ID: 920301093

View in Genome Browser
Species Human (GRCh38)
Location 1:204989537-204989559
Sequence CAGTCTGGGACCTCTCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920301085_920301093 8 Left 920301085 1:204989506-204989528 CCCGCACACGCACTGGCATCAGG 0: 1
1: 0
2: 5
3: 19
4: 154
Right 920301093 1:204989537-204989559 CAGTCTGGGACCTCTCGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 130
920301083_920301093 17 Left 920301083 1:204989497-204989519 CCAGGCTCACCCGCACACGCACT 0: 1
1: 0
2: 1
3: 11
4: 151
Right 920301093 1:204989537-204989559 CAGTCTGGGACCTCTCGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 130
920301087_920301093 7 Left 920301087 1:204989507-204989529 CCGCACACGCACTGGCATCAGGG 0: 1
1: 0
2: 2
3: 7
4: 111
Right 920301093 1:204989537-204989559 CAGTCTGGGACCTCTCGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920301093 Original CRISPR CAGTCTGGGACCTCTCGAGG AGG Intronic
900612549 1:3550360-3550382 CACTGTGTGACCTCTCGAGATGG - Intronic
902786279 1:18734601-18734623 CAGTCTGGGAAATCTAGGGGAGG - Intronic
907588537 1:55643535-55643557 CAGCCTCTGACCTCTCGAGAAGG - Intergenic
908286571 1:62610620-62610642 CACACTGGGACCTGTCGGGGTGG - Intronic
910293331 1:85619549-85619571 GAGTCTGGGAAATCTCAAGGAGG - Intergenic
915311414 1:155007581-155007603 CAGTGTGCTACCTCTTGAGGAGG + Intronic
915896059 1:159811845-159811867 CAGGCTGGGCCCTTTGGAGGAGG - Intronic
919750047 1:201031865-201031887 CAGAGGGGGACCTCTCAAGGTGG + Intergenic
920089092 1:203439796-203439818 CAGTCTAGGACCTGTCTAGGGGG + Intergenic
920301093 1:204989537-204989559 CAGTCTGGGACCTCTCGAGGAGG + Intronic
921111883 1:212046449-212046471 CACACTGGGGCCTCTTGAGGGGG - Intronic
923033611 1:230268679-230268701 GAGTCTGGGCCCTGTGGAGGTGG + Intronic
1062962283 10:1581468-1581490 CAGGCTGGGAACTCAGGAGGTGG - Intronic
1075448506 10:122530467-122530489 GAGACTGGGACCTCTGGATGTGG + Intergenic
1076879915 10:133235269-133235291 CACTCTGGGACCACCTGAGGGGG - Intergenic
1078412176 11:11133659-11133681 CAGTCAGTGACCTTTCAAGGTGG - Intergenic
1080406625 11:31985886-31985908 CAATCTGAGACCTCTCAAAGAGG + Intronic
1080770989 11:35341203-35341225 CGGCCTGGGACCTCCCTAGGAGG - Intronic
1083294097 11:61705994-61706016 CTGTCTGGGATCTCTGGAGGAGG + Intronic
1083611801 11:64007886-64007908 CAGCCTCGGCCCTCTGGAGGCGG - Intronic
1085154304 11:74279287-74279309 CATTCAGGGACCTCCAGAGGTGG - Intronic
1085714334 11:78858462-78858484 CAGGCTGGGAGCTGTTGAGGGGG + Intronic
1088088766 11:106012676-106012698 CAGACTGGGAACTCTCGAAGTGG + Intronic
1089005537 11:115087728-115087750 CAGGCTGGGGCTTCTCGGGGAGG + Intergenic
1090803831 11:130190334-130190356 CAGCCTGGGGCGTCTCGAAGGGG + Intronic
