ID: 920297009

View in Genome Browser
Species Human (GRCh38)
Location 1:204964405-204964427
Sequence GAAGCCAAGGGGCAAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920297009 Original CRISPR GAAGCCAAGGGGCAAAAAGC AGG Intronic
901290533 1:8120649-8120671 GTAGGGAAGTGGCAAAAAGCTGG - Intergenic
902566350 1:17314163-17314185 GAGGCCGAGGGGCACACAGCAGG - Intronic
904575524 1:31502881-31502903 GAAGCAAAGGCTCAAAAAGGTGG - Intergenic
904852526 1:33469510-33469532 GCAGCTAAGGATCAAAAAGCTGG + Intergenic
906212896 1:44022028-44022050 AAAGCCAAAGGGCAGAGAGCGGG + Intronic
906778924 1:48555092-48555114 GAAGTCAGGGTGCAAAAAGTGGG + Intronic
907678427 1:56540462-56540484 GAAGGCAAGGGAAAAAAATCTGG + Intronic
907909757 1:58815514-58815536 GGAGCCACGGGGCCAAAAGGAGG + Intergenic
909577996 1:77197153-77197175 GAAGCAAAGGAGAACAAAGCTGG + Intronic
912195037 1:107387869-107387891 GAAGGCAAGTGGAAAAAAGAGGG - Intronic
913437727 1:118864559-118864581 GAAAACAAGGGGCAAAGGGCAGG - Intergenic
913608651 1:120489864-120489886 GAAGGCAAGGGTCACAAGGCTGG + Intergenic
914133906 1:144883075-144883097 GGCGGCAGGGGGCAAAAAGCCGG + Intergenic
914370395 1:147019642-147019664 GAAGGCAAGGGTCACAAGGCTGG + Intergenic
914484299 1:148093768-148093790 GAAGGCAAGGGTCACAAGGCTGG - Intergenic
914582547 1:149031974-149031996 GAAGGCAAGGGTCACAAGGCTGG - Intronic
915514922 1:156407098-156407120 CAAGCCAAGAGCCAAAGAGCTGG + Exonic
916898557 1:169194239-169194261 GAAGGCAAGGGACAAGAAGGTGG + Intronic
917368632 1:174262760-174262782 GGAGCCAAGGGGCAATAACCTGG - Intronic
918065350 1:181096979-181097001 AAAGCCAAGGAGAAAAAAGTGGG - Intergenic
920297009 1:204964405-204964427 GAAGCCAAGGGGCAAAAAGCAGG + Intronic
920644916 1:207794787-207794809 GAAGCCAGCAGGCGAAAAGCAGG + Exonic
921176195 1:212596696-212596718 AATGCCAAGGGGGAAAAAGAAGG + Intronic
922283712 1:224149927-224149949 AAAGCCCTGGGGCAAAAAGGTGG + Intronic
923142584 1:231173531-231173553 GAAGACAAGGGCCAAGAACCAGG + Intronic
1063098421 10:2928422-2928444 GAATCCAAGAGGCAACCAGCAGG + Intergenic
1063800344 10:9570278-9570300 GGAGCCAAGGGGGAAAATGTAGG - Intergenic
1064814621 10:19245052-19245074 GAATCCAAGGGATGAAAAGCAGG + Intronic
1064897015 10:20248531-20248553 AAAGCCAAGCGGAGAAAAGCTGG - Intronic
1066092917 10:32043552-32043574 GAAGCCATGGTGGAAAAAACAGG + Intronic
1066545419 10:36494831-36494853 GTAGGCAAGAAGCAAAAAGCAGG - Intergenic
1066745011 10:38600280-38600302 GCGGCGAGGGGGCAAAAAGCCGG - Intergenic
1067334929 10:45353320-45353342 GAAGCCAAGAGGCAAAAGCCTGG + Intergenic
1068849644 10:61721851-61721873 GAAGAGAAGGGGGAAGAAGCAGG + Intronic
1069273194 10:66556683-66556705 GAAGCCAAAGAGTAGAAAGCTGG + Intronic
