ID: 920304512

View in Genome Browser
Species Human (GRCh38)
Location 1:205009978-205010000
Sequence AAGCCAATTTATAGAACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920304512_920304516 17 Left 920304512 1:205009978-205010000 CCATCTGTTCTATAAATTGGCTT 0: 1
1: 0
2: 1
3: 16
4: 267
Right 920304516 1:205010018-205010040 CATTAGGATCCTGTGTCCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 133
920304512_920304519 28 Left 920304512 1:205009978-205010000 CCATCTGTTCTATAAATTGGCTT 0: 1
1: 0
2: 1
3: 16
4: 267
Right 920304519 1:205010029-205010051 TGTGTCCCAGGGAAGGAGAAAGG 0: 1
1: 2
2: 7
3: 50
4: 552
920304512_920304517 21 Left 920304512 1:205009978-205010000 CCATCTGTTCTATAAATTGGCTT 0: 1
1: 0
2: 1
3: 16
4: 267
Right 920304517 1:205010022-205010044 AGGATCCTGTGTCCCAGGGAAGG 0: 1
1: 0
2: 5
3: 38
4: 406
920304512_920304513 1 Left 920304512 1:205009978-205010000 CCATCTGTTCTATAAATTGGCTT 0: 1
1: 0
2: 1
3: 16
4: 267
Right 920304513 1:205010002-205010024 TTTTCAGCCTGAATCTCATTAGG 0: 1
1: 0
2: 1
3: 20
4: 263
920304512_920304515 16 Left 920304512 1:205009978-205010000 CCATCTGTTCTATAAATTGGCTT 0: 1
1: 0
2: 1
3: 16
4: 267
Right 920304515 1:205010017-205010039 TCATTAGGATCCTGTGTCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920304512 Original CRISPR AAGCCAATTTATAGAACAGA TGG (reversed) Intronic
901268589 1:7932585-7932607 AAGCCAGTTTATCAACCAGAGGG + Intronic
903772477 1:25772615-25772637 AAGCCAGTTTAGAGAAAATAAGG - Intronic
905156483 1:35987567-35987589 AAGTAAAATTATAAAACAGATGG + Intronic
909236813 1:73162922-73162944 AAGCAAAATGTTAGAACAGATGG + Intergenic
909957275 1:81795013-81795035 GAGTTAATTTATAGATCAGAAGG + Intronic
910009799 1:82447586-82447608 AATTGAATTTATAGAAGAGAAGG + Intergenic
911249707 1:95561134-95561156 AAGACATATTATAGAACAAAAGG - Intergenic
911838256 1:102648793-102648815 AAGCCAAATTTTACTACAGAAGG - Intergenic
912404463 1:109425395-109425417 AAGTCACTTTATAGGACAGTGGG + Intronic
914973274 1:152331389-152331411 CAGGCAATTTATATAAAAGAAGG + Intergenic
915966156 1:160310484-160310506 AAGTCAAATTATTCAACAGAAGG + Intronic
916924894 1:169508076-169508098 AATCCAATTCACAGAATAGATGG - Intergenic
917029745 1:170676638-170676660 AAGCCAATTTTAAGAAGATAGGG + Intronic
917935238 1:179860160-179860182 AAGCCAATTGTTTGAACTGATGG - Intronic
917987628 1:180337109-180337131 ATTCCAATTAATAGAAAAGAGGG + Intronic
919261539 1:195201340-195201362 AGGCCAGTTCATAGAAAAGAGGG - Intergenic
920304512 1:205009978-205010000 AAGCCAATTTATAGAACAGATGG - Intronic
921490301 1:215767512-215767534 AAGCTAATTTGGAGAAGAGATGG + Intronic
923350140 1:233096774-233096796 TAGCCATTATATAAAACAGAAGG + Intronic
