTTCCCCTGAAGCAGG - Intergenic
1137593471 16:49708150-49708172 CCGTAGCTTTCCCCTGTTGCTGG - Intronic
1137602318 16:49764602-49764624 CCGTAGCTTTCCCCTGTTGCTGG - Intronic
1137735952 16:50723334-50723356 CCAAGCCTTGGCACTGATGCTGG + Exonic
1139581624 16:67877224-67877246 CAATGGCTCTGCCATGGTGCGGG + Exonic
1139992853 16:70953835-70953857 CTCTGGCTATGCCCTAATGCTGG - Intronic
1141681123 16:85544581-85544603 CCCTGTCTTTCCCCTCATGCTGG - Intergenic
1141864008 16:86737345-86737367 ACAGGGCTTTGCCGTGAAGCTGG - Intergenic
1142264299 16:89056733-89056755 CCCTGGCTCTGCACTGATGCTGG - Intergenic
1142803493 17:2359619-2359641 CCATGGCTGTGCTCAGAGGCTGG + Intronic
1143933009 17:10450589-10450611 CCATGACTGTGACCTGCTGCGGG - Exonic
1143937215 17:10498762-10498784 CCATGACTGTGACCTGCTGCGGG - Exonic
1145057832 17:19714847-19714869 CCCTGGCTCAGCCCAGATGCAGG - Intronic
1148907333 17:50919722-50919744 CCAGGGCTCTGCACCGATGCCGG - Intergenic
1150131123 17:62669841-62669863 CCACGGCTCTGGCCTGATTCAGG + Intronic
1151342931 17:73483190-73483212 CCCAGGCCTTGCCTTGATGCAGG + Intronic
1151669232 17:75562941-75562963 CCATGGCTGTGCCATGCTGGGGG + Intronic
1152102095 17:78308000-78308022 CCATAGCTTCGCCCTCAGGCAGG + Intergenic
1152274507 17:79348400-79348422 CTATGGCTTTGGCCTGGAGCAGG - Intronic
1153198875 18:2629533-2629555 CCATGGCTTGGACCTGCTGCAGG - Intergenic
1154077256 18:11215612-11215634 CCATGTCTTTGGTCTGGTGCTGG - Intergenic
1154415559 18:14173748-14173770 CCCTGGCTCTGCCCTTATCCAGG - Intergenic
1156018808 18:32576605-32576627 CCATTGTTTTGTCCAGATGCTGG + Intergenic
1157018210 18:43744873-43744895 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
1158821383 18:61163098-61163120 CCAGGGCTTTTTCCTGATCCAGG + Intergenic
1159880914 18:73857749-73857771 ATATGGCTTTGCCCTGATTAAGG + Intergenic
1161327254 19:3669875-3669897 CCATAGCTTTGCTCTGCTGCCGG + Intronic
1161739636 19:6012862-6012884 CCTTGGCTTTCCCAGGATGCTGG + Intronic
1162066098 19:8126312-8126334 CCGGGGCTTTGCCCGGATGACGG - Exonic
1163241972 19:16070015-16070037 CCAGGGCTGTGACCTGCTGCAGG + Intronic
1163746120 19:19048717-19048739 CCAGGTCTTTTCCCTGATTCAGG - Intronic
1168041993 19:53766033-53766055 CCAGGGCATTGCACTGGTGCAGG + Intergenic
925688495 2:6496110-6496132 CCACCTCTTTGCCCTGATGCAGG - Intergenic
926396215 2:12445511-12445533 CCCTGGGTTTGCTCTGATGTTGG + Intergenic
926705066 2:15831308-15831330 CTATGGCTTTGCTCTCAGGCAGG - Intergenic
927946348 2:27137405-27137427 CCCTGGCCTGGCCCTGAGGCAGG + Exonic
934670267 2:96208203-96208225 CCATGCCTCTGCCTTGATGGCGG - Exonic
936342112 2:111642948-111642970 CCATGGATTTACCCTGTGGCGGG + Intergenic
936476041 2:112840615-112840637 CAATGGCTTTTCCCTGATGTCGG + Intergenic
936710025 2:115121429-115121451 CCTTGGCTTTGTCCTGTTGATGG + Intronic
938072139 2:128314384-128314406 CCTTGGCACTGCCCTCATGCTGG - Intronic
939128969 2:138211680-138211702 CCATGGCTTTGGAATGCTGCTGG + Intergenic
940596603 2:155801510-155801532 GCTTAGGTTTGCCCTGATGCCGG - Intergenic
941094229 2:161217463-161217485 CTATGGTTTTGTCCTGATGATGG - Intronic
