ID: 920298795

View in Genome Browser
Species Human (GRCh38)
Location 1:204975961-204975983
Sequence TGCACACTGGAACCCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920298795_920298803 17 Left 920298795 1:204975961-204975983 CCCCCTGGGGGTTCCAGTGTGCA 0: 1
1: 0
2: 2
3: 19
4: 228
Right 920298803 1:204976001-204976023 TGTTCCGAGCCTCCCTCCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 205
920298795_920298804 18 Left 920298795 1:204975961-204975983 CCCCCTGGGGGTTCCAGTGTGCA 0: 1
1: 0
2: 2
3: 19
4: 228
Right 920298804 1:204976002-204976024 GTTCCGAGCCTCCCTCCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920298795 Original CRISPR TGCACACTGGAACCCCCAGG GGG (reversed) Intronic
900098941 1:952797-952819 TGCACACTGGGCCCCTCTGGGGG + Intronic
900352057 1:2239810-2239832 GGCACACTGGGACGCCCCGGAGG - Intronic
901456836 1:9367930-9367952 ACCACCCTGGGACCCCCAGGTGG - Exonic
902759627 1:18572731-18572753 TGCAAACTGGTCCCTCCAGGTGG + Intergenic
902927855 1:19708876-19708898 TGCACACATGAACCCCCACCAGG - Intronic
904985997 1:34549391-34549413 TGGACACTTGAACCGGCAGGGGG + Intergenic
906370501 1:45249079-45249101 AGCACACTGGAAAGCCAAGGTGG - Intronic
907259653 1:53207893-53207915 TGCACAGCAGAACCCCCAGAGGG - Intronic
907289173 1:53401993-53402015 TGGACACAGGCACGCCCAGGGGG + Intergenic
908521350 1:64945982-64946004 AGCACACTGGAAGGCCGAGGTGG - Intronic
909977837 1:82066031-82066053 TGCAGACTGACACCTCCAGGAGG + Intergenic
911445078 1:97982429-97982451 TGCACACTGGAATCACTGGGAGG + Intergenic
914850701 1:151311834-151311856 GTCACACTGGAAGCCCCAGTAGG - Intronic
915376572 1:155401532-155401554 AGCACACTGGAAGGCCAAGGTGG + Intronic
915470277 1:156121773-156121795 AGTACACTGGGACCCCAAGGAGG - Intronic
917515996 1:175708963-175708985 TGCACACAAGCACCCCCACGTGG + Intronic
919685983 1:200484003-200484025 TGCAGCCTGGAGCCTCCAGGTGG - Intergenic
919718257 1:200803074-200803096 TGTACATTGCAACCACCAGGTGG - Intronic
920298795 1:204975961-204975983 TGCACACTGGAACCCCCAGGGGG - Intronic
920449603 1:206049518-206049540 AGATCTCTGGAACCCCCAGGGGG + Intronic
920763557 1:208809462-208809484 TGCACAGTGGAATCACCTGGAGG - Intergenic
920928829 1:210367921-210367943 AGCACACTGGAGCCTGCAGGGGG - Intronic
922898494 1:229118832-229118854 TGCACAGTGCAGCCCACAGGTGG + Intergenic
922934133 1:229410770-229410792 TGCAGAATGGTAGCCCCAGGCGG + Intergenic
923099450 1:230800785-230800807 TGCACACTGGACTCACCAAGGGG - Intronic
924787512 1:247211765-247211787 AGAACAATGGAGCCCCCAGGAGG + Intergenic
1069686663 10:70323316-70323338 TGCAAACAGCAAACCCCAGGAGG - Intronic
1070585025 10:77757983-77758005 AGCACTCTGGGAGCCCCAGGTGG + Intergenic
1072537782 10:96376443-96376465 GGCACAGTGGGACCCGCAGGAGG - Intronic
1073815345 10:107200342-107200364 TGCAGACTTGAGCCCCCATGCGG + Intergenic
1074561426 10:114538836-114538858 TGCACACAGGTAGCCCCTGGGGG + Intronic
1074954751 10:118377605-118377627 TGCACTCTGGGGCACCCAGGTGG + Intergenic
1075976561 10:126701254-126701276 TGGCCACTGGAACACCCAGTAGG - Intergenic