1070664809 10:78335645-78335667 TAAACCAAGGGGAAGAAAGCTGG - Intergenic
1070746458 10:78936694-78936716 GCAGCCAAGGGGCAGAAGCCTGG + Intergenic
1071495594 10:86165535-86165557 GAAGCCCAGGGCCAAAGAGGCGG + Intronic
1071976148 10:90957303-90957325 AAAGCCAATGGGCCAAAAGGTGG - Intergenic
1074146491 10:110721370-110721392 GTAGCCAAGGTTCTAAAAGCAGG - Intronic
1074687214 10:115972078-115972100 GAAGCCACGGGACAGAAAGCTGG + Intergenic
1074953376 10:118363243-118363265 GAAGCCAAGTGGATAAGAGCAGG + Intergenic
1075542695 10:123328895-123328917 GGAGCCAAGGGGGACACAGCCGG - Intergenic
1076018772 10:127052921-127052943 GAAAGCAAGGGGGAAAAAGGGGG - Intronic
1077713395 11:4557868-4557890 GAAGCCAAGGGGGTAAAAACAGG + Intergenic
1077881078 11:6350857-6350879 GAAGCCATTGGGCAAAAACTGGG + Intergenic
1078350032 11:10585452-10585474 GAAACCAAGGCTCAAAAAGTAGG + Intronic
1078360567 11:10664567-10664589 GAACTCATGGGGCAGAAAGCAGG - Intronic
1078450411 11:11436691-11436713 GAAGGGCAGGGGCAAAAAGAGGG + Intronic
1078461764 11:11520020-11520042 GCAGCCAGGGTGCAAACAGCTGG + Intronic
1078590921 11:12640444-12640466 CAAGTCAAGAGGCAAAAAGTGGG + Intergenic
1078749040 11:14142692-14142714 CAAGCCAAGGGGCAGAAATGTGG + Intronic
1080236985 11:30081422-30081444 GAAGGAAAAGGGAAAAAAGCGGG - Intergenic
1082078637 11:47994736-47994758 GAAGCCACAGGATAAAAAGCAGG + Intronic
1083379105 11:62250161-62250183 GAAGAAAAGGGGCAAAAAAGTGG + Intergenic
1083660048 11:64247662-64247684 GAAACTAAGGCGCAAAGAGCTGG + Intergenic
1087979213 11:104590396-104590418 GAAGTCAAAGGGCTAAAAACTGG + Intergenic
1088933865 11:114379170-114379192 GAAGCCAAGGAGAAAAAAGGAGG + Intergenic
1090520656 11:127475524-127475546 GAAGAGCGGGGGCAAAAAGCAGG - Intergenic
1090590499 11:128261882-128261904 GAAGCCATGGGACAACAAGGAGG + Intergenic
1090645862 11:128766242-128766264 GAAGCCAAAGGGCCAAACGCTGG + Intronic
1090778250 11:129984067-129984089 GAAGCCTAGGGGGAAAGAGGAGG - Intronic
1091114901 11:133004056-133004078 GAAGCGAAGAGGCAAAGAGCAGG + Intronic
1092069585 12:5621833-5621855 GAAGGGAAGGGGGAAAAAGAAGG + Intronic
1092358136 12:7814015-7814037 GAACCCAAGGGAGGAAAAGCTGG + Intronic
1092371585 12:7921113-7921135 GAACCCAAGGGAGGAAAAGCTGG + Exonic
1092642127 12:10524283-10524305 AAAGTCAAGGGACAAAAAGTTGG + Intergenic
1092777319 12:11955114-11955136 GAAGAGAGGTGGCAAAAAGCAGG + Intergenic
1092894866 12:13001406-13001428 GAAGCCCCGGGGCCGAAAGCCGG + Intergenic
1094091249 12:26652652-26652674 GAAGCCAAGTAGCTAATAGCTGG + Intronic
1095846871 12:46755813-46755835 GAAGCAAAGGAGCCAAGAGCTGG - Intergenic
1096085200 12:48861075-48861097 GCAGCCAATGAGCAAAACGCGGG + Exonic
