ID: 920301015

View in Genome Browser
Species Human (GRCh38)
Location 1:204989004-204989026
Sequence GGACCACTGTGGTCACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920301015 Original CRISPR GGACCACTGTGGTCACACCT GGG Intronic
901293913 1:8146135-8146157 GCACCAATGTGATCACTCCTGGG - Intergenic
901314106 1:8294030-8294052 GCACCACTGTGCTCCAACCTGGG + Intergenic
902231469 1:15030308-15030330 GCACCACTGTACTCCCACCTGGG - Intronic
903640785 1:24858784-24858806 GCACCACTGTGCTCCAACCTGGG - Intergenic
905149740 1:35918342-35918364 TGTCCACTGTGGTCCCAGCTGGG - Exonic
910041087 1:82852173-82852195 GACCCACTGTAGTCACACCTGGG + Intergenic
910584701 1:88866449-88866471 GCACCACTGTACTCAAACCTGGG - Intronic
916530615 1:165652970-165652992 GGGCCACTCTGGTCAGAACTTGG - Intronic
917256383 1:173120876-173120898 GGACCAATGTGGCCAGCCCTAGG - Intergenic
917496151 1:175541891-175541913 GGACAAATGTGGTCAAACGTTGG - Intronic
918975854 1:191485062-191485084 GTGCCACTGTGCTCTCACCTGGG + Intergenic
920241596 1:204555820-204555842 GCACCACTGCGCTCCCACCTGGG + Exonic
920301015 1:204989004-204989026 GGACCACTGTGGTCACACCTGGG + Intronic
921271015 1:213469968-213469990 GTACCACTGTGCTCCAACCTGGG + Intergenic
924760348 1:246979009-246979031 GGACTTCTGTGGTTTCACCTTGG + Intronic
1063313982 10:4983982-4984004 GCACCACTGTAGACACAGCTGGG - Intronic
1063585935 10:7352363-7352385 GCACCACTGTACTCCCACCTGGG - Intronic
1063670646 10:8096934-8096956 AGAGCATTGTGGTCAAACCTGGG + Intergenic
1067477798 10:46578123-46578145 TGTCCTCTCTGGTCACACCTCGG - Intergenic
1067683839 10:48455879-48455901 TGTCCACAGTGGTGACACCTAGG + Intronic
1068186608 10:53593745-53593767 GAAGCAATCTGGTCACACCTTGG + Intergenic
1069532223 10:69227791-69227813 GGAACACTGTGGTAAGACCTTGG - Intronic
1070722346 10:78765331-78765353 GGAGCAGGGTGGTCACACGTGGG + Intergenic
1070888272 10:79923355-79923377 GAACCAGTGGGGCCACACCTGGG + Intergenic
1074114566 10:110446057-110446079 AGAACACTGTGGGCACACCATGG + Intergenic
1077268048 11:1661674-1661696 GGCCCTGTGTTGTCACACCTGGG - Intergenic
1078167176 11:8897686-8897708 AGCCCACTGTGGTCTCTCCTGGG - Intronic
1078211649 11:9274845-9274867 GGAGCACTGGAGTCACTCCTGGG - Intergenic
1079132621 11:17756451-17756473 AGTCAACTGTGGTCCCACCTGGG + Intronic
1079212778 11:18478028-18478050 GAACCACTATGGGCAGACCTTGG + Intronic
1082795510 11:57375957-57375979 GGAACACTGAGGTCCCACCTAGG - Intergenic
1084673164 11:70619470-70619492 GGACGCCTGTGGTCACACTCAGG + Intronic
1085731053 11:78999153-78999175 GGACACCAGTGGTCACACCGCGG + Intronic
1088749354 11:112830849-112830871 GGACCACTCAGGTCAGACCAGGG + Intergenic
1089566352 11:119373695-119373717 GCACCTGTGTGTTCACACCTCGG + Intronic
1090375599 11:126286397-126286419 GGCCCCCTGTGTTCACACCTGGG - Intronic
1090658032 11:128860768-128860790 TTTCCTCTGTGGTCACACCTGGG - Intronic