923901620 1:238332323-238332345 GGCCCAATTTATAGAACATAAGG - Intergenic
1064831615 10:19474832-19474854 AACCCATTTTATAGAACTAAGGG + Intronic
1067525609 10:47036596-47036618 AAATGAATTTATTGAACAGATGG + Intergenic
1068560151 10:58505254-58505276 AAGAAAATTTAGATAACAGAGGG - Intergenic
1068593334 10:58873586-58873608 AATCTAATTTATAAAACTGAGGG + Intergenic
1068818620 10:61346979-61347001 CAGACAATTTACAGAAGAGAAGG + Intergenic
1069523523 10:69146255-69146277 CAGCTAATTTTTAGTACAGACGG + Intronic
1071199203 10:83199408-83199430 AAGACAACATATAGGACAGATGG - Intergenic
1072882789 10:99244747-99244769 AAGCAAATGTTTATAACAGAAGG + Intergenic
1075247197 10:120833180-120833202 AAGGAAGTTTCTAGAACAGAAGG - Intergenic
1075364247 10:121869653-121869675 ATGGCAATTTACAGAACATAAGG + Intronic
1075841336 10:125506966-125506988 TAGCCAATTTATGGAATTGATGG - Intergenic
1078493411 11:11790947-11790969 CAACAAAATTATAGAACAGAAGG - Intergenic
1079844319 11:25445788-25445810 AAGCAAGCTTATAGATCAGAGGG + Intergenic
1084389804 11:68867985-68868007 AAACCAATTTGCAGTACAGAAGG - Intergenic
1084726360 11:70944996-70945018 AAGACAATTTGGGGAACAGAAGG - Intronic
1088087528 11:105999351-105999373 AAACCAAATAATAGAACAGTGGG - Intronic
1088117098 11:106324731-106324753 AAGACAAATTATATAAAAGAAGG + Intergenic
1088715621 11:112546702-112546724 AAGTCCATTTATTGCACAGATGG - Intergenic
1089922654 11:122224875-122224897 AAGCTATTTTATAGAAAATAGGG + Intergenic
1090235536 11:125144175-125144197 AAGGAATTTTATAGAACTGAAGG + Intergenic
1090423276 11:126590288-126590310 AAAGCAATTTTTAAAACAGAGGG - Intronic
1091121042 11:133057751-133057773 AACCCAATGGATTGAACAGAAGG - Intronic
1091187904 11:133663070-133663092 AAGCTAATTCAAAGAACAGTTGG + Intergenic
1091781679 12:3217905-3217927 AACCCATTTTATAGATGAGAAGG - Intronic
1092681370 12:10985670-10985692 ATGCCAAATTATAGAAAATATGG - Intronic
1093630434 12:21401755-21401777 AATCCAATTAATATCACAGAAGG - Intronic
1093888429 12:24490164-24490186 AAGCTGAGTTATAGAACAAATGG - Intergenic
1095865916 12:46971978-46972000 AAGCCTATTTACAGAAGAAAAGG - Intergenic
1097236560 12:57544250-57544272 ATGCCAATTTATATAGAAGATGG - Intronic
1097357874 12:58621773-58621795 AAGACAATTTATAGAATATATGG + Intronic
1098802149 12:74974804-74974826 AAGCCACATTCTAGAACACAAGG + Intergenic
1099099465 12:78420227-78420249 AAAGCAATTCATTGAACAGATGG - Intergenic
1099174932 12:79410131-79410153 TGGCTAATTTGTAGAACAGAGGG - Intronic
1099722955 12:86387021-86387043 AAGCCAATTTATAGAAAATAAGG - Intronic
1101045119 12:100797226-100797248 ATGCCCATTTGGAGAACAGAAGG + Intronic
1101650931 12:106676365-106676387 AAGGAAATTTAGAGAAAAGATGG + Intronic