943642161 2:190371473-190371495 GGATGGCTTTGTCCTGTTGCTGG + Exonic
946466049 2:219913199-219913221 CCAGGGCTTAGACCTGAGGCTGG + Intergenic
948731793 2:239968894-239968916 CCATGGCCATGCCTTGATACTGG + Intronic
948840135 2:240644766-240644788 CCATGTCTGTGCCCTGAGGGTGG - Intergenic
1169014727 20:2282379-2282401 CCAAGGCTTTGCCCTCATGTTGG - Intergenic
1169971780 20:11276317-11276339 GCATGGCTTAGCCCTGATGAAGG + Intergenic
1170214387 20:13876353-13876375 CCATTTCTTTGCCCTCAGGCAGG - Intronic
1172690192 20:36784634-36784656 CCATGGCCTCGCCTTGGTGCCGG - Exonic
1173951187 20:46994631-46994653 CCAGAGCTTTGCCCAGGTGCTGG + Intronic
1174067721 20:47877874-47877896 CCCTGGTTTTGCTCAGATGCTGG + Intergenic
1174073127 20:47912676-47912698 TCATGGCTTGGACCAGATGCTGG + Intergenic
1175385771 20:58594098-58594120 CCTTGACTTTGTCCTGAAGCAGG + Intergenic
1175774526 20:61644648-61644670 CCCTGGCTTTGCCCTGGTTGTGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176857760 21:13985518-13985540 CCCTGGCTCTGCCCTTATCCAGG + Intergenic
1176860140 21:14007475-14007497 CCTAGGCTTTGCCCTCTTGCGGG + Intergenic
1177909130 21:27009021-27009043 CAAGAGCTTTGCCCTGATGCTGG + Intergenic
1179514856 21:41899323-41899345 CCACGACGCTGCCCTGATGCAGG - Exonic
1179557885 21:42192247-42192269 TCACTGCTTTGCCCTGAGGCCGG - Intergenic
1181627588 22:24132204-24132226 TCATGGCTGAGCACTGATGCAGG + Intronic
1181674202 22:24441324-24441346 CAATGGCTATGCCCTGGGGCTGG + Exonic
1182560175 22:31153495-31153517 CCAGGGCTCTGCCCTTATGGTGG - Intergenic
950112431 3:10428073-10428095 CCATCCATTTGCCTTGATGCTGG + Intronic
950169434 3:10827805-10827827 CCATGGCTTTGCCTTGACCATGG + Intronic
950964660 3:17137904-17137926 CCGTGGCTTTGCCTTTCTGCAGG + Intergenic
952965031 3:38615886-38615908 ACATGGCTTTGGCCTGCTGGAGG + Intronic
953320088 3:41963580-41963602 CCAGGTCTTTTCCCTGATGCTGG + Intergenic
954121529 3:48503025-48503047 CCATGGCTTTGCCCAGAGCAGGG - Intronic
954302347 3:49706601-49706623 CCATGGCCTTGTTCTGAGGCTGG + Intronic
956379509 3:68650895-68650917 CTATGTCTTCACCCTGATGCTGG + Intergenic
959564891 3:107824180-107824202 TCCTGGCCTTGCCCTGAAGCAGG - Intergenic
960481906 3:118201764-118201786 CCCAGGCTTTGCCCTGATGGTGG + Intergenic
961323056 3:126091678-126091700 CCATGTCTTTTTCCTGATCCAGG - Intronic
961480344 3:127175429-127175451 CCAAGGCTCTGGCCTGACGCCGG + Intergenic
963088572 3:141461104-141461126 ACATGTCTTTGCTCTGATGGTGG - Intergenic
963174558 3:142284081-142284103 CAAGGGCTTTACCCTGAAGCAGG + Intergenic
964966400 3:162498824-162498846 CCATGGGTTTACCCAGATGCAGG + Intergenic
966820789 3:183922703-183922725 CCATGCCTTTGCCCTGTGGCGGG - Intronic
967996802 3:195173077-195173099 CCATGCCTCTACCCTGATCCTGG + Intronic
969391391 4:6893561-6893583 GCATGGGTTTGGCCTGGTGCAGG + Intergenic
969487439 4:7480175-7480197 TCTGGGCTTTGCCCTGAAGCAGG + Intronic
969704160 4:8782992-8783014 GCATGGCCTTGCCCTGTGGCTGG + Intergenic
975751195 4:77525137-77525159 CAAAGGCTTTTCTCTGATGCTGG + Intronic
975987121 4:80211086-80211108 CCTTCGCTTAGCCCTGACGCTGG - Intergenic