1096122209 12:49095370-49095392 GAAGAGAAGGGGAAAAAAGTTGG - Intergenic
1098186044 12:67897310-67897332 GATTCCAAGAGGCAAAAAGCAGG + Intergenic
1100023911 12:90104478-90104500 GAAGCCAGTGTGCACAAAGCTGG + Intergenic
1101831300 12:108258933-108258955 GAAGCCAAGGGCCAAAAGTAGGG + Intergenic
1102937331 12:116908816-116908838 GATGCTCTGGGGCAAAAAGCAGG - Intergenic
1103376796 12:120462815-120462837 GATGCCAAGGGGAAAGAAGCCGG + Exonic
1106595101 13:31128940-31128962 GAAGCCAAGGGAGAAAAAGGAGG - Intergenic
1109537879 13:63740748-63740770 GGAGCCTAAGGGCAGAAAGCAGG - Intergenic
1110010536 13:70327411-70327433 TAAGCCAAAGGGAACAAAGCTGG - Intergenic
1110450313 13:75633258-75633280 GCAGCCAAGAGGCAAAGAGATGG + Intronic
1111106132 13:83647950-83647972 GAAGCAAAAGTGCTAAAAGCGGG - Intergenic
1111728410 13:92041866-92041888 GAATCCAGGGGTCAAGAAGCAGG + Intronic
1111940606 13:94602356-94602378 GAAGCCAATGTGCAAAAGACTGG + Intronic
1112661996 13:101520803-101520825 AAAGCCAAGGGGCCTAAAGGAGG + Intronic
1113825724 13:113251690-113251712 GAAGGTAAGGGGAAAAAAGCAGG - Intronic
1113990233 14:16022931-16022953 GCTGCCCAGGGGCAAACAGCCGG - Intergenic
1117420834 14:55543411-55543433 GAAGGCCAAGGGCAAAAAGGTGG + Intergenic
1119559337 14:75578189-75578211 TAAGCCAAGGGGGAGAAAGTTGG + Intergenic
1119897438 14:78232062-78232084 GATGCCAGGGGGCAGGAAGCAGG - Intergenic
1120994763 14:90408770-90408792 GAAGCAAAGGGGGCAGAAGCAGG - Intergenic
1122137314 14:99641871-99641893 GAATCTAAGAGGCATAAAGCAGG - Intergenic
1122738393 14:103856749-103856771 GCAGCCAAGAGGCAGAGAGCTGG - Intergenic
1125437983 15:39668490-39668512 GAAGTCAAGCTGCAAAATGCTGG - Intronic
1125484349 15:40102121-40102143 GATGCCAACCAGCAAAAAGCAGG + Intronic
1126087611 15:45024088-45024110 CAAGCCAGGGAGCAAAAGGCAGG - Intronic
1129051139 15:72783150-72783172 GAAGAGAAGGGGCTAAAAGTTGG + Intronic
1132607444 16:799522-799544 AAAGCAAAGGGGCACACAGCGGG - Intronic
1134235096 16:12459179-12459201 GAACCTAAGGGGGAAAAGGCGGG - Intronic
1134239865 16:12497681-12497703 GAAGCCAATTGAGAAAAAGCAGG - Intronic
1135202583 16:20451391-20451413 CAATCCAAGGGGCATGAAGCAGG - Intergenic
1135216521 16:20576475-20576497 CAATCCAAGGGGCATGAAGCAGG + Intergenic
1136467858 16:30457471-30457493 GCAGCCAAGGGGCAAAAGCCTGG + Intergenic
1137942834 16:52705606-52705628 GAAGCCAAGGGGGTCAAACCTGG + Intergenic
1138184324 16:54964568-54964590 GAACCAAAGAGGCAAAGAGCAGG - Intergenic
1138490231 16:57372325-57372347 GAAGCCCAGGGACACAAAGCCGG + Intergenic
1139524580 16:67506597-67506619 GGAGGAAAGGGGAAAAAAGCGGG + Intergenic
1140689629 16:77469362-77469384 GAAGTAAAGGGGCAAAATGTAGG - Intergenic
1140767359 16:78172883-78172905 AATGCCAAGTGGCCAAAAGCAGG - Intronic