1101660592 12:106761756-106761778 AAGCAAAGTCATGGAACAGAGGG - Intronic
1103114157 12:118310697-118310719 AAACCTATTTATATAATAGAAGG - Intronic
1108968065 13:56337894-56337916 CAGCAAAGTTATAGAACACAGGG + Intergenic
1108990756 13:56654929-56654951 AAGCCAATTTCTATCACATATGG - Intergenic
1109668709 13:65574570-65574592 GAGAGCATTTATAGAACAGAAGG - Intergenic
1110571219 13:77006501-77006523 AAGACAATAAATGGAACAGAAGG - Exonic
1110931924 13:81230692-81230714 AAGACATTTTTTTGAACAGATGG - Intergenic
1111582702 13:90245326-90245348 AAGCTAATTTATAGAACCACTGG + Intergenic
1112038675 13:95523140-95523162 AAGCAAATTAATACAAAAGACGG - Intronic
1112599149 13:100838361-100838383 CAACCAATCTATAGGACAGAAGG - Intergenic
1113219028 13:108076932-108076954 AAGCCAATGTGCAGCACAGAAGG + Intergenic
1115666054 14:35549033-35549055 AAGCAAGTTTTTAGAACAAAAGG + Intronic
1116013394 14:39377760-39377782 AAGCCAATTTAAAAAAAAAAAGG - Intronic
1116204348 14:41843497-41843519 AAGACGATTTTTATAACAGAGGG - Intronic
1116251433 14:42488291-42488313 AACCCAAGTTGTAGAACAAAAGG - Intergenic
1116555553 14:46300408-46300430 AAACCATTTCACAGAACAGATGG + Intergenic
1116881777 14:50177767-50177789 ATGGGAATTTATAGTACAGAAGG + Intronic
1116912291 14:50482029-50482051 AAACCAATTTACACAACTGAGGG + Intronic
1122095555 14:99368327-99368349 AAGACAAGCCATAGAACAGAGGG - Intergenic
1122505647 14:102230201-102230223 CAGCTAATTTTTAAAACAGATGG + Intronic
1124393899 15:29283673-29283695 CAGCCAAATTCTAGAACAGATGG + Intronic
1124457659 15:29859203-29859225 AAACCTATATATAGAACAAAAGG + Intronic
1124994037 15:34705519-34705541 AAGCCATTTTATAGATGAGGAGG - Intergenic
1125343028 15:38693386-38693408 AAGCGAATTTCCAGTACAGATGG - Intergenic
1126131454 15:45345893-45345915 ATGCCAATTTACAGGAGAGAAGG + Intergenic
1127728539 15:61776525-61776547 AATCCAATTTGAACAACAGAAGG - Intergenic
1128916376 15:71566698-71566720 AGGCCAATTTATAAACCAGGGGG - Intronic
1129585730 15:76862530-76862552 AAGCCTATGTATGGAAAAGATGG + Exonic
1130727238 15:86451995-86452017 GAGCCAATTCATTGAACAGCTGG - Intronic
1131691679 15:94834060-94834082 AAACCACATTATAGAATAGATGG - Intergenic
1133075515 16:3277611-3277633 AAGCCGATTTCCAGGACAGATGG + Intronic
1133674000 16:8052342-8052364 TAGTCAATTTATACAAAAGATGG - Intergenic
1135219505 16:20601683-20601705 AAGCCAAATTGCAAAACAGAAGG + Intergenic
1135528572 16:23232928-23232950 AAGGCAATTTTTAGAGCAGGAGG + Intergenic
1135541866 16:23336186-23336208 CAGCGAATTTAGAGCACAGAGGG - Intronic
1137766604 16:50982239-50982261 AACCCACTTTGTAGAAGAGACGG - Intergenic
1138785518 16:59841107-59841129 AGGACACTTTATAGAACAAAAGG + Intergenic
1139006635 16:62579601-62579623 AATTTCATTTATAGAACAGAGGG - Intergenic
