ID: 920306014

View in Genome Browser
Species Human (GRCh38)
Location 1:205018579-205018601
Sequence CAGGGTAAACAGCAGGGGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920306003_920306014 9 Left 920306003 1:205018547-205018569 CCTGAGGGGCAGCTTATCACAGT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG 0: 1
1: 0
2: 2
3: 31
4: 319
920306002_920306014 17 Left 920306002 1:205018539-205018561 CCTGGACGCCTGAGGGGCAGCTT 0: 1
1: 0
2: 0
3: 13
4: 173
Right 920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG 0: 1
1: 0
2: 2
3: 31
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920306014 Original CRISPR CAGGGTAAACAGCAGGGGGT GGG Exonic
901131037 1:6962691-6962713 CAGGATAAAAGGCAGGGAGTGGG - Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902392986 1:16116905-16116927 CTGGGGAGACAGCAAGGGGTGGG - Intergenic
902469623 1:16639339-16639361 CAGGAGAGACAGCAGGTGGTAGG - Intergenic
902546497 1:17193742-17193764 CAGGCTGGAGAGCAGGGGGTGGG + Intergenic
902797134 1:18807224-18807246 CAGGGGAAGAGGCAGGGGGTAGG + Intergenic
903442800 1:23401137-23401159 CAGGCCAAACAGCAAGAGGTGGG - Intronic
903865207 1:26392774-26392796 GAGGGTAAAAAGAAGTGGGTGGG + Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904832878 1:33316593-33316615 CAGGGGCAACACCAGGGAGTTGG + Intronic
906092942 1:43198154-43198176 CAAAGAAAACAGTAGGGGGTGGG - Intronic
906662006 1:47589678-47589700 CAGGGTGAAAAGGAGGTGGTAGG + Intergenic
906964257 1:50441185-50441207 GAGGGTGAAGTGCAGGGGGTAGG + Exonic
907328896 1:53658750-53658772 CATGGTGCACAGCAGGAGGTAGG + Intronic
907808710 1:57846546-57846568 CAGAGTAAACAGCACAGAGTAGG - Intronic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
908342687 1:63198218-63198240 CATTGAAAACAGCAGAGGGTTGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911705361 1:101005661-101005683 CAGGGTGGAAGGCAGGGGGTTGG + Intronic
912913232 1:113784487-113784509 CACGGAAAAGGGCAGGGGGTTGG + Intronic
914045172 1:144085514-144085536 CAGGCAAATCAGCAGGGGATGGG - Intergenic
914132938 1:144875172-144875194 CAGGCAAATCAGCAGGGGATGGG + Intergenic
917176559 1:172242292-172242314 CAGGGTGAACAGCAAGGGGTGGG - Intronic
919250868 1:195054565-195054587 CAGGCCACACAGGAGGGGGTGGG - Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
920263603 1:204706259-204706281 CAGGGTACACAAGAGGGGGCTGG + Intergenic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920375697 1:205506672-205506694 AGGGGTTAACAGCAGGGGCTTGG - Intronic
921164145 1:212494056-212494078 TAGGCTAAACAGAAGGGAGTGGG - Intergenic
923032643 1:230262424-230262446 CACGGCACACAGCAGAGGGTGGG - Intronic
923339659 1:232996498-232996520 CAGAGTAAACAGCATGGGGTGGG + Intronic
924743862 1:246814633-246814655 AAGGGTCAAAAGCAGGCGGTGGG - Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065804285 10:29380676-29380698 CAGCGTAACCAGCAGGAGTTGGG - Intergenic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1066443948 10:35464713-35464735 CAGGGTTAAAGGCTGGGGGTGGG - Intronic