1092282945 12:7110848-7110870 GGCCCACCTTGGTCTCACCTAGG + Intergenic
1093465746 12:19446882-19446904 GTGCCACTGTAGTCAAACCTGGG + Intronic
1095547647 12:43390039-43390061 GGACCACTGGAGACACATCTGGG + Intronic
1096266908 12:50130760-50130782 GGAACACAGTGCCCACACCTGGG - Intronic
1102651298 12:114444348-114444370 GGACCAACCTGGTCACAGCTGGG + Intergenic
1103356399 12:120324623-120324645 GCACCACTGTGCTCATGCCTGGG + Intronic
1104034557 12:125089358-125089380 GGACCCCTGGGGGCACACCTGGG + Intronic
1104383948 12:128332713-128332735 GGTCCACAGTGGACACACCAGGG - Intronic
1105775360 13:23654420-23654442 GGGCCACTGTGATCAGACGTGGG - Intronic
1105967569 13:25398525-25398547 GGCCCACAGTGATCACAACTGGG - Intronic
1106181224 13:27371493-27371515 GGACCACAGAGGTGACCCCTGGG - Intergenic
1107600716 13:42009825-42009847 GCACCACTGTGCTCCAACCTGGG + Intergenic
1108267899 13:48730614-48730636 GCAACAATGGGGTCACACCTTGG + Intergenic
1108331444 13:49388975-49388997 GGAATACTGTGGCCAAACCTGGG - Intronic
1111176354 13:84601384-84601406 GTACCACTGTGCTCCAACCTGGG + Intergenic
1113296837 13:108968581-108968603 GTGCCACTGTAGTCCCACCTGGG + Intronic
1113765346 13:112877581-112877603 ACACCACTGTGGCCACAGCTAGG - Intronic
1114181412 14:20371153-20371175 GGACCAGTGTTTTTACACCTTGG - Intronic
1117418465 14:55519665-55519687 GTACCACTGTGGCCACCACTGGG - Intergenic
1117837194 14:59819594-59819616 CGACCACTGTTGTCAGCCCTTGG + Intronic
1118092712 14:62499824-62499846 GGACCACAAGGGTCATACCTTGG - Intergenic
1121056831 14:90862508-90862530 GTACCACTGTACTCCCACCTGGG - Exonic
1121359231 14:93241184-93241206 GCACCACTGTGCTCCCACCTGGG - Exonic
1123054320 14:105562002-105562024 GGACCACTGGGGACAGGCCTGGG - Intergenic
1123078904 14:105682421-105682443 GGACCACTGGGGACAGGCCTGGG - Intergenic
1125075684 15:35614715-35614737 GCACCACTGTGCTCCAACCTGGG + Intergenic
1127351171 15:58154053-58154075 GGCCTAAGGTGGTCACACCTAGG - Intronic
1127985239 15:64064678-64064700 GCACCACTGTACTCCCACCTTGG - Intronic
1128031966 15:64489064-64489086 GCACCACTGTATTCCCACCTGGG + Intronic
1131288731 15:91085949-91085971 GCACCACTGTGTTCACACAGAGG + Intergenic
1131813392 15:96197647-96197669 TGAGCACTGTGATCACACCATGG + Intergenic
1131912184 15:97219468-97219490 GGAGTACAGTGGTGACACCTTGG + Intergenic
1132382560 15:101376795-101376817 GGTCCACTGTGGTTACCCCCAGG + Intronic
1132932409 16:2465659-2465681 GCACCACTGTGCTCCAACCTGGG + Intergenic
1133560027 16:6942194-6942216 GCACCACTGTGCTCCAACCTGGG + Intronic
1133653021 16:7830849-7830871 GGCCTAAGGTGGTCACACCTAGG - Intergenic
1134298059 16:12964223-12964245 TGTCCACTGTTTTCACACCTAGG + Intronic
1134926550 16:18168008-18168030 GTGCCACTGTGCTCCCACCTGGG - Intergenic
1136533549 16:30885892-30885914 GCACCACTGTGCTCAAATCTGGG - Intronic
1136865933 16:33753655-33753677 GGACAACTGTTGGCACATCTTGG - Intergenic