1141338682 16:83181949-83181971 CAGCTAATTAATAGAAGAGATGG - Intronic
1144226820 17:13157222-13157244 GATCCAGATTATAGAACAGAGGG - Intergenic
1144262099 17:13531674-13531696 AAGCCAATTTATCAAAAATAAGG - Intronic
1145741707 17:27280385-27280407 CACCCATTTTATAGAACATATGG - Intergenic
1145748482 17:27338195-27338217 CAGCCAATTTTTAGTAGAGACGG - Intergenic
1146442436 17:32908929-32908951 AAGGCAATGTATAGATCAGCAGG + Intergenic
1148573449 17:48689664-48689686 AAGACAATTTGCAGAACAGAAGG + Intergenic
1150700702 17:67444590-67444612 AAGCAGATTAATAGAAGAGAAGG + Intronic
1151067322 17:71166234-71166256 AATCCAATTTAGAAAACAAAAGG + Intergenic
1153130515 18:1850977-1850999 AAAATAATTGATAGAACAGAAGG - Intergenic
1153988280 18:10372626-10372648 AAGCCAGTTTATGGAGCAGGAGG - Intergenic
1154301035 18:13192735-13192757 AAGCTAATTTTTAGTAGAGATGG + Intergenic
1157121053 18:44911568-44911590 TATCCAAGTTATAGAAAAGATGG + Intronic
1157466329 18:47949422-47949444 AAGCCAAAATGCAGAACAGAGGG + Intergenic
1158613025 18:58960502-58960524 CAGCCATTTCAGAGAACAGATGG + Intronic
1159642530 18:70880312-70880334 CAGCCAATTTTAAGCACAGATGG + Intergenic
1161260424 19:3334878-3334900 AAGACAAGGAATAGAACAGAGGG + Intergenic
1161982740 19:7638284-7638306 AAGCCAATTTGCAGAACTGGGGG + Intronic
1163072117 19:14852512-14852534 AATCCAGTCTATAGAACTGAGGG + Intergenic
1165900863 19:39168667-39168689 AAGCCACTTTAAAAAACAAAGGG - Exonic
925947929 2:8883121-8883143 AATCCAATTTAAAGACCAAAGGG + Intronic
926039788 2:9663880-9663902 AGGCCAATTCAGTGAACAGATGG - Intergenic
927394512 2:22634227-22634249 ATGACAATGTATAGAACACAGGG + Intergenic
927514446 2:23663589-23663611 AAGCCCATTTGGAGAAAAGAAGG - Intronic
928414693 2:31082481-31082503 AAGCCAGTTTCTAGAACCAAAGG + Intronic
929088470 2:38191931-38191953 AAGCCACTTTATAGGCCAAATGG + Intergenic
930174917 2:48292185-48292207 AAGCCAATTTTTACAACATGTGG - Intergenic
930848487 2:55932077-55932099 AAGCCATTTTATATCACACATGG - Intergenic
930876624 2:56225882-56225904 AAGCATCTTTATATAACAGAAGG - Intronic
931080821 2:58768499-58768521 AAGCAGCTTTATAGAACAGGGGG - Intergenic
935949569 2:108316524-108316546 AGGTCAATTTATAAAAAAGAAGG + Intergenic
937502918 2:122502514-122502536 AAGTTGAATTATAGAACAGATGG - Intergenic
938673748 2:133609885-133609907 AAGGCAATTAGTAGAAAAGAGGG + Intergenic
938849563 2:135246935-135246957 AAGCCAGTTATTAGAACTGAAGG + Intronic
939144956 2:138402306-138402328 AAGCCACTATAGAGAACAGTTGG + Intergenic
939450662 2:142369699-142369721 AAGCTATATTATAGAGCAGATGG - Intergenic
940629430 2:156219284-156219306 AAGTAAATTGATAGAAGAGAAGG - Intergenic
941194463 2:162431192-162431214 AAGCCAAGTTGTAGAAAACAAGG - Intronic