1066957288 10:42185207-42185229 CAGGCAAATCAGCAGGGGATGGG - Intergenic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1070136391 10:73697950-73697972 CAGGGGAGGCAGCAGGGTGTGGG - Exonic
1070472755 10:76800422-76800444 CAGAGAAAACAGCAGGGCTTTGG - Intergenic
1070569714 10:77631783-77631805 CAGGCCAAACAGCAGGGGGCAGG + Intronic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1072425976 10:95331249-95331271 CAGGGAAATCAGGATGGGGTGGG - Intronic
1072868425 10:99089115-99089137 CAGAGTAAACAGCATAGAGTGGG - Intronic
1073268223 10:102241137-102241159 CAGGGTAAGAACCAGGGGATAGG - Intronic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1073634126 10:105179933-105179955 CAGGGTTAACAGTAAGGGGAAGG - Intronic
1076644515 10:131943468-131943490 CAGGGTGCACAGCAGGGTGCTGG - Intronic
1077541780 11:3150092-3150114 CAGGGGAAACAGCTGCTGGTTGG - Intronic
1078082334 11:8213259-8213281 CAGGGCAGACAGCAGGGGTGAGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1082952989 11:58837903-58837925 AAGTGTCAACAGCAGAGGGTAGG - Intronic
1083576704 11:63797120-63797142 CTGGGTACACAGCAGGTGATGGG - Intergenic
1083608897 11:63995771-63995793 CAAGGTCATCAGCTGGGGGTAGG + Intronic
1084714602 11:70865603-70865625 CAGGCTCAGCAGCAGAGGGTGGG + Intronic
1084965223 11:72741124-72741146 CATGGTAAACAGGAAGGAGTTGG - Intronic
1089353467 11:117834687-117834709 CAGGTTACACAGCTGGGGGATGG - Intronic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1089997459 11:122922509-122922531 CAAGGTAAACAGCAGAGGGGAGG + Intronic
1090398713 11:126435182-126435204 GAGGGAACCCAGCAGGGGGTAGG - Intronic
1091818901 12:3459700-3459722 CAGGGAGAAGGGCAGGGGGTTGG + Intronic
1092060736 12:5548331-5548353 CAGGCAAAGCAGCAGGGGGTTGG + Intronic
1092203483 12:6601628-6601650 CAGGTAAAACAGAAGGGGTTTGG - Exonic
1092385605 12:8033574-8033596 CCGGGTAACAAGCAGGGTGTGGG + Exonic
1093088982 12:14900516-14900538 CAGGGAAATCAGCTAGGGGTCGG + Intronic
1093092289 12:14935660-14935682 CAGGGTGAAGAGGAGGGAGTTGG - Intronic
1093920155 12:24850401-24850423 CAGGGTCTTCAGCAGGTGGTAGG + Intronic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1095562973 12:43587459-43587481 CAGGGGAAACCACAGGGGGTGGG - Intergenic
1095825517 12:46526437-46526459 GAGGGGACAGAGCAGGGGGTAGG - Intergenic
1097841523 12:64326207-64326229 CAGGGTAGAGAGGAGGGGGGTGG + Intronic
1098213167 12:68187424-68187446 CAGGGTAGACAGCAGAGAGTTGG + Intergenic
1098307042 12:69112794-69112816 CATGGTAAACAGCAGAGAGTGGG + Intergenic
1099194409 12:79598201-79598223 CAGTGCAAACATCAGGAGGTAGG + Intronic
1099528085 12:83740826-83740848 GAGGGCAAACAGAAGAGGGTGGG + Intergenic
1101577716 12:106013550-106013572 CTGGGTAAAAAGGAGGGGCTGGG - Intergenic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1105600748 13:21884842-21884864 CAGGACAAACAGGAGGGGGGTGG + Intergenic