1142210967 16:88808285-88808307 GGGCCACTGTGGACAGACGTGGG + Exonic
1203106221 16_KI270728v1_random:1362448-1362470 GGACAACTGTTGGCACATCTTGG + Intergenic
1203127293 16_KI270728v1_random:1599920-1599942 GGACAACTGTTGGCACATCTTGG - Intergenic
1142962920 17:3562420-3562442 ACACCACTGTGCTCCCACCTGGG + Intergenic
1144014224 17:11178560-11178582 GGACCACTGTCTTCAAATCTTGG - Intergenic
1144386538 17:14753459-14753481 GCACCACTGTACTCAAACCTGGG + Intergenic
1144620082 17:16813004-16813026 GGACCACTGGGCTCTCACCAAGG - Intergenic
1144892604 17:18502695-18502717 GGACCACTGGGCTCTCACCAAGG + Intergenic
1145139610 17:20441592-20441614 GGACCACTGGGCTCTCACCAAGG - Intergenic
1146112280 17:30100722-30100744 GCACCACTGTGCTCCAACCTAGG + Intronic
1146396259 17:32470053-32470075 GCACCACTGTGCTCCAACCTGGG - Intronic
1147279671 17:39348740-39348762 GGACCACTGTACTCCAACCTGGG - Intronic
1148076181 17:44936341-44936363 CCATCACTGTGGTGACACCTGGG + Exonic
1148903925 17:50899544-50899566 GTACCACTGTGCTTAAACCTGGG - Intergenic
1148960876 17:51391719-51391741 GCACCACTGTGCTCCAACCTGGG + Intergenic
1149527567 17:57368510-57368532 TCACCACTGTGCTCCCACCTGGG + Intronic
1153821883 18:8839143-8839165 AGGCCACTGTGGTCACAGCAAGG + Intergenic
1154050534 18:10952182-10952204 CGACCACAGTGGTAACACATTGG - Intronic
1156232989 18:35173147-35173169 GCACCACTGTAGTCCCACCTGGG - Intergenic
1158183129 18:54740609-54740631 GGACCACTTTAGCCACTCCTAGG - Intronic
1158549608 18:58424344-58424366 GCACCACTGCGTTCCCACCTGGG + Intergenic
1160505456 18:79423947-79423969 GGACCACTGCTGTCCCACCCTGG - Intronic
1161744227 19:6045297-6045319 GGACCACAGTGATGAAACCTGGG + Intronic
1161943318 19:7419264-7419286 GGCCGAGTGTGGGCACACCTGGG - Intronic
1162359349 19:10208443-10208465 ACACCACTGTGCTCCCACCTGGG + Intronic
1162393435 19:10403281-10403303 GGACCCCGCTGTTCACACCTAGG - Intronic
1162751157 19:12830233-12830255 GGGCCACTGTGGTCTAAGCTTGG - Intronic
1164896558 19:31882179-31882201 TGACCACTGCAGTCACACCAGGG - Intergenic
1165820887 19:38675322-38675344 GTACCACTGTGATCCCACTTGGG - Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1166568454 19:43779254-43779276 GGGTCACTGTGTTCCCACCTCGG + Intronic
1168228420 19:55013125-55013147 GCACCACTGCTGTCAAACCTGGG - Intergenic
1168393623 19:56030325-56030347 GCACCACTGTGCTCCAACCTGGG + Intronic
926143156 2:10380540-10380562 GGCCCTCTGTGGACACACCATGG - Intronic
926158006 2:10468600-10468622 GCACCACTGTAGTCCCGCCTGGG - Intergenic
926184454 2:10678089-10678111 GCACCACTGTGCTCCAACCTGGG - Intronic
929717331 2:44326422-44326444 GGACCACTGTGCTCCAGCCTGGG - Intronic
933340969 2:81025658-81025680 ACACCACTGTGGACACAGCTAGG - Intergenic
933569199 2:83989068-83989090 GGACCACTGTGCTCCAGCCTGGG + Intergenic
935596671 2:104883988-104884010 GGACCACTGGGAACTCACCTAGG - Intergenic
937046680 2:118855526-118855548 GACCCACTGGGGTCACCCCTAGG - Intergenic