1077581223 11:3418552-3418574 TTCACACTGGCACCCCTGGGAGG - Intergenic
1077992025 11:7420611-7420633 TGCACACTGGCATTCCCTGGTGG + Exonic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1078900851 11:15641318-15641340 TGCCCACTGGAGCAGCCAGGGGG - Intergenic
1080748870 11:35134418-35134440 TGCACCCTGGAAGTCCCAAGGGG - Intergenic
1083626802 11:64076064-64076086 TGCAGGCTGGATCCACCAGGAGG - Intronic
1083967602 11:66052154-66052176 TGCGCACTACAACTCCCAGGAGG + Intronic
1084421227 11:69061655-69061677 TGCTCATGGGGACCCCCAGGTGG + Intronic
1084700740 11:70784901-70784923 TGGACACAGGAAGCCACAGGTGG + Intronic
1087531515 11:99387973-99387995 TGCACACTGGAATCAACTGGAGG - Intronic
1089018801 11:115189797-115189819 TACAGACTGGAAGCTCCAGGAGG - Intronic
1090715953 11:129431106-129431128 TGCACACTGGGAGGCCGAGGTGG - Intronic
1091011683 11:132007059-132007081 TTCACTCAGGAACCCCCAGTGGG - Intronic
1091768439 12:3136902-3136924 TGCACTGTGGAGCCGCCAGGTGG + Intronic
1093736477 12:22625553-22625575 GCCTCACTGGGACCCCCAGGAGG + Exonic
1094021104 12:25915368-25915390 GGCTCACTTAAACCCCCAGGAGG - Intergenic
1095600716 12:44010095-44010117 TGCATACTTGAACCCCCAGATGG - Intronic
1097230060 12:57505407-57505429 TGCACACTGGGAGGCCGAGGTGG - Intronic
1097780454 12:63697294-63697316 TGCTCATTGGAATCACCAGGGGG - Intergenic
1097986076 12:65784640-65784662 TGCAGACTGGAATGCCCATGGGG + Intergenic
1100294229 12:93245816-93245838 TGCTCTCTGTAAGCCCCAGGAGG - Intergenic
1101831816 12:108263779-108263801 TCCCCACTGTAACCCCAAGGTGG + Intergenic
1102028221 12:109725510-109725532 TGGACACTGGAACCCCCGCTCGG - Intronic
1102601761 12:114036812-114036834 TGCACTCTGGATCCCCCAGGTGG - Intergenic
1102985955 12:117278443-117278465 TGCCCACTGGAATTCCCAGAGGG + Intronic
1103094375 12:118121030-118121052 TACAAACTGGAATCACCAGGTGG + Intronic
1104811262 12:131621575-131621597 TGCAGGCTGGAACCCCCTGGGGG - Intergenic
1104977264 12:132557762-132557784 TGCTGACTGGAGACCCCAGGGGG - Intronic
1104995041 12:132649107-132649129 GACACACTGGAACCCACAGACGG + Intronic
1105007166 12:132728797-132728819 TGCATACTTGCACCCCCAGAGGG + Intronic
1107601636 13:42020271-42020293 TCCTAACTGTAACCCCCAGGAGG + Intergenic
1109696933 13:65972799-65972821 GGCACACTGGAACCCCTGGTTGG + Intergenic
1113735041 13:112672485-112672507 TGCACAGTGGCACCTCCAGGAGG + Intronic
1114632573 14:24168828-24168850 TGCACTTTGGAAGGCCCAGGTGG + Intergenic
1118405833 14:65422753-65422775 AGCACTCTGGAAGGCCCAGGTGG - Intronic
1119778230 14:77261175-77261197 TGCACACTGGAATCACCTGGGGG - Intergenic
1121008107 14:90503300-90503322 GGCAGTCTGGAACTCCCAGGTGG + Intergenic
1121714702 14:96065293-96065315 TGCACATCGGAATCTCCAGGAGG - Intronic
1122679456 14:103446787-103446809 AGCTCACTGCAACCTCCAGGAGG + Intronic
1122894010 14:104746417-104746439 TGCACCCTGGATGCCCCAAGGGG + Intronic
1124655712 15:31504782-31504804 TGCATTCTGGAAGTCCCAGGTGG - Intronic
1125398277 15:39273077-39273099 TGCACACTGGAAATGCCATGGGG - Intergenic
1125640790 15:41229401-41229423 GGCTCACTGCAACCTCCAGGCGG - Intronic