1106229356 13:27809809-27809831 CAGAGTTCTCAGCAGGGGGTTGG + Intergenic
1106502829 13:30345859-30345881 AAGGGTGAACACCAGGAGGTGGG + Intergenic
1111420120 13:88000336-88000358 CCTGGTGAAGAGCAGGGGGTTGG + Intergenic
1112753336 13:102604052-102604074 CAGTGTGAACAGCTGGGCGTGGG + Intronic
1113582741 13:111440448-111440470 CAGGGGAAGCTGCAGGGGGCAGG - Intergenic
1113901260 13:113799468-113799490 CAGGGAAAACCGCGTGGGGTCGG - Intronic
1113914198 13:113861230-113861252 CAGGGGAAACAGCCAGGGCTGGG + Intronic
1115665591 14:35541721-35541743 CAAGGTAAACAGCAATGGGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116931495 14:50695343-50695365 CTGGGTAACAGGCAGGGGGTTGG - Intergenic
1121500629 14:94434083-94434105 CTCGGTAACCAGCAGGGGGCAGG + Intergenic
1122283274 14:100636741-100636763 CAGGGGAAGGAGCAGGGAGTGGG - Intergenic
1122360335 14:101156247-101156269 CAGTATCAATAGCAGGGGGTAGG - Intergenic
1122431542 14:101651630-101651652 CATGGTAAACAGCATGCAGTTGG - Intergenic
1122713713 14:103680188-103680210 CTGGATAAACAGCAGTGGTTAGG - Intronic
1202935812 14_KI270725v1_random:86573-86595 CAGGCAAATCAGCAGGGGATGGG + Intergenic
1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123614994 15:22137541-22137563 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1127211344 15:56777816-56777838 CAGGCTGAAGAGCATGGGGTGGG - Intronic
1127315499 15:57790678-57790700 CAGGGTCAAGAGCAGGGGAATGG - Intergenic
1127914754 15:63446207-63446229 CAGGGGGAACAGCAATGGGTGGG + Intergenic
1128704151 15:69826308-69826330 CAAGGGAACCAGCAGGTGGTTGG - Intergenic
1128780737 15:70357169-70357191 CAGGGAACAGAGGAGGGGGTGGG + Intergenic
1129200100 15:73993585-73993607 CAGGGTGGAGAGCAGGGGTTGGG - Intronic
1129239479 15:74242978-74243000 CAGGGAAGACAGCAGGGAGGAGG - Intronic
1129342055 15:74892568-74892590 GAGGGTGGACAGCAGGGGCTAGG + Intronic
1129652262 15:77499471-77499493 CAGGGTAAAGAGCTGGGGAGAGG - Intergenic
1130717063 15:86345308-86345330 GAGGTTAAACACCAGGGGGATGG - Intronic
1131419691 15:92295004-92295026 CAGGGTAAACAGCTTCGGATTGG + Intergenic
1131905689 15:97139526-97139548 CAGTGTAAACAGCAGGGGCCAGG - Intergenic
1202987239 15_KI270727v1_random:429304-429326 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1132478557 16:154279-154301 CAGGGTGACCAGCAGGCAGTGGG - Exonic
1132480735 16:165035-165057 CAGGGTGACCAGCAGGCAGTGGG - Intronic
1132519077 16:379131-379153 CAGTGGACACAGCAGGGGGCGGG + Intronic
1133616869 16:7485364-7485386 CAAGGTAAACTGCAGAGGATGGG - Intronic
1133832102 16:9332866-9332888 CTGGGTTAACATCAAGGGGTAGG + Intergenic
1133901958 16:9984434-9984456 CAGGGTAAACTCCAGGGCATTGG - Intronic
1136275665 16:29177963-29177985 CAGGGGAAACAGCGCAGGGTCGG + Intergenic
1136379434 16:29885596-29885618 AAGGCTTAACAGCAGGGGATTGG + Exonic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1139582189 16:67880292-67880314 CAGGATCAGCAGCAGGGGGCTGG - Intronic