941363018 2:164576387-164576409 AAACCAATTTCTTAAACAGAAGG - Intronic
942867507 2:180692987-180693009 CAGCCAATTTTTAGTAGAGATGG - Intergenic
944364779 2:198905229-198905251 AAGCCAATTCATATCACTGAAGG - Intergenic
945534570 2:210998798-210998820 AAGTCTATTTTTAGAAAAGAGGG - Intergenic
945559804 2:211325806-211325828 AAAAAAATTTATAGTACAGATGG - Intergenic
945854728 2:215055363-215055385 AAGCGAATTTTTAGAAAAGAGGG - Intronic
946090895 2:217222309-217222331 AAGTCAATTTATAGGTCAGATGG - Intergenic
946831378 2:223731555-223731577 CAGGCAATTTATAGAAGACATGG - Intergenic
1169704143 20:8483780-8483802 AAGCCAGTTTAAAGATCAAATGG - Intronic
1169899094 20:10534863-10534885 AAGATAATTTTTAGAGCAGAAGG + Intronic
1173378646 20:42515057-42515079 AAGCTAATCTATAGATCCGATGG - Intronic
1174231903 20:49052498-49052520 TGGCCAGTTTGTAGAACAGAAGG + Intronic
1174249706 20:49209386-49209408 AAGCCAATTTATTGATCAGGTGG - Intergenic
1174268207 20:49347333-49347355 CAGCCTATTTACAGGACAGAAGG - Intergenic
1174867363 20:54150494-54150516 CAGCTAATTTTTAGTACAGATGG + Intergenic
1175100048 20:56572845-56572867 AAGACAATTAAAAGAACAGCTGG + Intergenic
1179037231 21:37768919-37768941 AAGGGAATTTATAGCTCAGATGG + Intronic
1181773491 22:25143526-25143548 ATGACAATTTATAGAAAGGAAGG - Intronic
1183127996 22:35803860-35803882 TATCCAATCTAAAGAACAGAAGG + Intronic
1183760130 22:39808789-39808811 AAGTCAATTAAAAGACCAGAAGG - Intronic
1184463195 22:44651883-44651905 AAGACAAGTTTTAGAACAGCGGG - Intergenic
949164332 3:920118-920140 AAGTCAAATTAAAGTACAGAGGG + Intergenic
950759659 3:15209982-15210004 AAGCCAATTTAAAAAACTGCTGG - Intronic
956491257 3:69774575-69774597 AAGCCAGTTAACAGAACACAAGG - Intronic
957121080 3:76093762-76093784 AAGCCACCTTATAGAAAACATGG + Intronic
958148903 3:89663737-89663759 GATACAATTTATAGAACAAAGGG - Intergenic
958449315 3:94253999-94254021 AACCCAATTTATAGTCCAAAGGG - Intergenic
959344807 3:105180322-105180344 AAGATAATTTATAGAATAGTTGG + Intergenic
959349303 3:105240632-105240654 AAACCAACTTTTAGAACAAATGG - Intergenic
960481597 3:118197939-118197961 AAGGCAAGTTTTAGAGCAGAAGG - Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964960902 3:162424265-162424287 AACCCAACTAATGGAACAGAAGG - Intergenic
965847170 3:172977085-172977107 AAACAAATGTATAGGACAGAAGG + Intronic
966286712 3:178305558-178305580 TAACCAATTTATAGAAAACACGG + Intergenic
967398236 3:189030785-189030807 AAGCTAATTCATAGAATTGAAGG - Intronic
967579790 3:191138435-191138457 AAGTCTATGTAGAGAACAGAAGG + Intergenic
968743803 4:2346832-2346854 AAGCCAATTAATAAAAAAGAAGG + Intronic
970189223 4:13495095-13495117 AAGACAATTTATTGAAAAGAGGG - Intergenic
971098329 4:23434195-23434217 TAGCCACTTTATAAAAAAGATGG - Intergenic