1093129615 12:15374516-15374538 CAGTCTTGGAGCACTGGAGGGGG + Intronic
1094026360 12:25963668-25963690 CAGTTTGGGAACCCCCGAGGTGG - Intronic
1095547019 12:43384613-43384635 CACACTGGGGCCTGTCGAGGGGG - Intronic
1098882016 12:75926646-75926668 CAACCTGGGACCTCCCCAGGAGG + Intergenic
1100942752 12:99741728-99741750 CACACTGGGGCCTGTCGAGGTGG + Intronic
1103343225 12:120232382-120232404 TGTTCTGGGACCTCTGGAGGAGG - Intronic
1104391665 12:128396368-128396390 CAGACTGGGGCCTGTCGTGGGGG + Intronic
1106603880 13:31209656-31209678 CAGTCTGGGAAGTGTCTAGGTGG - Intronic
1107845296 13:44506465-44506487 CACACTGGGACCTGTTGAGGGGG + Intronic
1114546906 14:23509713-23509735 GAGTCTGGGACTTCTACAGGAGG + Intronic
1114791008 14:25658368-25658390 CCTTCTGGGACCTCTGGAGGAGG + Intergenic
1120190254 14:81434269-81434291 CAGTCTGAGATCTCACGAGGTGG + Intronic
1202860610 14_GL000225v1_random:79186-79208 CAGCCTGGGACCTCTCAAGCAGG - Intergenic
1202922040 14_KI270723v1_random:35520-35542 CAGCCTGGGCCCTCTCAAGCGGG + Intergenic
1125676131 15:41503442-41503464 CGGTCTGGCACCTCTGGAGAGGG - Exonic
1126891574 15:53210811-53210833 CAGTTTGGGGCCTCTCTTGGTGG + Intergenic
1128357987 15:66941875-66941897 GAGTCTGGGAGCTTTGGAGGGGG - Intergenic
1129565706 15:76620836-76620858 CATGCTGGGGCCTGTCGAGGGGG + Intronic
1132353721 15:101156294-101156316 CAGTCTTGGACACCTGGAGGGGG + Intergenic
1132971273 16:2690366-2690388 AAGCCTGGGACCTCTGGAGATGG + Intronic
1136662640 16:31777943-31777965 CACACTGGGGCCTGTCGAGGGGG + Intronic
1137804324 16:51289041-51289063 CAGTCTGGGAGCTCTCTCTGAGG - Intergenic
1139923833 16:70475018-70475040 CACCCTGGGACCTCTGCAGGTGG + Intronic
1140280631 16:73551600-73551622 CAGTCTGGAACCTCTAGAGCTGG + Intergenic
1140744941 16:77973077-77973099 CTCCCTGGGGCCTCTCGAGGAGG + Intronic
1142320842 16:89381917-89381939 CAGGCTGTGACCTCTCCACGGGG + Intronic
1142864236 17:2780559-2780581 CACTCTGTGACCTCTCCTGGGGG - Intronic
1143516829 17:7423550-7423572 CAGTGAGGTACCTCTTGAGGGGG - Intergenic
1144630872 17:16871879-16871901 CCTTCTGGGTCCTCTCCAGGAGG - Intergenic
1144650442 17:17003596-17003618 CCTTCTGGGTCCTCTCCAGGAGG + Intergenic
1149661890 17:58338365-58338387 CACCCTGGGACCCCTCGAAGAGG - Intergenic
1151186894 17:72371281-72371303 CAGTTTGGGGCGTCTCAAGGAGG + Intergenic
1151481001 17:74370050-74370072 CACACAGGGACCTCTCTAGGAGG - Intronic
1152186012 17:78856626-78856648 CAGCCTGGGAGCCCTGGAGGCGG + Intronic
1152199326 17:78935941-78935963 CTGTCTGGGATGTCTCGAGTGGG + Intergenic
1153938277 18:9951884-9951906 CAGACGGGTACCCCTCGAGGGGG - Intronic
1156746122 18:40393430-40393452 TAGTCTGGGACCCCTGGAAGTGG - Intergenic