976689854 4:87857214-87857236 CCATGGCTTTGCTCCCATGGTGG - Intergenic
977692410 4:99929057-99929079 CCATGGCTTTACCATGATTAAGG + Intronic
978203603 4:106052214-106052236 TCTTGGCTTTGCTCTGCTGCTGG - Intronic
979633871 4:122935098-122935120 CCATCTCTTTGCACTGAAGCAGG + Intronic
981490736 4:145336717-145336739 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
981748106 4:148069862-148069884 CCAAAGCTTTTCCCTGATGGTGG + Intronic
983615708 4:169702121-169702143 AGATGGCCTTTCCCTGATGCTGG + Intronic
984756648 4:183331172-183331194 CCAGGGCCTGGCCCTGAGGCTGG - Intergenic
988902953 5:35753740-35753762 CCATTTCTTTTCCCTGATGCAGG + Exonic
995346982 5:111132815-111132837 CCATGGCTTAGCCTTAATGGGGG - Intergenic
999082874 5:148860810-148860832 TCATGGCTTTGCCTTTGTGCAGG + Intergenic
999302263 5:150498584-150498606 CCCTGGCTTTGTCCTGAGGCAGG + Intronic
1000253056 5:159513528-159513550 CCATGGGGTTGCCCTGAAGTGGG - Intergenic
1000429356 5:161133045-161133067 CAATGACTTTGCCCAGATCCCGG + Intergenic
1000718820 5:164680512-164680534 CCATGTCTTTTTCCTGATCCAGG - Intergenic
1001333028 5:170775692-170775714 ACTTGGGTTTGCCCTGAGGCTGG + Intronic
1002344463 5:178537661-178537683 TCATGGCCTTGCCCTGTGGCTGG - Intronic
1002705809 5:181160399-181160421 CCAAGGCTTTGGCCTGTGGCAGG + Intergenic
1003167526 6:3694042-3694064 CCAGGGCTTTGCGCAGAAGCTGG - Intergenic
1003787048 6:9498202-9498224 CCAGGTCTTTTCCCTGATTCAGG - Intergenic
1004580515 6:16946738-16946760 TCATGGCTTTGCCCTGCAGGTGG + Intergenic
1005753722 6:28906901-28906923 CCATGGTTTGACCCTGAAGCTGG + Intronic
1006241052 6:32679472-32679494 CCAGGGCACTGACCTGATGCTGG + Intergenic
1006332715 6:33403895-33403917 CCAGGGCCTTGACCTGCTGCTGG - Exonic
1006635822 6:35460455-35460477 CCAGGGCCTTGCCCTGCTGTGGG + Intronic
1008047900 6:46870347-46870369 ACAGGGCTTTGCCATGTTGCTGG + Intronic
1008897881 6:56578660-56578682 GCATGCCTTTTCCCAGATGCAGG + Intronic
1009346436 6:62617440-62617462 CCTTCCCTTTTCCCTGATGCAGG + Intergenic
1011540907 6:88427363-88427385 CCATTGCTTTTCCATTATGCTGG + Intergenic
1011728569 6:90236009-90236031 CCAGGGCTATGCCCTTATGGGGG + Intronic
1013474306 6:110493523-110493545 ACATGGCTTCTCCCTGGTGCAGG - Intergenic
1013545360 6:111151698-111151720 ACATGGCTTTGCTGTGATTCTGG + Intronic
1017238686 6:152143715-152143737 CCAGGGCTTTGCCCAGTTGTCGG + Exonic
1017836943 6:158187333-158187355 CCAGGTCTTTTCCCTGATCCAGG - Intronic
1018385820 6:163301996-163302018 CGATGGCTTTCCCCTGAATCAGG - Intronic
1018486805 6:164248974-164248996 CCCTGGCTGTGCCATGAGGCTGG + Intergenic
1018903584 6:168063106-168063128 CTATGCCTTTGATCTGATGCTGG - Intronic
1019278721 7:189219-189241 GCATGGCTTTGCACAGAAGCTGG - Intergenic
1021436828 7:20627802-20627824 CCATGACATTGCCATGATGCCGG + Intronic
1022311678 7:29202298-29202320 CATTTGCTTTGCCCTGATGTGGG - Intronic
1022863020 7:34387771-34387793 CCAAGTCTTTTCCCTGATCCAGG - Intergenic
1024611169 7:51065598-51065620 CCAGGGCTTGGCCCTGTTGGAGG - Intronic
1024722105 7:52148855-52148877 CCAGGGCCTTTCCCTGATCCAGG + Intergenic
