ID: 920296473

View in Genome Browser
Species Human (GRCh38)
Location 1:204960378-204960400
Sequence CTGTTACAGCATAGGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920296473_920296484 29 Left 920296473 1:204960378-204960400 CCACTCTGCCTATGCTGTAACAG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 920296484 1:204960430-204960452 GCAACTGTGGTAAGCGAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 101
920296473_920296478 7 Left 920296473 1:204960378-204960400 CCACTCTGCCTATGCTGTAACAG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 920296478 1:204960408-204960430 GTGCCTCCTGATGCAATAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 106
920296473_920296482 25 Left 920296473 1:204960378-204960400 CCACTCTGCCTATGCTGTAACAG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 920296482 1:204960426-204960448 AGAGGCAACTGTGGTAAGCGAGG 0: 1
1: 0
2: 0
3: 10
4: 124
920296473_920296483 28 Left 920296473 1:204960378-204960400 CCACTCTGCCTATGCTGTAACAG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 920296483 1:204960429-204960451 GGCAACTGTGGTAAGCGAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 104
920296473_920296481 16 Left 920296473 1:204960378-204960400 CCACTCTGCCTATGCTGTAACAG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 920296481 1:204960417-204960439 GATGCAATAAGAGGCAACTGTGG 0: 1
1: 0
2: 0
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920296473 Original CRISPR CTGTTACAGCATAGGCAGAG TGG (reversed) Intronic
900515281 1:3078930-3078952 CTGTAACAGCCTCGTCAGAGAGG + Intronic
902874035 1:19330417-19330439 CTGACACAGCAAAGGCTGAGTGG - Intergenic
903383251 1:22910807-22910829 CTTTTAAAGCATGGTCAGAGAGG + Intronic
904672738 1:32178535-32178557 TTGTTACAGCATTAGCAGTGAGG - Intergenic
904992511 1:34604564-34604586 TTGTCACAGCAAAGGAAGAGAGG - Intergenic
906590381 1:47019520-47019542 CTGTTTCAGCATTGGCTGAATGG - Intergenic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
908472926 1:64461648-64461670 CTGTTGTGGCATTGGCAGAGGGG + Intergenic
911765587 1:101670666-101670688 CAGCTACTCCATAGGCAGAGTGG - Intergenic
911820219 1:102409707-102409729 ATTTTAGAGCACAGGCAGAGTGG - Intergenic
912157458 1:106939122-106939144 CTGTTACAAAATAGGGAGTGAGG - Intergenic
919411295 1:197246207-197246229 CTATGCCAGCATAGGCTGAGTGG - Intergenic
920296473 1:204960378-204960400 CTGTTACAGCATAGGCAGAGTGG - Intronic
920603912 1:207361115-207361137 TTATTACAGAATAGGCAGAGCGG - Intergenic
924168688 1:241313467-241313489 TTGATAGAGCACAGGCAGAGTGG - Intronic
1064193431 10:13226806-13226828 CTCTTACAGGATAGGAAGACAGG - Intronic
1064701179 10:18023468-18023490 CTGCTACAGCAGTGGCAGAGGGG + Intronic
1069185430 10:65416998-65417020 GTGGAACAGCATATGCAGAGAGG - Intergenic
1070270553 10:74950406-74950428 CTGTTACTGCAGATGCAGACGGG + Intronic
1072118883 10:92388779-92388801 TTGTTACACCACAAGCAGAGGGG + Intergenic
1074257921 10:111821874-111821896 CTGGTACAGGAGAGGGAGAGAGG - Intergenic
1075220820 10:120582908-120582930 CTGGTACAGTATAAGCTGAGAGG - Intronic
1086162289 11:83735357-83735379 CTTCTACTGCACAGGCAGAGAGG + Intronic
1086436187 11:86783061-86783083 CTTTCAGAGCAAAGGCAGAGGGG + Intergenic
1086611278 11:88758690-88758712 CTTTTACAACCTAGCCAGAGAGG + Intronic