1141403820 16:83774046-83774068 CAGAGATAACAGCAGGGGGCTGG - Intronic
1141850287 16:86640458-86640480 CAGCCCAGACAGCAGGGGGTTGG + Intergenic
1142660806 17:1428028-1428050 CTGTGTTAACAGCAAGGGGTGGG - Intronic
1143040692 17:4034035-4034057 CAGGCTAAAGAGCAGGTGGGTGG + Exonic
1144092210 17:11868245-11868267 CAGTTTAAAAAGCAGGTGGTGGG - Intronic
1144952394 17:19001248-19001270 CAGGGCAGAAAGCAGGGGCTTGG + Intronic
1147250420 17:39149903-39149925 CAAGGTAAACAGGAGAGAGTTGG - Intronic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1147420390 17:40319532-40319554 TGGGGTAAGCAGCAGGGGGTGGG - Intronic
1149686546 17:58538817-58538839 CTGGGTGAACAGCTGGGGATGGG - Intronic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1150585290 17:66512102-66512124 GAGGGTAAACTGTAGGGGATGGG - Intronic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151497460 17:74467205-74467227 CAGGGTACGGAGGAGGGGGTGGG + Intronic
1151516351 17:74598637-74598659 GAGGGAACACAGCAGGGAGTCGG + Intergenic
1151765324 17:76130769-76130791 CAGGGTGAACCGGAGGGTGTGGG - Intergenic
1152100592 17:78299579-78299601 CTGGCAAAAGAGCAGGGGGTTGG - Intergenic
1152125045 17:78441483-78441505 CAGGGTCAACTGCGGGGGGTGGG + Intronic
1152479349 17:80539694-80539716 CAGGGAGAAATGCAGGGGGTGGG - Intergenic
1152508817 17:80771577-80771599 CAGGGTAAACACCTGGGGCTGGG - Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1153730450 18:8006098-8006120 CAGGCTTAACAGCAGCGAGTTGG - Intronic
1154215858 18:12415694-12415716 CAGGGGAAGGAGCAGTGGGTGGG - Intronic
1155929330 18:31689442-31689464 CAGGGTAAATAGAAGAGGCTGGG + Intergenic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157597329 18:48871641-48871663 CAGGGTCAGCAGCAGGGCCTTGG - Intergenic
1157614393 18:48978136-48978158 CAGGGTCAGCAGCAGGGCCTTGG + Intergenic
1158480467 18:57817274-57817296 CAGGGCCAACATCAGGGAGTGGG + Intergenic
1158965262 18:62616863-62616885 CAGAGTAAGCAGCAAGGGCTAGG + Intergenic
1160935743 19:1593680-1593702 AAGGGGAGACAACAGGGGGTGGG - Intergenic
1161270674 19:3387789-3387811 GAGGGTGACCAGCCGGGGGTGGG + Intronic
1161286004 19:3468561-3468583 CAGGGCATACAGTGGGGGGTGGG + Intronic
1161331757 19:3691959-3691981 CAGGGAAAAGAGCCTGGGGTGGG - Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1164709269 19:30343864-30343886 GAGGGAAAACAGCAAGAGGTTGG + Intronic
1164927353 19:32140635-32140657 CAGAGTAAACAGCAGGTTCTGGG + Intergenic
1166322666 19:42028332-42028354 CAGGGTATACAGGATGGGTTGGG - Intronic
1167019591 19:46863321-46863343 CTGGGTAAATAGGTGGGGGTTGG + Intergenic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167510001 19:49890903-49890925 CAGGGAAAGTAGCAGGGAGTGGG - Intronic
1168292487 19:55363240-55363262 CAGGGTGGACAGCAGGGGTCTGG + Exonic
1202684730 1_KI270712v1_random:38918-38940 CAGGCAAATCAGCAGGGGATGGG - Intergenic