1127791369 15:62401536-62401558 TGCACATTGGAATCACCTGGAGG + Intronic
1129152855 15:73699842-73699864 TGCCTACTGGATCCCACAGGTGG - Intronic
1130517724 15:84639060-84639082 TGCACACTGGGGCCCCGTGGTGG - Intergenic
1131250485 15:90827102-90827124 TGGACCCAGGAACCCCCAGGAGG - Intergenic
1131467966 15:92670634-92670656 TGCACATTAGAATCCCCTGGAGG + Intronic
1133303627 16:4797289-4797311 TGGACACTGGAAGTGCCAGGAGG - Exonic
1133965019 16:10524754-10524776 TGCACTCTGGGAGGCCCAGGTGG - Intergenic
1134481522 16:14623587-14623609 AGCACACTGGAAGGCCAAGGCGG + Intronic
1135389137 16:22074320-22074342 AGCACACTGGAAGGCCAAGGCGG + Intronic
1139511342 16:67430232-67430254 TGCTCCCCTGAACCCCCAGGGGG - Intergenic
1140400165 16:74665197-74665219 TGGACACTGAAATGCCCAGGCGG + Intronic
1141685096 16:85565656-85565678 TGGGCACTGGCATCCCCAGGAGG - Intergenic
1141988906 16:87598850-87598872 TGAACTCTGGGACTCCCAGGAGG + Intergenic
1141989248 16:87601291-87601313 TGAACTCTGGGACTCCCAGGAGG + Intergenic
1142131031 16:88431556-88431578 TGGCAACTGGAACCCCCAAGGGG - Exonic
1143265147 17:5631000-5631022 TCCACACTGGAGGCCCCATGGGG - Intergenic
1143893717 17:10120941-10120963 GGCCCACTGGAACCCCAAGGTGG + Intronic
1144930544 17:18855631-18855653 TGTACACTGTAAGCCCCATGAGG - Intronic
1146395550 17:32462504-32462526 TCCTCACTGGAGCCCCCTGGTGG - Intronic
1146434001 17:32825788-32825810 AGCACTCTGGAAGACCCAGGCGG + Intronic
1146917093 17:36684946-36684968 TGCCCACTGAAGACCCCAGGAGG - Intergenic
1147029637 17:37622010-37622032 TGTACACTGAACCCCACAGGTGG + Intronic
1147316318 17:39622079-39622101 TGCCCTCTGGCGCCCCCAGGTGG - Intergenic
1147854188 17:43466309-43466331 TGCACACTGGGACATCCAGCAGG - Intergenic
1151347546 17:73511456-73511478 TGCAGGCTGGCACCCCCGGGAGG - Intronic
1151598453 17:75091807-75091829 TGCAGCCTAGAGCCCCCAGGCGG + Intronic
1152336475 17:79702165-79702187 TGGACACTGGGGCCCCCTGGGGG + Intergenic
1152624905 17:81383723-81383745 TGCAAGCTGGAAACCCCATGGGG - Intergenic
1152783935 17:82238399-82238421 TGCCGACTGGAAGCCTCAGGGGG + Intronic
1156826485 18:41435638-41435660 TGTACACTGAAGCCCCCAGGAGG + Intergenic
1157098410 18:44708185-44708207 AGGACACTTGAACCACCAGGAGG - Intronic
1157581644 18:48777247-48777269 TGCACACTGGTGCCCCCTGCAGG - Intronic
1160705170 19:526175-526197 TTCTCCCTGGAGCCCCCAGGAGG - Intergenic
1160731714 19:644256-644278 TCCGCACTGGAGCCCCCGGGAGG + Intergenic
1161455022 19:4365752-4365774 AGCACAGTGGAATCCCCAGAGGG + Intronic
1161767797 19:6216639-6216661 TGGGCACAGGGACCCCCAGGTGG - Intronic
1162068247 19:8138405-8138427 TACTCACTGGAGCCCCGAGGAGG + Exonic
1163754375 19:19097713-19097735 TGCACTCTGGGAGGCCCAGGTGG + Intronic
1164779000 19:30877692-30877714 TGCACACAGCAATGCCCAGGAGG - Intergenic
1165094443 19:33402689-33402711 TGCACCCTGGCACCCTCCGGTGG + Intronic
1165266488 19:34666447-34666469 TGTGCACTGGGACCCGCAGGTGG - Intronic
1168608097 19:57775913-57775935 TGCATAGTGCAACCCCCATGTGG + Intronic
1168609736 19:57789642-57789664 TGCATAGTGCAACCCCCATGTGG + Intronic