972773272 4:42218286-42218308 ATGCCAATTAAAGGAACAGAAGG - Intergenic
973940084 4:55898647-55898669 ATGCCCATATATAGAAGAGAGGG - Intronic
974894162 4:67918645-67918667 AAGACAATATAGAGAAAAGAAGG + Intronic
975026290 4:69552492-69552514 AATCCTAATTATAGATCAGAAGG + Intergenic
975191982 4:71475009-71475031 AAGCCAATATTTTGAACAGCTGG - Intronic
977580442 4:98718891-98718913 TAGCAATCTTATAGAACAGAGGG + Intergenic
977636931 4:99309853-99309875 AAGACACTTAATAGAACAGCTGG + Intronic
978030357 4:103934123-103934145 CAGCCGATTTAGAGAAAAGAAGG + Intergenic
978863184 4:113475924-113475946 AGGCCAATTTACAAAACATATGG + Intronic
979480552 4:121211650-121211672 AAGCCAGTTAATATAATAGAAGG - Intronic
980621054 4:135304388-135304410 AGGACAATTTATATATCAGAGGG + Intergenic
980671364 4:136010984-136011006 TAGCCAAATTAGACAACAGAAGG + Intergenic
980715829 4:136627414-136627436 AAGACATTTTATAGAACAGGAGG - Intergenic
981239048 4:142452467-142452489 AAGCCCTTTCAAAGAACAGATGG - Intronic
984080060 4:175237494-175237516 AAGCCAATATTTATAAAAGAAGG - Intergenic
986448517 5:7844380-7844402 AAGCCAATTTTTAAAACAAAGGG - Intronic
989609673 5:43278958-43278980 ATACCAAGTAATAGAACAGATGG + Intronic
990088737 5:52013656-52013678 AAGGCAATTTGTAGGAGAGAGGG - Intronic
990850034 5:60193025-60193047 AAGCCAAGTTGGAAAACAGATGG + Intronic
992670741 5:79058238-79058260 AAGCCAATATATAAAAGAAAGGG - Intronic
993132944 5:83922102-83922124 AAGCAAATTGAAGGAACAGAAGG - Intergenic
993560916 5:89407249-89407271 AAGGCTATTTAGAGAACACATGG + Intergenic
993588877 5:89768495-89768517 AAGCCAATTTATGGAATTTATGG - Intergenic
997059309 5:130481638-130481660 CATGCAATTTATAGACCAGATGG + Intergenic
997166568 5:131666366-131666388 AACCCAATTACTAAAACAGAGGG + Intronic
997317287 5:132947841-132947863 AAGACAATATTTAGCACAGAAGG + Intronic
998554287 5:143107966-143107988 AAGGCAATAAATATAACAGAAGG + Intronic
1001496368 5:172190085-172190107 ATGGAAATTTATAGAACACAGGG - Intergenic
1002798722 6:500212-500234 AAGTCAAGTTATTGAGCAGAAGG + Intronic
1004380676 6:15129665-15129687 AGGCCAATTTATAGGAGAAAAGG - Intergenic
1005106981 6:22234269-22234291 AAGGCAAATTTCAGAACAGAGGG - Intergenic
1005115006 6:22326459-22326481 AAGCCAATGTGGAGAAGAGAGGG + Intergenic
1005695854 6:28352151-28352173 GAGGCATTTTATAAAACAGAAGG - Intronic
1006729154 6:36222711-36222733 AAGCCAATAAAAAGCACAGAAGG - Intronic
1007852830 6:44821922-44821944 AAGCCAAGTTATAGAATGCAGGG - Intronic
1008078137 6:47167322-47167344 AAGCCAACTAGTAGAATAGATGG - Intergenic
1009558057 6:65200702-65200724 AGAGCAATTTAAAGAACAGAGGG - Intronic
1010079372 6:71841126-71841148 AAGGCAATTTATGGATCATATGG + Intergenic