1141912915 16:87072177-87072199 GAAGCCTAAGGGGAAAACGCTGG + Intergenic
1142542508 17:671265-671287 GAAGGGAAGGGACAAAAAGAAGG + Intronic
1142882854 17:2894951-2894973 GAAGCCAAGGGGCCCGAGGCGGG - Intronic
1143590234 17:7881573-7881595 GAAGCAAAGGAAGAAAAAGCTGG + Intronic
1143592617 17:7894652-7894674 GAAACCAAGGGGGAAAGAGATGG - Intronic
1143862857 17:9903806-9903828 GTAGCCTAGGAGCAAAAGGCTGG - Intronic
1145286087 17:21506780-21506802 GAAGGCAAGGGGCGAGCAGCAGG - Intergenic
1145693378 17:26766798-26766820 GCAGCGGGGGGGCAAAAAGCCGG - Intergenic
1147357178 17:39907219-39907241 GAAGCCAAGGCCCAGAAAGGGGG + Intronic
1149056816 17:52376466-52376488 GAAGTCATTGGGCAAAAAGGGGG - Intergenic
1149808813 17:59646279-59646301 GAAGCCAAGGGGTTCAAAACTGG - Intronic
1150154510 17:62840923-62840945 AAAGCTAAGGGGCAAAACCCGGG + Intergenic
1153101354 18:1473636-1473658 GAATCCAACGTGCAAAAATCAGG + Intergenic
1157124161 18:44938924-44938946 AAAGCCAAGCAGCAGAAAGCAGG - Intronic
1157207770 18:45715185-45715207 GAATCCAAGGTGGAAAAACCAGG + Intergenic
1158744341 18:60181174-60181196 TATGCTAAGGGGAAAAAAGCTGG - Intergenic
1158892782 18:61888785-61888807 GAAGCCATGGGAAAAGAAGCAGG + Intronic
1158947339 18:62458470-62458492 GAAGCTTAGGGGGAAAAAGAAGG - Intergenic
1159576857 18:70189623-70189645 GAAGTCAAACGGCTAAAAGCAGG - Intronic
1160054229 18:75464415-75464437 GAAGCCAAGGGGCATGAAAGTGG - Intergenic
1160154409 18:76422661-76422683 CCAGCCAAGGGGCAAGAAGCAGG + Intronic
1160707762 19:537335-537357 GAGGAAAAGGGGCAAGAAGCTGG - Intronic
1160872449 19:1283436-1283458 GGAGCCAAGGGTCAGAAATCAGG - Intergenic
1161121584 19:2529882-2529904 GAAGCCAAGACCCAAAAACCAGG - Intronic
1161849657 19:6731814-6731836 GCATCCAAGGGGCAGAAAGAAGG + Intronic
1165046476 19:33108674-33108696 GAAGCCCAGGAGCAATACGCTGG - Intronic
1165449734 19:35875072-35875094 GAATCCAAGGGCCAAGAAGCAGG - Intronic
1166933907 19:46319742-46319764 GAGGCCCAGGGGCAAAGAGCGGG - Intronic
1168520111 19:57043495-57043517 GAAGGCAAGGGGAGAAAGGCAGG - Intergenic
1202683431 1_KI270712v1_random:29859-29881 GGCGGCAGGGGGCAAAAAGCCGG - Intergenic
925929019 2:8692981-8693003 CAGGCCAAGGGGTAAAAAGCAGG + Intergenic
925959625 2:9003381-9003403 GAAGGGAGGGGGCAACAAGCCGG - Intronic
926522896 2:13939134-13939156 GAAGAAAAAGGGAAAAAAGCAGG - Intergenic
928690012 2:33789556-33789578 AAAGCAAAGGGGAAAAAAGGAGG - Intergenic
931017877 2:58006639-58006661 GATGCCAAGGGCCAAGAGGCAGG + Intronic
933236731 2:79872617-79872639 TAAGCAAAGGGGGAAAAAGATGG + Intronic
933259368 2:80114827-80114849 GAAACCATGGAGCAAAAATCAGG - Intronic
933775389 2:85768426-85768448 GAAGCCTGGGAGCAAAAATCTGG + Intronic