1090531421 11:127594821-127594843 CTGATTCAGCATATCCAGAGTGG + Intergenic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1095765722 12:45893239-45893261 CTGTGACAGCCTAGGCAAAGGGG - Intronic
1098722248 12:73915231-73915253 CTGATACAGTAGAGGCAGTGTGG - Intergenic
1099877476 12:88427047-88427069 TTGTTGCAGCATATGCAGAGAGG - Intergenic
1100090976 12:90970667-90970689 CTGTGCCAACACAGGCAGAGTGG + Intronic
1100480819 12:94977207-94977229 CTGTAACAGGCTAGGCACAGTGG + Intronic
1101321047 12:103673460-103673482 CAGTTACTGCAGAGGCCGAGAGG - Intronic
1102473984 12:113176778-113176800 CTGGGAAAGCAGAGGCAGAGAGG - Intronic
1102896598 12:116603320-116603342 TTGTTACAGCTTAGGGGGAGGGG - Intergenic
1103165284 12:118765126-118765148 CTGTTACAACAGTGGCAGACTGG + Intergenic
1105554874 13:21437619-21437641 TTTCTAGAGCATAGGCAGAGTGG - Intronic
1113375651 13:109763038-109763060 CTTTCACACCATAAGCAGAGTGG + Intronic
1113779144 13:112966027-112966049 GTTTTACAGAATATGCAGAGAGG - Intronic
1113956235 13:114101176-114101198 CTGTTACAGACAAGTCAGAGAGG + Intronic
1116818037 14:49601036-49601058 CTATTCCAGCATACCCAGAGTGG + Intronic
1125098733 15:35885347-35885369 ATGTAACAGCATAAACAGAGGGG - Intergenic
1125363697 15:38891096-38891118 CTGGGACATCACAGGCAGAGGGG + Intergenic
1125564672 15:40667588-40667610 CTGTTTCAGAAGAGGAAGAGAGG + Intergenic
1126200305 15:45978299-45978321 CAGTTCCAGCATAGGAAGGGTGG - Intergenic
1128678889 15:69632094-69632116 CTGTTTCCGCATCTGCAGAGAGG + Intergenic
1129052012 15:72789359-72789381 CTGCTACTCCATAGACAGAGCGG + Intergenic
1131273034 15:90958226-90958248 CTGTTAGAGCCCATGCAGAGAGG + Intronic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1132752446 16:1465016-1465038 CAGTGACAGCATGGGCAGCGAGG - Intronic
1132889909 16:2198533-2198555 CAGTTGCTGCACAGGCAGAGAGG - Intergenic
1133338805 16:5023483-5023505 CTGTCACAGCAAAGTTAGAGGGG - Intergenic
1135780641 16:25297118-25297140 CTGTTACAGATTAGGTAAAGAGG + Intergenic
1136286860 16:29249212-29249234 ATGGGACAGCAGAGGCAGAGTGG - Intergenic
1136482795 16:30553079-30553101 CTGTACCATCATGGGCAGAGCGG - Intronic
1136567429 16:31078742-31078764 CAGTGACAGCATTGGCAGAGTGG - Exonic
1136610871 16:31364120-31364142 CTGTTAAAAAATAGGCAAAGGGG + Intronic
1138710288 16:58963424-58963446 ATCTTACAGCTTAGGCAGAGAGG - Intergenic
1139082019 16:63533792-63533814 TTGATAGAGCACAGGCAGAGTGG + Intergenic
1139732147 16:68955464-68955486 CTGTGACTGCATTGGCACAGTGG + Intronic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1147872140 17:43594954-43594976 TGGATACTGCATAGGCAGAGCGG + Intergenic
1157227924 18:45884497-45884519 CAGGTACAGCAGAGGCTGAGAGG - Intronic
1158909623 18:62047168-62047190 CTATTCCAGCATAGGCTGAGTGG + Intronic
1160391484 18:78536802-78536824 CTTTTGCAGCGTAGGAAGAGTGG - Intergenic
1164610031 19:29625507-29625529 CTGTTTCAGCATTGACTGAGTGG + Intergenic
1164911437 19:32015475-32015497 GTGGTCCAGCATAAGCAGAGTGG - Intergenic
925591063 2:5510545-5510567 CTGTGACAGAAGAGGAAGAGAGG + Intergenic
926874680 2:17462121-17462143 CTGTGATAGCATGGGGAGAGGGG + Intergenic
927092674 2:19723934-19723956 CTTTTAGAGCAGGGGCAGAGAGG - Intergenic
931434695 2:62236289-62236311 CTGTTCCAGCCTCAGCAGAGGGG - Intergenic
935882578 2:107580425-107580447 CTGGTAGAGCATAGGAAGAAAGG + Intergenic
939249638 2:139667336-139667358 CTGATTCAGCAGAGGGAGAGAGG - Intergenic