1168620834 19:57878238-57878260 TCCACAATGCAACCCCCATGTGG - Intronic
1168627686 19:57932032-57932054 TCCACAGTGCAACCCCCATGTGG - Intronic
925153792 2:1635128-1635150 TGCACACAAGCAGCCCCAGGTGG + Intronic
925890553 2:8430821-8430843 TGCTCACTGGGACCCCCTGGAGG - Intergenic
926741316 2:16113928-16113950 AGCACACAGGGACCCTCAGGAGG + Intergenic
927099130 2:19774535-19774557 AGCACGCTGTAATCCCCAGGAGG + Intergenic
927545673 2:23950649-23950671 AGCACACTGGAAGACCGAGGTGG - Intronic
928441175 2:31293467-31293489 GGCACACTGTAACCACCTGGTGG + Intergenic
929026674 2:37611479-37611501 TGCACACTGGAATCACATGGGGG - Intergenic
929539251 2:42807777-42807799 AGCTCACTGCAACCCACAGGAGG + Intergenic
931756430 2:65378755-65378777 TGCACACTGGAATCACCTGGAGG + Intronic
932272336 2:70421549-70421571 TGAACATTGGAACCACCTGGAGG + Intergenic
932574070 2:72953209-72953231 TGCCCACAGGACCCCCCAGGAGG - Intronic
935056652 2:99573461-99573483 TGCCCACTGCAAGCCCCTGGTGG + Intronic
935191183 2:100780007-100780029 AGCACACTGGAAGGTCCAGGTGG + Intergenic
935209845 2:100929770-100929792 TGCACACCGGAATCACCTGGGGG - Intronic
935688858 2:105712305-105712327 TGGCCACTGGAACCCCCAGGGGG - Intergenic
935709866 2:105888808-105888830 TGCTCACATGAACCCCTAGGGGG - Intronic
936573427 2:113634782-113634804 AACACACTGGAAGCCCAAGGAGG - Intronic
937181577 2:120000952-120000974 TGCACTTTGGAACACCGAGGTGG - Intergenic
937867909 2:126767741-126767763 AACACTCTGGAGCCCCCAGGAGG - Intergenic
942719430 2:178934113-178934135 TGCACACTGGAGTCACCTGGGGG - Intronic
944586953 2:201181027-201181049 TGCAAATTGGAAACCACAGGGGG + Intergenic
945994993 2:216429173-216429195 TGCAAGCTGGAAGCCCCTGGCGG - Intronic
948406430 2:237723749-237723771 TGCACCCTGGAGGCCCCAGGAGG - Intronic
1172134217 20:32676163-32676185 TGCTCCCTGGAATTCCCAGGTGG - Intergenic
1174111642 20:48201635-48201657 AGCACAGTGCAGCCCCCAGGAGG - Intergenic
1174969452 20:55257569-55257591 TGCACACTGGAACCCACTCATGG - Intergenic
1175991128 20:62789832-62789854 AGCACTCTGGAAGCCCGAGGTGG - Intergenic
1176411367 21:6451106-6451128 TGCTGGCTGGAAGCCCCAGGGGG + Intergenic
1179603817 21:42499228-42499250 TGCACCCAGGAAGCCCCAGGAGG + Intronic
1179686860 21:43059428-43059450 TGCTGGCTGGAAGCCCCAGGGGG + Intronic
1182047725 22:27288818-27288840 TGCACATTGGAACCTTCTGGGGG + Intergenic
1182519644 22:30878086-30878108 TGCGCACTGGGAGCCACAGGAGG + Intronic
1183598926 22:38828807-38828829 TGCACCCTGAAACCACCTGGGGG - Intronic
1184430422 22:44438908-44438930 TGGACACTCGAACTCCCAAGAGG + Intergenic
1185205135 22:49533498-49533520 GACACCCTGGAACACCCAGGAGG + Intronic
1185426755 22:50776098-50776120 AACACACTGGAAGCCCAAGGAGG + Intronic
950265504 3:11570077-11570099 TGCACATCAGAAACCCCAGGGGG - Intronic
950486874 3:13279049-13279071 GGCACACAGGAAGCCCCCGGTGG + Intergenic
953137146 3:40190796-40190818 TGCACAGTAGAATCACCAGGAGG - Intronic
953820642 3:46204902-46204924 TGCACTGTGGAGCCCACAGGAGG + Intronic
954083431 3:48225669-48225691 TTCTCAGTGGAACCCCCAGTGGG + Intergenic
954433106 3:50481746-50481768 AGCACTTTGGAAGCCCCAGGCGG + Intronic