934261214 2:91478189-91478211 GACGTCGGGGGGCAAAAAGCCGG - Intergenic
934261239 2:91478275-91478297 GGAGGCGGGGGGCAAAAAGCCGG - Intergenic
934304474 2:91809958-91809980 GCGGTCAGGGGGCAAAAAGCCGG - Intergenic
934328783 2:92042792-92042814 GCGGTCAGGGGGCAAAAAGCCGG + Intergenic
934976372 2:98805667-98805689 GCAGCCTAGGGGCAAACAGAAGG + Intronic
935896250 2:107740796-107740818 GAAGCCAAGTAACACAAAGCAGG + Intergenic
936572158 2:113626316-113626338 TAAGCTAAAGGGAAAAAAGCTGG + Intergenic
937040344 2:118815912-118815934 GAAGCCAGGAGACAAAGAGCTGG - Intergenic
938702441 2:133891630-133891652 GCAGTCAAGGGGCAGAGAGCTGG - Intergenic
938767560 2:134470463-134470485 GAAGCCAAGATGCAAAATGCAGG + Intronic
940174413 2:150862969-150862991 GAGGCAGAAGGGCAAAAAGCAGG + Intergenic
940335843 2:152526392-152526414 GAAGTCTAGGAGCAAAAAGGAGG - Intronic
941829417 2:169938105-169938127 GAAGGCAAGGGGCTAAAATAAGG - Intronic
941872104 2:170396691-170396713 GAAGCAACGGGGCAAGATGCTGG + Intronic
942455231 2:176133602-176133624 GATGCCAAGGGCCAAGAGGCTGG + Intergenic
943330472 2:186552652-186552674 AGTGCCAAGGGGCAAAAACCAGG - Intergenic
946148882 2:217750881-217750903 GAAGAAAAGGGGCAAAAAAATGG + Intronic
947011099 2:225567823-225567845 GAAGCCAAGGGGAAAAAGGATGG + Intronic
947162317 2:227226892-227226914 CAAGCCAAGAGGCAAAATGAAGG + Intronic
1170656732 20:18293741-18293763 GAATGAAAGGGGGAAAAAGCTGG + Intronic
1171305352 20:24100972-24100994 GAAGACAAGGCCCAGAAAGCAGG + Intergenic
1174672192 20:52318703-52318725 GAAGCCAAGGGCCAGCAAGGAGG + Intergenic
1176008859 20:62881094-62881116 GAAGCCCAGGGGGAAGAGGCTGG + Exonic
1179865387 21:44213591-44213613 GAAGCCAGGGAGGAAAACGCGGG - Intergenic
1180317039 22:11284595-11284617 GCTGCCCAGGGGCAAACAGCTGG + Intergenic
1181767987 22:25105633-25105655 GAAGCCAGGAGGGAACAAGCAGG + Intronic
1183481604 22:38068471-38068493 GAGGCCAAGGGGCTAAGGGCAGG + Intronic
1183586108 22:38754109-38754131 GAAGCCAAAGTGCAAAGATCTGG + Intronic
1184485616 22:44777001-44777023 GGAGCCTGAGGGCAAAAAGCCGG - Intronic
1185428034 22:50784564-50784586 TAAGCTAAAGGGAAAAAAGCTGG - Intergenic
949898656 3:8791933-8791955 GAAGCCAAGGGGCAGAGTGAGGG - Intronic
951403463 3:22264101-22264123 GACTCCAAGGGGCATAAGGCTGG + Intronic
951737841 3:25887471-25887493 GAAGCCAACTGGAAAAAAGAAGG - Intergenic
955803067 3:62706001-62706023 GAAGCCAGGAGCCACAAAGCAGG - Intronic
956597160 3:70980179-70980201 GAAGCCAAGGGGGGAAGAGTTGG + Intronic
958093708 3:88912408-88912430 GAAGCCAAGGGGACAATAGCTGG + Intergenic
958536974 3:95416542-95416564 GATGCCAAGAGGGAAAAAGATGG + Intergenic
960988540 3:123295878-123295900 GGAGCCAAGAGGCAAAACCCTGG - Intronic