937470404 2:122169478-122169500 TGCCCACTGTTGTCACAACTTGG + Intergenic
938155518 2:128936274-128936296 GGACCACTGTTGTCCAGCCTGGG + Intergenic
939236774 2:139504269-139504291 AAACCACTGGAGTCACACCTAGG - Intergenic
941968594 2:171325226-171325248 GGACCACTGTGCTCCAGCCTGGG - Intronic
942243618 2:173986993-173987015 GGTCCAATGTTGTCACAGCTGGG + Intergenic
944156846 2:196616578-196616600 GCCTCACTGTGTTCACACCTCGG + Intergenic
944163019 2:196686607-196686629 AAACCTCAGTGGTCACACCTAGG + Intronic
947631705 2:231657774-231657796 GGACCACTGTGCTCCAGCCTGGG + Intergenic
948094447 2:235322229-235322251 TTGCCACTGGGGTCACACCTGGG - Intergenic
948679757 2:239625819-239625841 GTTCCTCTGTGGTCACACCTAGG + Intergenic
1169198531 20:3696518-3696540 GGACTACTCTGGTCAGACTTTGG - Intronic
1169424405 20:5485099-5485121 GGCCCACTGTGGTCATAACAGGG + Intergenic
1170132183 20:13032569-13032591 GGACCAGTGTGGGCACCCATTGG - Intronic
1170941076 20:20848391-20848413 GGTCCGCTGTTTTCACACCTAGG - Intergenic
1171323400 20:24267280-24267302 GGGTCTCTGTGGTAACACCTTGG - Intergenic
1172825946 20:37786168-37786190 GCACCACTGTGGCCACCACTGGG + Intronic
1175248914 20:57597262-57597284 GGGCCGCTGGGGTCACAGCTGGG + Intergenic
1176236584 20:64056410-64056432 GGTCCACTGGGGTCACAGCTCGG + Intronic
1178106081 21:29320799-29320821 GGTCCCCAGAGGTCACACCTTGG - Intronic
1178626725 21:34224686-34224708 GCACCACTGTACTCCCACCTGGG + Intergenic
1180090883 21:45533396-45533418 GGGCTGCTGTGGGCACACCTGGG + Intronic
1181042372 22:20198211-20198233 TGACCACTGCGGCCCCACCTGGG + Intergenic
1184691494 22:46119364-46119386 TGACCTCTGTGGACACAGCTTGG - Intergenic
950358192 3:12429394-12429416 GCACCACTGGGGTCAGCCCTTGG - Intronic
952358293 3:32604889-32604911 GGCCGACTCTGGGCACACCTAGG + Intergenic
954038531 3:47866950-47866972 TGACCACTGTGCTCAGACCCAGG + Intronic
954898352 3:53996714-53996736 GGAATGCTGTGGCCACACCTGGG - Intergenic
958803538 3:98782972-98782994 GGACCACATTTGTCACACATGGG - Intronic
961355947 3:126340105-126340127 GACCCACTGTGGGCACAGCTGGG + Intergenic
962829931 3:139131053-139131075 GGACCACTGTCCTCAAACCCAGG - Intronic
964112860 3:153105318-153105340 GCACCACTGTACTCAAACCTGGG - Intergenic
969273516 4:6119025-6119047 GGAGCACTGCGGCCACACCAGGG + Intronic
970404309 4:15747710-15747732 GGACCACTGTGCTCCAGCCTGGG - Intergenic
976755930 4:88498012-88498034 GGGCCACTGGAGTCACACCTGGG - Intronic
978006259 4:103620777-103620799 TGAGCACTATGCTCACACCTGGG + Intronic
978550439 4:109919671-109919693 GGAGCACTGTGGCCTCACATTGG + Intronic
984160341 4:176244918-176244940 GCACCACTGTGCTCTCACCTGGG + Intronic
984431864 4:179660835-179660857 GGGCCACTGGAGCCACACCTGGG - Intergenic
984760564 4:183359469-183359491 GCACCACTGTACTCCCACCTGGG + Intergenic
987710985 5:21500262-21500284 GCACCACTGTACTCCCACCTGGG + Intergenic