925032394 2:661013-661035 GTGGGTACACAGCAGGGAGTGGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
927929343 2:27034143-27034165 TAGGTTCCACAGCAGGGGGTGGG - Exonic
929033560 2:37671307-37671329 CTGGGAAACCAGCAGGGAGTCGG - Intronic
929611914 2:43277055-43277077 CAGGGAAATCAGCTGGGGGCTGG - Intronic
929681677 2:43998228-43998250 GGGGGTAGAGAGCAGGGGGTAGG + Intergenic
930578252 2:53178873-53178895 CAAGGTAAACTGCAGTGGTTTGG - Intergenic
931517276 2:63057371-63057393 CAGGGTACAGAGGTGGGGGTTGG + Exonic
932347027 2:71002162-71002184 GAGGATAAAGGGCAGGGGGTGGG + Intergenic
933009588 2:77042944-77042966 CAGGGTGAAGAGTTGGGGGTGGG + Intronic
933456303 2:82523983-82524005 CTGGGTAAAAAGCATGGTGTTGG - Intergenic
933827002 2:86171271-86171293 CAGGCTGAACTGCAGGGGCTGGG + Exonic
934231754 2:90190105-90190127 CAAGCAAAACGGCAGGGGGTGGG - Intergenic
934246988 2:90315928-90315950 CAGGCAAATCAGCAGGGGATGGG + Intergenic
934262337 2:91486675-91486697 CAGGCAAATCAGCAGGGGATGGG - Intergenic
934305387 2:91817664-91817686 CAGGCAAATCAGCAGGGGATGGG - Intergenic
934327869 2:92035084-92035106 CAGGCAAATCAGCAGGGGATGGG + Intergenic
934466260 2:94265623-94265645 CAGGCAAATCAGCAGGGGATGGG + Intergenic
935531624 2:104239618-104239640 CAGGGCAAAGAGCAGGGTATAGG + Intergenic
935848469 2:107192668-107192690 GAGGGTAACCACCAGGAGGTGGG + Intergenic
936920029 2:117678303-117678325 CACGGCACAAAGCAGGGGGTTGG + Intergenic
938293820 2:130164331-130164353 CAGGGTCAGAAGCAGGAGGTGGG + Intronic
938462724 2:131508631-131508653 CAGGGTCAGAAGCAGGAGGTGGG - Intergenic
939405879 2:141755012-141755034 AAGGAAAAACAGCAGAGGGTAGG + Intronic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
944063945 2:195599620-195599642 CATGGTAAACAGCTGAGGATGGG + Intronic
944502667 2:200378154-200378176 CTGAGTAATCAGCAGGGGGTTGG - Intronic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
946162046 2:217841303-217841325 CAGGGGAGCCAGCAGGGAGTGGG + Intronic
946507501 2:220317480-220317502 CAGGGTTAACAGTAGATGGTCGG - Intergenic
947711038 2:232315967-232315989 CCGGGTTACCAGTAGGGGGTAGG + Intronic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1170791211 20:19511051-19511073 CAGGGTCAGCAGCAGGGTGGGGG - Intronic
1170797984 20:19566392-19566414 CACAGGAAACAGCAGGGTGTGGG - Intronic
1171318050 20:24212824-24212846 TAGGGAAAACAGCAGGCAGTAGG + Intergenic
1173018438 20:39247621-39247643 GGGGGTAAACAGCAGGGGTGTGG - Intergenic
1173586376 20:44186488-44186510 CAGGGCAAACGGCATGGGCTGGG - Exonic
1174645958 20:52085512-52085534 CAGGTCAAACAGCAGGGATTTGG + Intronic
1175238894 20:57532028-57532050 CAGGAAAAACAGCTGGGAGTGGG + Intergenic
1175266547 20:57706877-57706899 CAGGGGAACCAGCAGTGGGTGGG + Intronic
1176931531 21:14817372-14817394 AAGGGTGCACAGCAGGGGATGGG + Intergenic
1178378240 21:32086114-32086136 GAGGATAAACAGCAGGTGGGAGG - Intergenic
1178635163 21:34296141-34296163 CTGGGCATACAGCAGGTGGTAGG + Intergenic