961376023 3:126466417-126466439 GTAGCCAGGGTGCAAAATGCAGG - Intronic
961809778 3:129515085-129515107 GAACCCAAGGTGCAGAAAGATGG - Intronic
962845830 3:139273182-139273204 GTAGCCGAGGAGCAAACAGCAGG + Intronic
963308687 3:143683528-143683550 AAAGGCAAAGGGCAAAAATCGGG + Intronic
963338640 3:144006918-144006940 GAAGCAAAGGAGCTAAAAGGTGG - Intronic
963707043 3:148699805-148699827 GAAGTCAGGGGGAAAAAAGGTGG - Intronic
963892762 3:150654196-150654218 TAAGCAAAGGGGCAACACGCTGG - Intergenic
964191004 3:154001023-154001045 GAAGGCAAGAGGCAGAAAGGTGG - Intergenic
964623062 3:158734342-158734364 GAAGCCAAGGGGGAGAGTGCAGG + Intronic
964855165 3:161138595-161138617 GAGGCCAAAGGGGAGAAAGCAGG + Intronic
967304748 3:188049625-188049647 GAAGCCATGGAGGGAAAAGCTGG + Intergenic
967878045 3:194280092-194280114 GAAGTCAAGGGGGCAAGAGCAGG + Intergenic
968892093 4:3374835-3374857 AAAGCCATGGGGCAAAGAGCAGG - Intronic
969826562 4:9762708-9762730 GGAGCCTAAGGGCAGAAAGCAGG + Intergenic
970554773 4:17220208-17220230 GAAGCCAAGGAGGAAGAAGATGG + Intergenic
970821643 4:20222945-20222967 TAAGCTAAGAGGTAAAAAGCAGG - Intergenic
973912111 4:55592022-55592044 GAAGCCAAGGGACACAAATGGGG - Intronic
974296042 4:59999925-59999947 GAAGTCAAGGGGCATAGTGCAGG - Intergenic
975164210 4:71159464-71159486 GAAGCTAAGGTGCAAGAACCAGG - Intergenic
975526823 4:75360296-75360318 GATACCAAGGGCCAAAAAGAAGG + Intergenic
975739459 4:77414904-77414926 GAAGCCAAGGGCCAAGAGGCAGG + Intronic
976542350 4:86293472-86293494 AAAGCCAAGGGGGTATAAGCAGG - Intronic
976927886 4:90524346-90524368 TAAGCCAAGGGGCAAACAGCTGG + Intronic
977928242 4:102725440-102725462 GGAGCTAAGGAGGAAAAAGCTGG + Intronic
979354482 4:119686856-119686878 TAATCCAAGGGGCAAAAAATAGG - Intergenic
980804203 4:137790732-137790754 GAATCCAAGAGGAAAAAAACAGG + Intergenic
984179030 4:176457943-176457965 GAAGCCAGAGAACAAAAAGCAGG + Intergenic
988444689 5:31272198-31272220 GAAGCCAAAGGTCCGAAAGCTGG + Intronic
988994105 5:36697904-36697926 GAGGCCAAGGGGAACAAAGAGGG - Intergenic
990712334 5:58599085-58599107 GTAGCAAAGGAGCAAATAGCAGG + Intronic
991134850 5:63169447-63169469 GAAGCAAATGTGAAAAAAGCAGG - Intergenic
991295840 5:65079738-65079760 GAAAACAAGGGGGAAAAAGCAGG - Intergenic
994468578 5:100171544-100171566 GAACCGAAGGAGCAAAAGGCTGG + Intergenic
997515630 5:134487316-134487338 GAAGGGAAGGGAGAAAAAGCAGG + Intergenic
998006941 5:138663319-138663341 GAAGCCCTGGGGCAAAGAGCAGG - Intronic
999059518 5:148618418-148618440 GAAGCCAGAGGGAAAGAAGCTGG - Intronic
999326274 5:150645711-150645733 AAAGCCAAGGGTGACAAAGCTGG - Intronic
1001259815 5:170218839-170218861 GGAGACAAGGGGAAAAGAGCAGG + Intergenic
1001285742 5:170422476-170422498 TGAGCCCAGGGGCAAGAAGCCGG + Intronic