988749157 5:34177353-34177375 GCACCACTGTACTCCCACCTGGG - Intergenic
990140241 5:52694789-52694811 GGACCGCTGAAGTCACATCTTGG + Intergenic
990183949 5:53192603-53192625 GGACACCTGTGATCACATCTAGG - Intergenic
990996211 5:61734574-61734596 GACCCAGTGTGGTCCCACCTGGG + Intronic
991761324 5:69919323-69919345 GCACCACTGTACTCCCACCTGGG + Intergenic
991786005 5:70198777-70198799 GCACCACTGTACTCCCACCTGGG - Intergenic
991840552 5:70794371-70794393 GCACCACTGTACTCCCACCTGGG + Intergenic
991878449 5:71199168-71199190 GCACCACTGTACTCCCACCTGGG - Intergenic
998351815 5:141506889-141506911 GAAGCACTGTCATCACACCTGGG + Intronic
1000005960 5:157185287-157185309 GGAGCACAGTGGTGCCACCTTGG + Intronic
1001993459 5:176135220-176135242 GGACCACTCTGGCCAGACCTTGG + Intergenic
1002511051 5:179718045-179718067 GTACCACTGTACTCCCACCTGGG - Intronic
1003506987 6:6748269-6748291 GGAGGACTGTGGTCACCCTTGGG - Intergenic
1004671473 6:17801457-17801479 GCACCACTGTGCTCTAACCTGGG + Intronic
1005546706 6:26880235-26880257 GCACCACTGTACTCCCACCTGGG - Intergenic
1009017459 6:57921321-57921343 GCACCACTGTACTCCCACCTGGG - Intergenic
1009431375 6:63570286-63570308 GCACCACTGTGCTCCAACCTGGG + Intronic
1013757243 6:113476189-113476211 TCACCACTGTGGTCAAGCCTGGG - Intergenic
1018702885 6:166441440-166441462 AAACCACTGTGGCCAAACCTGGG - Intronic
1018745917 6:166762069-166762091 GTACCTCTGTGGTGACACCAGGG - Intronic
1019095707 6:169577467-169577489 TGCCCGCTGTGGTTACACCTGGG - Intronic
1021761861 7:23910306-23910328 GGCCCACTGGAGCCACACCTGGG - Intergenic
1022243527 7:28535133-28535155 GGCCCAGTGTGGTCACACGAAGG + Intronic
1024141587 7:46467918-46467940 GGATCACTGGGGTCCCAACTAGG + Intergenic
1024264668 7:47597540-47597562 GGCCTTCTGTGGGCACACCTAGG - Intergenic
1024348142 7:48334375-48334397 GCACCACTGTGCTCCAACCTGGG - Intronic
1024825975 7:53389745-53389767 GCACCACTGTGCTCCCGCCTGGG - Intergenic
1025926599 7:65965570-65965592 GCACCACTGTACTCCCACCTGGG - Intronic
1026625462 7:71988015-71988037 TGACACCTGTTGTCACACCTGGG - Intronic
1026967221 7:74447931-74447953 GGTCCTCTGTGATCACATCTGGG + Intergenic
1027141714 7:75662224-75662246 GCACCACTGTGGTCCATCCTGGG - Intronic
1027223049 7:76226227-76226249 GGCCCACTGTGTCCACACCCAGG + Intronic
1028207975 7:88038821-88038843 GCACCACTGTGCTCCCGCCTGGG - Intronic
1028456955 7:91048915-91048937 GCACCACTGCAGTCCCACCTGGG - Intronic
1029254141 7:99257679-99257701 GCACCACTGCGCTCCCACCTAGG - Intergenic
1030605028 7:111631881-111631903 GCACCACTGTGCTCCAACCTGGG - Intergenic
1030707988 7:112715056-112715078 GGTTCACTCTGGCCACACCTGGG + Intergenic
1031718193 7:125134800-125134822 GGCCCACTGGAGCCACACCTGGG - Intergenic
1034329809 7:150272731-150272753 GCACCACTGTAGTCCCACCTGGG - Intronic
1035685833 8:1523043-1523065 GCAGCACTGGGGTCACACCCAGG + Intronic