943727472 2:191267089-191267111 TTGTCTCTGCATAGGCAGAGAGG - Intronic
944799485 2:203225435-203225457 TTGTTACAGGCTAGGCACAGTGG + Intronic
945732317 2:213553922-213553944 CTGTTACAGACTTGGCAGTGGGG + Intronic
947885834 2:233570277-233570299 CTGTTTCAGGAGTGGCAGAGGGG - Intergenic
948928186 2:241113096-241113118 CTGTTATTGGAGAGGCAGAGTGG - Intronic
1170750255 20:19139006-19139028 ATTTTACAGGATAGGCAGAAGGG - Intergenic
1172808055 20:37627330-37627352 CTTTTACAGAAAAGGCAGGGGGG - Intergenic
1172857861 20:38021772-38021794 CTGTTACAAGTTAGGTAGAGGGG - Intronic
1173989616 20:47291712-47291734 GTGATAGAGCATAGGCAGTGAGG + Intronic
1174158718 20:48535098-48535120 GGGCTACCGCATAGGCAGAGAGG + Intergenic
1176275020 20:64260501-64260523 CTGTGGCAGCACAGGAAGAGGGG - Intronic
1176909285 21:14543223-14543245 CACTTACAGTATAGGCTGAGAGG - Intronic
1178790459 21:35694855-35694877 TTGTAACAGCAAAAGCAGAGGGG + Intronic
1180220127 21:46353265-46353287 CTGTTACAGCAGAGGCTGCAGGG + Exonic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1181770619 22:25122644-25122666 CTGATACAGGACAGGCAAAGTGG - Intronic
1183049087 22:35246198-35246220 CTGTGCCAGCAAAGGCTGAGTGG - Intergenic
1184349857 22:43936421-43936443 CTCTTACAGCATTGGCACACTGG - Intronic
949695282 3:6687329-6687351 CTGTTTCATCATGAGCAGAGAGG + Intergenic
950373115 3:12547934-12547956 TTGTTACAGTGAAGGCAGAGAGG + Intronic
950817932 3:15726909-15726931 ATTTTAGAGCATAGGCAAAGTGG - Intronic
950972313 3:17201590-17201612 GTGTTACAGCAGAGGCAGGATGG + Intronic
951176266 3:19604381-19604403 CTGATAGAGAATAGGCATAGTGG + Intergenic
955106978 3:55907918-55907940 CTGCTACAGAAGAGGCAGACAGG + Intronic
955382083 3:58447545-58447567 TTATTAAAGCACAGGCAGAGTGG + Intergenic
965355194 3:167664743-167664765 CTCTTACAGCATAGGGAGAAGGG + Intergenic
965508499 3:169542368-169542390 ATGTTATTGCATAGGCGGAGGGG - Intronic
966736345 3:183189986-183190008 CTCCTACAGCAGAGGCAGACTGG - Intronic
968142423 3:196269545-196269567 CTGAGACAGGATAGGCAGTGTGG + Intronic
970382446 4:15521634-15521656 CACTTTCAGCATAGCCAGAGAGG - Intronic
970493342 4:16598964-16598986 CTGTTCCAGCATGGGCAGGGTGG + Intronic
972131015 4:35833396-35833418 CTGATACAGCTTAAGCAGACAGG + Intergenic
973649337 4:52982198-52982220 CTGTCACAGCATAAGCATAATGG + Intronic
978727578 4:111987599-111987621 TTGTTACAGAATAAGCATAGAGG + Intergenic
979775294 4:124582413-124582435 CTGCTAAAGCATAGCAAGAGTGG + Intergenic
980182215 4:129414809-129414831 CTGTGACACCATAGGTAGAAAGG - Intergenic
980971060 4:139567613-139567635 CTGTCACGGCATATGCAGAAGGG + Intronic
983012330 4:162563066-162563088 CTGTTTCAGCACTGACAGAGTGG - Intergenic
983081080 4:163386333-163386355 CTGTTACAAGATAGGTAGATGGG + Intergenic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
990471976 5:56123901-56123923 CTGTGACAGCTGAGGCAGATTGG - Intronic
990910455 5:60846344-60846366 CTGTTACTGGATAGGCACACAGG - Intergenic
995277017 5:110288628-110288650 CGGTTACAGGATAGGCAATGGGG + Intergenic
996512454 5:124331974-124331996 TTGACAGAGCATAGGCAGAGTGG + Intergenic
1000916145 5:167084215-167084237 ATTTTTCAGCAAAGGCAGAGAGG - Intergenic
1001179939 5:169510893-169510915 TTGTCACAGCTGAGGCAGAGGGG - Intergenic
1001949711 5:175807792-175807814 CTATTCCAGCAAAGGAAGAGGGG + Intronic