1001801603 5:174549089-174549111 TAAGCCACTGGGCAAAAATCAGG - Intergenic
1001863821 5:175085152-175085174 ATAGCCAAAGGGAAAAAAGCAGG - Intergenic
1001903044 5:175446532-175446554 TAAGCCAAGGTGCCAAAGGCCGG - Intergenic
1001934739 5:175696005-175696027 AATGCCCAGGGGCAAACAGCAGG + Intergenic
1002760155 6:195638-195660 AATGCTAAGTGGCAAAAAGCTGG - Intergenic
1006944812 6:37778194-37778216 GAAGCCAGGAGGCAAAGAGGAGG - Intergenic
1007367000 6:41401429-41401451 GAAGCCATGGTGCATTAAGCTGG + Intergenic
1007903639 6:45436558-45436580 ATAGCCAAGGGGAAAAAAACAGG - Intronic
1015198249 6:130548133-130548155 AAAGCCAAGAGGCAATAAGGAGG - Intergenic
1015442842 6:133268838-133268860 TGAGCTAAGAGGCAAAAAGCTGG + Intronic
1016566354 6:145459170-145459192 GTAGCCAATGGGCAAAGAGAGGG + Intergenic
1017900466 6:158715060-158715082 CAGGCCAAGGGGCACAGAGCAGG - Intronic
1019076591 6:169393256-169393278 GAAGCCAAGGGGCACAGCACAGG - Intergenic
1019549231 7:1593960-1593982 GAAGAAAAGGGGCAGGAAGCAGG - Intergenic
1019724968 7:2596854-2596876 GAAGCCAAGGGCCGGAATGCTGG + Intronic
1021291208 7:18847662-18847684 GAAGCCAAGAAGCAAAAACGAGG + Intronic
1022482412 7:30752650-30752672 GAAGGCCAAGGGCAAACAGCAGG + Intronic
1022506955 7:30913429-30913451 GAAGCCAAGGAGCAGAGAGGAGG + Intronic
1022522254 7:31016002-31016024 GACCTCATGGGGCAAAAAGCAGG - Intergenic
1022675398 7:32495192-32495214 GAATCCAGGGAGGAAAAAGCAGG + Intronic
1024352383 7:48380058-48380080 GAAGCCAAGGGGTGAATATCTGG + Intronic
1024692558 7:51818868-51818890 GGAGCAAAGGGGAAAGAAGCAGG + Intergenic
1025120473 7:56297460-56297482 GAAGGAATGGGGCAAAAAGGTGG - Intergenic
1025607439 7:63049408-63049430 TAAGTCAAGGGGAAAAAAACAGG + Intergenic
1026347101 7:69483586-69483608 GAAGCCCAGGAGAAAAAAGATGG + Intergenic
1026768012 7:73172628-73172650 GAGGCCCAGGGGCCAAATGCAGG - Intergenic
1027044478 7:74982338-74982360 GAGGCCCAGGGGCCAAATGCAGG - Intronic
1027079161 7:75220022-75220044 GAGGCCCAGGGGCCAAATGCAGG + Intergenic
1028115419 7:86991722-86991744 GAAGCCAAGAGAGATAAAGCAGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028385785 7:90251403-90251425 GAAGCAGAGGGACAAAAACCGGG + Intronic
1029388393 7:100258601-100258623 GAGGCCCAGGGGCCAAATGCAGG + Intronic
1029899559 7:104024410-104024432 GAATCCATTGGGGAAAAAGCTGG + Intergenic
1033014848 7:137661565-137661587 GAAACCATGGGGGAGAAAGCTGG - Intronic
1033021414 7:137728700-137728722 GAAACCATGGGGGGAAAAGCTGG - Intronic
1034477050 7:151291280-151291302 GAGACCAAGGGGCAAGGAGCAGG + Intergenic
1036599945 8:10251592-10251614 CAAACCAAGAGGCAGAAAGCAGG + Intronic
1037502150 8:19496644-19496666 GAAGTCACGGAGCAAACAGCTGG + Intronic