1025231944 7:57208325-57208347 TCATGGCTTGGTCCAGATGCTGG + Intergenic
1026086367 7:67266443-67266465 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
1026097615 7:67358977-67358999 CAAGGGCTTGTCCCTGATGCTGG + Intergenic
1026690781 7:72548386-72548408 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
1030825734 7:114155545-114155567 TCAGGTCTTTTCCCTGATGCAGG + Intronic
1032791811 7:135247977-135247999 CCATGGCTTCCGCCTGATACAGG + Intronic
1034223839 7:149467189-149467211 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
1034259713 7:149747210-149747232 TCAGGGCTTTGACCTGATCCTGG - Intergenic
1035607993 8:941646-941668 CCATGGCTTTTCGCTGTGGCTGG - Intergenic
1036977189 8:13426983-13427005 CCCTGGCTTTTGTCTGATGCAGG + Intronic
1037056194 8:14444990-14445012 CCATTACTTTCCCCTGATGTAGG + Intronic
1039220053 8:35320456-35320478 CCAGGTCTTTTCCCTGATCCAGG - Intronic
1041177567 8:55212264-55212286 CCATGTCTTTTTCCTGATCCAGG - Intronic
1043346842 8:79308134-79308156 CCTTTGCTTGGCCCTAATGCAGG - Intergenic
1043973728 8:86562307-86562329 CAATGGCTTTGCCTTGGTGAAGG + Intronic
1044211941 8:89560851-89560873 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
1044979556 8:97702352-97702374 CCCTGCCTTTGCCCATATGCAGG + Intronic
1045044064 8:98257643-98257665 CCAGGTCTTTTCCCTGATCCAGG + Intronic
1045169587 8:99649678-99649700 TCCTGGCTTTGCCCTGAGGGTGG - Intronic
1046870285 8:119197932-119197954 TAATGGCTTGGCCCTTATGCTGG - Intronic
1049204764 8:141358634-141358656 CCAGGGCATTGACCTGATGCTGG - Intronic
1049849426 8:144822883-144822905 GATTGGCTTTGCCCTGGTGCAGG - Intergenic
1051672925 9:19530255-19530277 CCATGGCTGTGCTCTGTTACAGG + Intronic
1056306075 9:85291920-85291942 CTCTGGCTTAGCCCTGATTCTGG + Intergenic
1056768090 9:89457337-89457359 CCATGGCTTTGCTACGATGCAGG - Intronic
1057547985 9:96032202-96032224 CCCTGGCCTTTCCCTGATGAAGG - Intergenic
1059424511 9:114212235-114212257 CCAGGTCCTTGCCCTGAAGCTGG - Intronic
1059534540 9:115069339-115069361 TCATGGCTTTGACCTTAAGCAGG + Intronic
1061315475 9:129792921-129792943 CCACTGCTCTGCCCTGGTGCTGG - Intergenic
1061589178 9:131587864-131587886 CCCCGGCTTTCCCCTGATGGGGG + Intronic
1061879631 9:133562341-133562363 CCATGGCTATGCCCTGTTTGGGG - Intronic
1186618626 X:11214992-11215014 TCAGGGCCTTGCCCTGATTCAGG - Intronic
1186876822 X:13825615-13825637 TCCAGGCTTTGCACTGATGCTGG - Intronic
1190360339 X:49643411-49643433 CCAGGCCTTTTCCCTGATCCAGG + Intergenic
1190887775 X:54544305-54544327 CCAGGTTTTTGACCTGATGCTGG - Exonic
1192247042 X:69381810-69381832 CAATGGCTTTGCTGAGATGCTGG + Intergenic
1192469275 X:71382905-71382927 CCATGGCTTTGTTCTGACGGAGG + Intronic
1196128273 X:112123754-112123776 CCATGCCTATGTCCTGAAGCTGG - Intergenic
1197159427 X:123307158-123307180 TCCTGGCTTTGCCTTGATGGTGG - Intronic
1198140672 X:133799440-133799462 AGATGGCTTTGTCCTGATGGTGG - Intronic
1199441361 X:147871704-147871726 CCAGGGCTTTGTTCTGATGAAGG - Intergenic
1201723518 Y:17130415-17130437 CCAGGCCTTTTCCCTGATCCAGG + Intergenic