1159226595 18:65545463-65545485 CACACTGGGACCTGTCGAAGGGG + Intergenic
1161697411 19:5777228-5777250 TAGTCTGGGGCCTCTAGAGAAGG - Intronic
1163576172 19:18112041-18112063 CAGACAGGGACCTCTTGGGGAGG + Intronic
1167030066 19:46952923-46952945 CACTCTGGGATCACTCAAGGTGG - Intronic
1167317184 19:48771268-48771290 GAGTCTGGGACCTCTCTCTGAGG - Intergenic
1168118355 19:54238851-54238873 CAATCTAGGACCTCCAGAGGGGG - Exonic
1168305360 19:55432344-55432366 CACTCTGGGACCTCTCCAGGAGG - Exonic
925139467 2:1540023-1540045 GAGGCTGGGACCTTTTGAGGAGG - Intronic
933678569 2:85078804-85078826 CAGACTGTGACATCTCCAGGTGG - Intergenic
938369576 2:130760872-130760894 CAGCGTGGGACAGCTCGAGGAGG - Intronic
938675537 2:133629964-133629986 CATACTGGGGCCTGTCGAGGGGG + Intergenic
942916291 2:181311829-181311851 CAGACTTGGACCTCTCCTGGAGG - Intergenic
945023798 2:205600662-205600684 CACACTGGGACCTGTCGGGGTGG - Intronic
947841233 2:233209106-233209128 TGGTCCGGGACCTCTCGGGGTGG - Intergenic
948524930 2:238565649-238565671 GAGGCTGGGACCTCTCCGGGCGG + Intergenic
948778919 2:240305051-240305073 CAGGCTGGGAGCTGGCGAGGAGG - Intergenic
1170086323 20:12536003-12536025 CAGTCTGGTAGCTCTGCAGGTGG + Intergenic
1170430568 20:16272891-16272913 CAGCCTGGGACCTCCCAAAGTGG - Intronic
1170733776 20:18995912-18995934 CAGTCCTGGACCTCTCCAGAAGG + Intergenic
1171449045 20:25223453-25223475 CTGTGTGGGAACTCTGGAGGGGG + Intronic
1173329747 20:42065156-42065178 CAGTCTGGCAGCTCTTGAGAAGG - Intergenic
1173844008 20:46176791-46176813 GAGGCTGGGAGCTCTGGAGGGGG + Intronic
1175096088 20:56542595-56542617 CAGTCTGCGACCTTTTGAGAGGG + Intergenic
1177044166 21:16148797-16148819 CAGCCTGGGACCTCCTCAGGGGG - Intergenic
1180699803 22:17775016-17775038 CAGCCTGAGACCTCCAGAGGTGG - Intergenic
1183451619 22:37899029-37899051 CATTGTGGGACCTCTGGAGCTGG - Intergenic
1184309888 22:43634317-43634339 GAGTGTGGGACCTCTCTAAGGGG + Intronic
1184486014 22:44779999-44780021 CAGGCTGGGACCCCAAGAGGTGG + Intronic
1184710067 22:46244615-46244637 CAGTCTGGAAGGTCTAGAGGGGG - Exonic
953187842 3:40654856-40654878 CACTCTGGGGCCTGTCCAGGGGG - Intergenic
954640044 3:52092427-52092449 CAGCCTGGGGCTTCTCCAGGAGG - Intronic
962624991 3:137216993-137217015 CAGACTGGGGCCTGTCGGGGGGG + Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
970180183 4:13383915-13383937 CAGGCTGGGACCTCAGGAGAGGG - Intronic
975428506 4:74259161-74259183 CAGTCTGGCATCTCTCCAGAAGG + Intronic
986449638 5:7851266-7851288 CAGTCGGGCTCCTCCCGAGGAGG - Exonic
989072230 5:37523178-37523200 GGGTCAGGGACCTCTTGAGGAGG - Intronic
991507169 5:67337290-67337312 CAGTCTGGGATATGTGGAGGAGG + Intergenic
994960407 5:106594818-106594840 CACACTGGGACCTGTCGGGGTGG + Intergenic