954682187 3:52351725-52351747 TGCAGACTGCAGCTCCCAGGGGG + Intronic
954712867 3:52513611-52513633 GGCACACAGGCACCCACAGGTGG - Intronic
955446069 3:59011148-59011170 AGCACTCTGGAAGCCCAAGGCGG + Intronic
956111987 3:65878992-65879014 TGATCACTGCAACCCCCAGCAGG - Intronic
960953463 3:123014520-123014542 TGCACAGTTGTACCCCAAGGGGG + Intronic
961107209 3:124252175-124252197 TGCACATTAGAATCACCAGGGGG + Intronic
962423712 3:135250466-135250488 TGCACACTGGAATCACCTGAGGG + Intronic
962753222 3:138449923-138449945 TACACACTGGAAGCTCTAGGAGG - Intronic
963844553 3:150141813-150141835 AGCACACTGGAATCACCTGGGGG + Intergenic
964749040 3:160038006-160038028 TCCACCCTGGAGCCCACAGGTGG + Intergenic
965585515 3:170314386-170314408 TGCACACTGGAACCCTCTTAAGG + Intergenic
965849740 3:173009685-173009707 TGCACACTGGAGGCCCAAGCCGG - Intronic
967479158 3:189954551-189954573 CACACACTGGGAACCCCAGGAGG - Intergenic
968549178 4:1213672-1213694 TGGGCACTGGAACCCCCTGTGGG + Intronic
969542834 4:7804195-7804217 TGCACTCTGGCACCACCTGGTGG - Intronic
969673066 4:8600418-8600440 TCCACACTCGCACCCCCAGATGG - Intronic
969714876 4:8863586-8863608 TGCACTCCCGAACCCCCATGGGG - Intronic
971344361 4:25798459-25798481 TGCACACTGGAATCACCTGGGGG - Intronic
972413767 4:38818890-38818912 TACACTCCTGAACCCCCAGGGGG - Intronic
972652822 4:41035909-41035931 TGCACACTGGGAGACACAGGTGG + Intronic
975048988 4:69835889-69835911 AGCACACTGGGACGCCAAGGAGG - Intronic
977638990 4:99333659-99333681 TGGACACTGGAGCCTCCATGAGG + Intergenic
984378858 4:178965062-178965084 AGCACACTGGGAGGCCCAGGTGG - Intergenic
984580841 4:181508363-181508385 TTCACACTGGAACTCCAAAGAGG + Intergenic
986420489 5:7576180-7576202 TGCACACAGGCCCTCCCAGGAGG + Intronic
987374998 5:17225707-17225729 TGCACACTGGATCTGCCAAGAGG - Intronic
989166468 5:38437649-38437671 TGCACATTAGAACCACCTGGCGG - Intronic
990569920 5:57067825-57067847 TGCACACTGGAAGGACAAGGTGG + Intergenic
990735069 5:58851360-58851382 TGCACACAGGCAGCTCCAGGGGG + Exonic
991705866 5:69358273-69358295 AGCACACTGGAAGGCCGAGGTGG + Intronic
992811139 5:80389780-80389802 TGCACACTGGCACCCCGTGACGG + Intergenic
999736220 5:154515316-154515338 AGCACTCTGGAAGGCCCAGGCGG + Intergenic
1001287824 5:170436493-170436515 TCAGCACTGGAATCCCCAGGAGG + Intronic
1002337390 5:178489313-178489335 TGGACTCTGCAACCCCCTGGGGG + Intronic
1002905314 6:1443879-1443901 TGCTCTCTGGGACCTCCAGGTGG - Intergenic
1003855642 6:10271190-10271212 TTCACACTGGAAACCTCAGTAGG + Intergenic
1004223694 6:13768278-13768300 AGCACACTGGAAGGCCAAGGCGG - Intergenic
1006267098 6:32934687-32934709 GGCACACTGAGAGCCCCAGGAGG + Exonic
1006600691 6:35223601-35223623 TACACACTGGAATTCCCTGGGGG - Intronic
1008036369 6:46749419-46749441 TGTACCCTGGAGCCCTCAGGTGG - Intronic
1008247436 6:49195067-49195089 GGCACACTGGAAAACCCAGAGGG + Intergenic
1010278383 6:73994988-73995010 TGCACCCTGGAACCTCATGGAGG - Intergenic
1014768770 6:125437455-125437477 TGTACACTGGAATCACCTGGAGG - Intergenic