1003244170 6:4370177-4370199 CTGTAACAGAGCAGGCAGAGGGG + Intergenic
1003763413 6:9208676-9208698 CAGTTACAGCAATGGCTGAGTGG + Intergenic
1004292417 6:14380452-14380474 CTGTTACTGGAGAGGCAGATAGG - Intergenic
1005504294 6:26456753-26456775 CTGTCACAGCAGAGACACAGTGG + Intergenic
1011217301 6:85018599-85018621 CTGAGACCGCAGAGGCAGAGTGG - Intergenic
1011452206 6:87505536-87505558 CTATAACAGAATACGCAGAGTGG + Intronic
1013300979 6:108804637-108804659 CAGTTACAGCATGGGTAGACAGG + Intergenic
1018109466 6:160520739-160520761 CTCTTAGAGCATGGCCAGAGTGG + Intergenic
1019873543 7:3789433-3789455 CAGTTACAGGCTGGGCAGAGTGG - Intronic
1020508609 7:9023516-9023538 CTGTTACAGTAAAGTGAGAGAGG + Intergenic
1022383520 7:29882489-29882511 CTGTCACATTATAGCCAGAGGGG + Intronic
1022481578 7:30746902-30746924 CTCTTACAGCATCTGCAGAGGGG - Intronic
1023057731 7:36303294-36303316 CTCTTACACCACAGACAGAGTGG + Intergenic
1024868334 7:53930943-53930965 CCCTTACAGCATAGGCAAGGTGG - Intergenic
1027779454 7:82503980-82504002 CTGCTGCAGCAGAGGAAGAGAGG - Intergenic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1035076861 7:156184920-156184942 CTGTAACAGCACAGGAAGATCGG - Intergenic
1036296213 8:7540279-7540301 CTGTAACTGCATAGACACAGGGG + Intronic
1036326353 8:7780740-7780762 CTGTAACTGCATAGACACAGGGG - Intronic
1036414737 8:8536554-8536576 CTGCTACAGCATAGGAAGTAGGG - Intergenic
1037781815 8:21874646-21874668 CTGGAACAGCGTAGGTAGAGGGG + Intergenic
1039049839 8:33483363-33483385 TGGCTACTGCATAGGCAGAGCGG + Intronic
1040976049 8:53195472-53195494 ATGTGACAGCCTTGGCAGAGTGG - Intergenic
1041472439 8:58225627-58225649 CTGTCACACAATAGGAAGAGAGG - Intergenic
1042934430 8:74044505-74044527 TTCTTACAGCTTAGCCAGAGGGG + Intergenic
1047609069 8:126503433-126503455 ATTTTAAAGCATAGGCACAGAGG + Intergenic
1048257645 8:132917255-132917277 CTGTTACATCACAGCCAGGGTGG + Intronic
1049271561 8:141698830-141698852 CAGCAACATCATAGGCAGAGAGG - Intergenic
1049740636 8:144239330-144239352 CGGTTACAGCATAGGGAGACGGG - Exonic
1050268159 9:3913116-3913138 ATGTTACAGCTTAGGAAGTGTGG + Intronic
1054993199 9:71354041-71354063 CAGTTACAGCATATGATGAGTGG - Intronic
1055512916 9:77012900-77012922 CTGTAACAAAATATGCAGAGAGG - Intergenic
1057128264 9:92635997-92636019 CTGTTATATCATAGGGACAGAGG + Intronic
1057480377 9:95440607-95440629 CTGTCTCAGGATTGGCAGAGGGG + Intergenic
1058602695 9:106687651-106687673 CACTTACAGCATAGGCAGTAGGG + Intergenic
1059757107 9:117303987-117304009 CTGGGGCAGCATAGGCAGATGGG - Intronic
1188162599 X:26821473-26821495 CTGTTTCAGCTTAGGTACAGGGG + Intergenic
1189523699 X:41797786-41797808 CTGTTACCCCATAGGCTGTGTGG + Intronic
1190863627 X:54366481-54366503 CTGTTGCGGGATAGGCAGTGAGG + Intergenic
1192223223 X:69211446-69211468 CTGGTCCACCATGGGCAGAGAGG + Intergenic
1193693692 X:84680539-84680561 CTGTTTCAGCTTAGGCACAGAGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194289684 X:92055063-92055085 CTATTCCAGGAAAGGCAGAGTGG + Intronic
1195361167 X:104085018-104085040 CTGCCAAAGCAGAGGCAGAGAGG + Intergenic
1196525872 X:116726723-116726745 TTGTTAAAGCATAGCAAGAGTGG - Intergenic
1197835706 X:130691491-130691513 ATTTTACAGCATAGGAAGACAGG - Intronic
1199441074 X:147867929-147867951 CTGATCCAGCATAGTCATAGTGG + Intergenic
1200607197 Y:5279639-5279661 CTATTCCAGGAAAGGCAGAGTGG + Intronic