997211551 5:132079896-132079918 CAGTGTGGGACCTGGGGAGGAGG + Intergenic
999685898 5:154102855-154102877 TAGTGTGGGGCCTCTCCAGGGGG - Intronic
1001638205 5:173227772-173227794 CAGTCTGGGGCCTCTGCTGGTGG + Intergenic
1002160592 5:177312037-177312059 AAGTCTGAGACCACTCGGGGCGG - Exonic
1002534729 5:179869937-179869959 CACCCTGTGACCTCTCCAGGAGG - Intronic
1003174728 6:3746227-3746249 CAGTCTGAGATCTGTCGGGGGGG + Intronic
1005447716 6:25941868-25941890 CTGTCTGGGCCCCTTCGAGGAGG + Intergenic
1005877300 6:30020952-30020974 CATTCTGAGACCTCTAGGGGAGG - Intergenic
1007073302 6:39051503-39051525 CAGCCTGGGTCCTGTCCAGGAGG - Intronic
1007242783 6:40439095-40439117 CTGTCTGGAACAGCTCGAGGTGG - Intronic
1007253846 6:40514972-40514994 CAGTCTGGGAGCTGCCCAGGTGG - Intronic
1007738188 6:43994788-43994810 CAGTCTGAGCCCTATCTAGGAGG - Intergenic
1007777023 6:44229600-44229622 CATTCTGGGACATGTCCAGGCGG - Exonic
1012925297 6:105261525-105261547 CAGTCTTAGACTTCTAGAGGAGG + Intergenic
1019533759 7:1516956-1516978 CAGGCTGGGACCTGACAAGGAGG + Intergenic
1019885328 7:3899559-3899581 CAGAGTGGGCCCTCCCGAGGTGG + Intronic
1021427578 7:20519953-20519975 CAGTATATAACCTCTCGAGGTGG + Intergenic
1022767082 7:33425510-33425532 CACACTGGGGCCTCTGGAGGGGG - Intronic
1024045786 7:45584696-45584718 CAGGCTGGGACCTCTAGACCTGG - Intronic
1026398526 7:69984838-69984860 CAGTCTGGGAGCTGTGGATGAGG + Intronic
1032752329 7:134853870-134853892 CACACTGGGACCTGTCGGGGTGG - Intronic
1033363873 7:140656833-140656855 CAGGCTGGGACATATGGAGGAGG - Intronic
1035577773 8:719048-719070 GAGTCTGGGACCTGCCTAGGTGG - Intronic
1037609901 8:20467220-20467242 GTGGCTGGGGCCTCTCGAGGAGG + Intergenic
1037788362 8:21916335-21916357 CAGTCAGGGACCACTGGGGGTGG - Intergenic
1038441071 8:27571263-27571285 GAGTCTGGGACGGCTCCAGGTGG - Intergenic
1048605791 8:135967449-135967471 CAGACTGGAACCTTTGGAGGAGG + Intergenic
1050542268 9:6680931-6680953 CAGACGGGGACGTCACGAGGCGG - Intergenic
1051832373 9:21294463-21294485 CAGTCTGGGACCTGTGGAAAAGG - Intergenic
1051836689 9:21346330-21346352 CACACTGGGGCCTGTCGAGGGGG + Intergenic
1057226335 9:93295190-93295212 CAGTCTGGGACCGCGGGAGCTGG + Intronic
1058556253 9:106170736-106170758 CAGACTGGGGCCTGTCGCGGGGG + Intergenic
1061442949 9:130618969-130618991 AAGGCTGGGAGCTCTGGAGGAGG - Intronic
1187271183 X:17781108-17781130 CATTCTGGGAGCTCTTGGGGTGG + Intergenic
1193523911 X:82565674-82565696 CACACTGGGACCTGTCGGGGTGG - Intergenic
1194041804 X:88950731-88950753 CAGTCTGGTACCTCTAGGAGGGG + Intergenic
1198022728 X:132675140-132675162 CAGTTTGGGGCCTATCGAGTTGG + Intronic
1199717691 X:150517912-150517934 CAGCCTGGAACCTCTCAAGCAGG + Intergenic