1012488552 6:99750906-99750928 AATACAATTTATACAACTGATGG - Intergenic
1012954289 6:105552323-105552345 AAAGCAATTTATAGAAATGAAGG + Intergenic
1013020755 6:106214806-106214828 AAGCCCATTTACAGAACAAATGG + Intronic
1013527283 6:110986263-110986285 AAGCCAATTAAAAGGACTGATGG - Intronic
1013796519 6:113895124-113895146 AAGCCACTGAATATAACAGATGG + Intergenic
1014206338 6:118659994-118660016 ATACCAACTTTTAGAACAGATGG + Intronic
1018463611 6:164022219-164022241 ATGCGAATTTATAGATGAGAAGG + Intergenic
1020938362 7:14497820-14497842 AAGCCATCTCCTAGAACAGAAGG - Intronic
1021644268 7:22772701-22772723 AAGCCCTTTTAAAAAACAGATGG + Intergenic
1023574669 7:41614063-41614085 AAGGGAATTAAGAGAACAGATGG - Intergenic
1025105034 7:56163526-56163548 AAGCCCATTGATAGATCAGGAGG + Intergenic
1027680417 7:81213692-81213714 AAGCCATTTTAAAGAAAGGAAGG + Intergenic
1027725442 7:81799717-81799739 AAGCCACTTTATAAATAAGATGG + Intergenic
1028016652 7:85723011-85723033 AAGCCAACTTCGAGGACAGAAGG + Intergenic
1029019462 7:97349045-97349067 TAGCCAATTTCTAGAACTTAGGG - Intergenic
1029318785 7:99738804-99738826 CAGCTAATTTTTAGTACAGATGG + Intergenic
1029323715 7:99787784-99787806 CAGCTAATTTTTAGTACAGATGG + Intergenic
1029782204 7:102746304-102746326 AAGCTAATTTTTAGCAGAGATGG + Intergenic
1030722215 7:112883807-112883829 AAGCGAATTTGTAAAATAGAAGG - Intronic
1032014117 7:128365827-128365849 AAGAAATTTTCTAGAACAGAAGG + Intergenic
1033047044 7:137971759-137971781 AAGCCAACTTATTTAAAAGAGGG + Intronic
1033068768 7:138182205-138182227 AAGCCAATTTCCAGATCAAAAGG + Intergenic
1033410157 7:141110055-141110077 AATCCAATTTATAGGAAAAAAGG + Intronic
1034789357 7:153954076-153954098 AAGGCATTTTATAGAAGCGATGG - Intronic
1035687831 8:1538669-1538691 AATCCAATTCCTAGAAAAGAGGG - Intronic
1037322077 8:17653645-17653667 AAGGCCATTTTGAGAACAGATGG - Intronic
1038005720 8:23428158-23428180 ATGCCAATTCATAGGACAAATGG + Intronic
1039625278 8:39044021-39044043 AAGCCAAGTTATGGAATAGGGGG - Intronic
1040068883 8:43173158-43173180 AAAACAATTTTTAGTACAGATGG + Intronic
1041712412 8:60906446-60906468 AAGTCTATTGATAGAACAGGAGG + Intergenic
1042499218 8:69490480-69490502 AAGTCACTCTATAAAACAGATGG + Intronic
1045800030 8:106091711-106091733 AAGAGAATTTATAGAAGAGAAGG + Intergenic
1046430308 8:114115819-114115841 AATCAAATTTCTAAAACAGAAGG - Intergenic
1047332432 8:123903811-123903833 AAGGCAAATTATAGCACAAAAGG + Intronic
1047614219 8:126549854-126549876 AAGACAACCTCTAGAACAGAAGG - Intergenic
1047868428 8:129055505-129055527 TAGCCCATTTCTAGAACAGTGGG - Intergenic
1048137119 8:131757261-131757283 TATTCAATTTATAGAAAAGAAGG + Intergenic
1048535384 8:135289613-135289635 AAACAAATTCATAGAACAGTGGG - Intergenic