1035868066 8:3106353-3106375 GCACCACTGTACTCCCACCTGGG + Intronic
1036048138 8:5166802-5166824 GGACCACAGTCCTCACACCTTGG + Intergenic
1036576496 8:10032180-10032202 GGCCCACTGGAGCCACACCTGGG + Intergenic
1036635427 8:10547220-10547242 GGACCACTACGCTCACCCCTCGG - Intronic
1040045205 8:42955929-42955951 AGAATACTGTGATCACACCTGGG - Intronic
1040666327 8:49638664-49638686 GGAGGACTGTGGCCTCACCTGGG - Intergenic
1041082113 8:54223900-54223922 GGACCACTGCTGTCACTCCCAGG - Intergenic
1042979265 8:74507165-74507187 GTTCCAGTGTGGTCACATCTTGG - Intergenic
1046393462 8:113608247-113608269 AGACCAATGTGATCACACTTTGG - Intronic
1047293840 8:123553657-123553679 GCACCACTGTGCTCCAACCTGGG - Intergenic
1047953573 8:129955972-129955994 GGACCATTGTGGTCATCCTTAGG - Intronic
1049232328 8:141490815-141490837 GGCTCTGTGTGGTCACACCTGGG + Intergenic
1049696430 8:143986302-143986324 GGAGCATTGAGGACACACCTTGG - Intronic
1050067169 9:1771967-1771989 GGCCCACTGGAGTCACACCTGGG + Intergenic
1056007166 9:82285069-82285091 GGACCACTGTGATTCCACTTTGG - Intergenic
1056428035 9:86498044-86498066 GCACCACTGTGCTCCAACCTGGG + Intergenic
1056520528 9:87397068-87397090 GCACCACTGTGCTCCCGCCTGGG - Intergenic
1056633765 9:88315141-88315163 GCACCACTGTGCTCCAACCTGGG - Intergenic
1057627924 9:96694316-96694338 GTACCACTGTGGTCCAGCCTGGG - Intergenic
1061215520 9:129219480-129219502 GGTCCACCGTGGCCACATCTTGG - Intergenic
1062068530 9:134541889-134541911 GGGCCAGTGTGGTCACAAATCGG - Intergenic
1062070215 9:134551379-134551401 GGACCACTGGGGTCTCTACTTGG - Intergenic
1185604211 X:1358340-1358362 GGGCCACTGTGGCAAGACCTTGG - Intronic
1186410969 X:9344076-9344098 GTGCCACTGTGCTCACGCCTGGG + Intergenic
1186452575 X:9685763-9685785 GTACCACTGTACTCCCACCTGGG - Intronic
1186918588 X:14251079-14251101 GCACCACTGTGCTCCAACCTGGG - Intergenic
1190464634 X:50713590-50713612 GCACCACTGTACTCCCACCTGGG + Intronic
1193272532 X:79545661-79545683 GGCCCACTGGAGTCACACCTAGG + Intergenic
1196250998 X:113459855-113459877 GGGCCACTGGAGCCACACCTGGG + Intergenic
1197244087 X:124150467-124150489 GGACCATTGTGATCCCACCCAGG + Intronic
1198133915 X:133727734-133727756 GCACCACTGTGGCCACAGCCTGG + Intronic
1200699606 Y:6390868-6390890 GGAGCACTGTTCTCACACCTTGG + Intergenic
1200915354 Y:8566629-8566651 GGAGCAGTGTTCTCACACCTTGG - Intergenic
1200915877 Y:8570793-8570815 GGAGCAGTGTACTCACACCTTGG - Intergenic
1200919570 Y:8601313-8601335 GGAGCAGTGTTCTCACACCTCGG - Intergenic
1200923644 Y:8635184-8635206 GGAGCACTGTTCTCACACCTAGG - Intergenic
1200925824 Y:8653825-8653847 GGAGCAGTGTTTTCACACCTTGG - Intergenic
1201034505 Y:9773830-9773852 GGAGCACTGTTCTCACACCTTGG - Intergenic
1201039044 Y:9810716-9810738 GGATCAATGTTCTCACACCTCGG + Intergenic
1202149830 Y:21834740-21834762 GGAGCAGTGTTCTCACACCTCGG - Intergenic
1202586055 Y:26428923-26428945 GGACAACTGTTGGCACATCTTGG + Intergenic