1037883233 8:22582970-22582992 GAAGCCCTGGGGCAGGAAGCAGG + Intronic
1038447777 8:27615709-27615731 GAAGTCAAGGGGCTGACAGCTGG + Intergenic
1038543800 8:28410737-28410759 GAAGCCAAGGGTCAGAAGCCTGG + Intronic
1039543011 8:38386830-38386852 GAAGCCGAGGAGAAAGAAGCAGG - Intronic
1040908414 8:52492458-52492480 GAAGCCAAAGGGTAAAAATATGG + Intergenic
1041522081 8:58767996-58768018 GAAACAAAAGGGCAAAGAGCTGG - Intergenic
1042081071 8:65051403-65051425 GAAGACAAGTAGCAACAAGCTGG - Intergenic
1043275534 8:78387713-78387735 GAAGACAAAGGGAAAAAAACAGG - Intergenic
1043312647 8:78880305-78880327 GTAGCCTAGGGGCAATAGGCTGG - Intergenic
1043734842 8:83730007-83730029 GAAGCCTAGGGGCACAGCGCAGG - Intergenic
1044424361 8:92034024-92034046 GGAGTGAAGGGGTAAAAAGCAGG + Intronic
1044594018 8:93941107-93941129 GAAGTCAAGGGGCACAGCGCAGG - Intergenic
1045494345 8:102695856-102695878 CATGCCAACGGGAAAAAAGCAGG - Intergenic
1047958893 8:129996511-129996533 GAAGCCAAGTGGGAAAGGGCAGG + Intronic
1048669042 8:136695848-136695870 GAGGCCAAGGAGGAAAAAGTGGG + Intergenic
1048852227 8:138656199-138656221 GAAGAGAAGGGGCAAACAGAAGG - Intronic
1051074170 9:13210469-13210491 GAAGTCAAGGGGGAAATACCTGG - Intronic
1052654282 9:31335239-31335261 GTTGCCAAGGGGCAAACTGCAGG + Intergenic
1053342407 9:37348766-37348788 GAAGACAAGGTGGAAAAAGCAGG - Intronic
1055905111 9:81284666-81284688 AAAGCCAAAGGGAAAAAAGAAGG - Intergenic
1057825507 9:98369655-98369677 GTAGCCAGGGAGCAAAATGCAGG + Intronic
1058153327 9:101486139-101486161 GGAGCCAAGGGCCAGAAAGAGGG + Intronic
1060032766 9:120229617-120229639 GAATCCAAGAAGAAAAAAGCAGG + Intergenic
1061489317 9:130936500-130936522 AATGCCAAGGGGCAGACAGCTGG + Intronic
1062365000 9:136204267-136204289 AAAGTGAAGGGGCAGAAAGCTGG - Intronic
1186286250 X:8046805-8046827 GATGCCAAGGGGAAATCAGCTGG - Intergenic
1186720259 X:12296576-12296598 GAAGCCAAGGCTCAGCAAGCTGG - Intronic
1187048879 X:15676120-15676142 GAAACCAAGGAGCAGCAAGCTGG + Intergenic
1189368436 X:40408254-40408276 GAAGCCAGAGTGGAAAAAGCAGG + Intergenic
1192129757 X:68538286-68538308 AAAGATAAGAGGCAAAAAGCAGG + Intergenic
1193259293 X:79386589-79386611 GAAGTCAAGGAGAAACAAGCTGG - Intergenic
1197096213 X:122598903-122598925 GAAGTCAAGGGGTAAAAGGAAGG + Intergenic
1197292035 X:124670373-124670395 GAAGGTAAGGGAGAAAAAGCAGG + Intronic
1197501004 X:127242595-127242617 GAAACCAAGGAGTAAAAATCAGG + Intergenic
1199034645 X:143035249-143035271 GAAGACAAGGGGAATAAAACTGG - Intergenic
1199322231 X:146454037-146454059 GAAGGCAGAGGGCAAATAGCCGG - Intergenic
1201763593 Y:17561555-17561577 GCAGCCCCGGGGAAAAAAGCGGG - Intergenic
1201837960 Y:18344435-18344457 GCAGCCCCGGGGAAAAAAGCGGG + Intergenic