1051122051 9:13762003-13762025 AGCCCACTTTATAGCACAGAAGG - Intergenic
1051572144 9:18571105-18571127 AACACAATTTATTGAACAGAGGG + Intronic
1052715731 9:32114844-32114866 AAGACAATTTTTTGCACAGACGG + Intergenic
1053256146 9:36617078-36617100 AAGAAAATTTCTAGAACAGTTGG + Intronic
1053568912 9:39283983-39284005 AAACCAATTTACAGAAAACATGG + Intronic
1053834881 9:42125018-42125040 AAACCAATTTACAGAAAACATGG + Intronic
1054090546 9:60842948-60842970 AAACCAATTTACAGAAAACATGG + Intergenic
1054111957 9:61118505-61118527 AAACCAATTTACAGAAAACATGG + Intergenic
1054128232 9:61335025-61335047 AAACCAATTTACAGAAAACATGG - Intergenic
1054595656 9:67062511-67062533 AAACCAATTTACAGAAAACATGG - Intergenic
1054783398 9:69187154-69187176 TCGCCTATTAATAGAACAGAAGG + Intronic
1055134622 9:72813918-72813940 AGGCCAATTTATAGATCAAGGGG + Intronic
1055661218 9:78505932-78505954 AAGCCAATTTCTGAGACAGAAGG + Intergenic
1056408024 9:86294993-86295015 AATTCAATTTATAGAAAATAGGG + Intronic
1058136016 9:101308341-101308363 AAGGCAACTTCTAGAACACATGG + Intronic
1058424643 9:104865842-104865864 AATGCCATTTATAGAAAAGATGG + Intronic
1058854956 9:109052474-109052496 AAGACTTTTCATAGAACAGATGG - Intronic
1059077666 9:111211176-111211198 AAGCCAATTTTAAAAAGAGATGG - Intergenic
1060026134 9:120173568-120173590 TAGCCACTTTATTCAACAGATGG + Intergenic
1060766382 9:126297382-126297404 AATCCACTTTATAAAACAGGTGG + Intergenic
1060913064 9:127366211-127366233 AAGCTAATTATTAGAAGAGAAGG + Intronic
1186207627 X:7216860-7216882 AAGCCATTTTCCAGAACACAAGG + Intergenic
1187570871 X:20500016-20500038 AGGTCAAGTTATAGATCAGAAGG - Intergenic
1188829362 X:34877542-34877564 CAGCCAATTTACACAACAGCTGG + Intergenic
1188896324 X:35672925-35672947 ATGACAATTTCTAGAATAGAGGG - Intergenic
1188916910 X:35922608-35922630 CGTGCAATTTATAGAACAGAAGG - Intronic
1192314218 X:70039457-70039479 ACGCCGATTTCAAGAACAGACGG - Exonic
1192857492 X:75028122-75028144 AACACAATTTATTGAAGAGATGG + Intergenic
1194198605 X:90927555-90927577 AAGCCATTTTAAAAAACAGTAGG - Intergenic
1194697386 X:97070749-97070771 AAGCCAAGTTATATAACACAAGG + Intronic
1194921352 X:99769739-99769761 AAGCCAAATTATAAAATGGAAGG + Intergenic
1195086579 X:101418897-101418919 ATGCGAGTTTCTAGAACAGAAGG - Intronic
1196938840 X:120755755-120755777 GAGCTAATTTAAAGAAAAGAGGG - Intergenic
1196974565 X:121144353-121144375 AACCCAAGTTATAAAACAGAGGG - Intergenic
1197235522 X:124058318-124058340 CAGCTAATTTTTAGTACAGACGG + Intronic
1198192853 X:134327677-134327699 ACCCAAATTTATAGAACACAGGG - Intergenic
1198207845 X:134485256-134485278 TAGACAATTTATAGAAGAGAAGG - Intronic
1201579453 Y:15495531-15495553 AAGCCATTTTCCAGAACACAAGG + Intergenic