1015895008 6:138008547-138008569 TGCACAGTGGAATCACCTGGGGG - Intergenic
1017289897 6:152723722-152723744 TGCCCACTGGAACTCTCTGGTGG - Exonic
1019073221 6:169366763-169366785 TCCACACTGAAAACACCAGGGGG - Intergenic
1019285409 7:220736-220758 TGCACACAGGAAGCTCCACGTGG + Intronic
1019358067 7:591280-591302 TGGGCACTGGGACCCCCACGTGG + Intronic
1019599010 7:1872199-1872221 TGCACACTGTGAGCCCCACGGGG + Intronic
1019658677 7:2211467-2211489 TGCACACTGGACCCTCCAGCAGG + Intronic
1019910370 7:4096824-4096846 GGGACACTGAAACCCCCACGGGG + Intronic
1020097518 7:5377090-5377112 TCCCCACTGGAGGCCCCAGGAGG - Intronic
1020255862 7:6502943-6502965 TCCAGGCTGGAAGCCCCAGGAGG + Intronic
1022496992 7:30859603-30859625 TGCACACTTGAGCACTCAGGGGG + Intronic
1022939031 7:35213369-35213391 TGCTCATTGGAATCACCAGGGGG - Intronic
1023125627 7:36951512-36951534 TGGCCACTGGAACCACCTGGAGG + Intronic
1023832886 7:44050372-44050394 TGAGCACTGGAAGCCCCATGTGG - Intronic
1024404434 7:48962459-48962481 TGCACAATGGAAGCCCCAGCAGG + Intergenic
1027381196 7:77611690-77611712 TGCACACTGGGAGGCCAAGGCGG - Intronic
1030903944 7:115159725-115159747 AGCAGACTGGAGTCCCCAGGGGG + Intergenic
1032095152 7:128934507-128934529 TGCAGAATGGAAGCTCCAGGAGG + Intergenic
1033362088 7:140644992-140645014 AGCACACTGGAAGGCCGAGGCGG + Intronic
1035597606 8:871100-871122 TGCACACTGGTGCCCAGAGGTGG - Intergenic
1037196410 8:16196376-16196398 TGAAGACTGCAGCCCCCAGGAGG - Intronic
1039105265 8:33982992-33983014 TGCACACTGGCAGCCCAAAGTGG - Intergenic
1042528528 8:69791229-69791251 TGTACCCTAGAACACCCAGGTGG - Intronic
1044695618 8:94919667-94919689 GCCACACTGGAACCCCCTGGTGG + Intronic
1045034283 8:98165330-98165352 TGCACACTGTATACACCAGGTGG + Intergenic
1047402983 8:124561678-124561700 TGCACACTAGAACAGCCCGGAGG + Intronic
1049046326 8:140154921-140154943 GGCACAGTGGAGCCCGCAGGAGG - Intronic
1049055916 8:140237547-140237569 TGCACTCTGGAATCACCTGGGGG - Intronic
1049560083 8:143305840-143305862 TGCAGAGTAGAAACCCCAGGTGG - Intronic
1049917970 9:336766-336788 TGGGCACTGGAACCCACAGGAGG + Intronic
1057022962 9:91714718-91714740 CGCATGCTGGAACCCCCGGGCGG - Intronic
1057517897 9:95737315-95737337 CGGACACTGGAACCCTCAGACGG + Intergenic
1058131777 9:101261824-101261846 TGCACACTAGAACCTACTGGAGG + Intronic
1062036296 9:134384135-134384157 TCCACACTGTCACCCCCGGGGGG + Intronic
1062293024 9:135805878-135805900 TGGACAGTGTAGCCCCCAGGTGG - Intergenic
1062489231 9:136796502-136796524 TGCACCCAGAAACCCCCAGACGG - Intronic
1062606147 9:137349701-137349723 TGCAGCCTGGGACCCCCACGTGG - Intronic
1187412143 X:19060868-19060890 TGCACATTGGAATCACCTGGGGG - Intronic
1187633184 X:21197480-21197502 CCAACACTGGAAGCCCCAGGAGG - Intergenic
1189273059 X:39765275-39765297 AGCACACTGGAATCCCCTGGAGG + Intergenic
1189278297 X:39803288-39803310 TGCACAACGGAATCACCAGGTGG + Intergenic
1190126466 X:47709799-47709821 GGCTCACTGCAACCTCCAGGAGG + Intergenic
1192198499 X:69048302-69048324 TGCTCACTGGAATCCCCTGGGGG - Intergenic
1195836868 X:109125506-109125528 TGGCCATTGGAACCACCAGGTGG - Intergenic