1178742153 21:35211491-35211513 GAGGGTAAGCAGCAAGGGGCTGG - Intronic
1180280160 22:10686249-10686271 CAGGGAAATCAGCAGGGGATGGG + Intergenic
1180587382 22:16904781-16904803 CAGGCAAATCAGCAGGGGATGGG + Intergenic
1180730026 22:17974210-17974232 CAGGGCAGACAGCAGGGTGGTGG - Intronic
1183327752 22:37203653-37203675 CAGGGTGCACAGTAGGTGGTCGG - Intergenic
1183704260 22:39467286-39467308 GAGGGTGAAGGGCAGGGGGTTGG + Intronic
1184075310 22:42173363-42173385 CAGGGTCAACATCAGGTGGGGGG + Intronic
1184899496 22:47435916-47435938 CAGGGTACGCAGCTGAGGGTTGG + Intergenic
1185128194 22:49023300-49023322 CAGGGTAGACAGGAGGGGAGAGG + Intergenic
950542207 3:13619382-13619404 CAGGGAAAAAAGCAGGGGAAGGG - Intronic
951557888 3:23938968-23938990 GAGCTGAAACAGCAGGGGGTTGG - Intronic
952794031 3:37223200-37223222 GGGGGTAAGCAGGAGGGGGTTGG + Intergenic
952817036 3:37454444-37454466 CAGGGTAAATGGTAGGGAGTGGG + Intronic
954129744 3:48554367-48554389 CAGGGTTCACAGCAGGGAGTGGG - Intronic
954299821 3:49694878-49694900 CAGGAGAGACAGCAGGTGGTAGG + Intronic
956523473 3:70131379-70131401 CAGGGAAAACCTCATGGGGTTGG - Intergenic
960095278 3:113683765-113683787 AAGGTTAAAAAGCAGGGGATGGG - Intronic
960545502 3:118910085-118910107 CAGAGTCAACAGAAGTGGGTAGG - Intronic
961682934 3:128611041-128611063 CAGGGTCCACAGCTGGGTGTGGG - Intergenic
963884627 3:150567529-150567551 CAGTGGAAAAAGCATGGGGTAGG - Intronic
964206315 3:154178878-154178900 CAGGGTGAAGGGCAGGGTGTAGG - Intronic
965732085 3:171782981-171783003 CATGGTAAAGAGCAGGGGATGGG + Intronic
968469294 4:771502-771524 CAGCGTCAACTGCAGGGAGTAGG + Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968934100 4:3601046-3601068 TAGGGAAACCAGCAGGGGCTGGG + Intergenic
969627009 4:8310794-8310816 CAGGGTCAAGAGGTGGGGGTGGG + Intergenic
970536838 4:17038573-17038595 CAGGGTCAATAGCTGGGAGTGGG + Intergenic
971819228 4:31530339-31530361 CCTGGTCAAGAGCAGGGGGTTGG + Intergenic
972573472 4:40330998-40331020 CAGGGTGAGCAGCAGGGGAATGG - Intergenic
974857366 4:67476706-67476728 CAGGGTAGGCAGCAAGGGGCAGG + Intronic
975538979 4:75484451-75484473 ATGGCAAAACAGCAGGGGGTGGG + Intronic
975662241 4:76699363-76699385 AAAGGTAAAAAGCAGGGGGAGGG - Intronic
976361270 4:84181534-84181556 CTGGGTAGACAACTGGGGGTTGG - Intergenic
977174183 4:93798951-93798973 CAGAGAAAAAAGCAGGGGGTAGG + Intergenic
978081103 4:104592734-104592756 CAGGGTAAATAGCAGGGAAGTGG + Intergenic
978102337 4:104857551-104857573 CAGGGGAAAGATAAGGGGGTGGG + Intergenic
978524631 4:109653023-109653045 TAGGGTAAAGAGCTAGGGGTGGG + Intronic
979783087 4:124680818-124680840 CAGGAGAAATAGCTGGGGGTAGG + Intronic
981081797 4:140644300-140644322 CGGGGTGGACAGCAGGGAGTGGG + Intronic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982054998 4:151539675-151539697 CAGGGCACTCAGCAGGGAGTGGG - Intronic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
986023669 5:3829008-3829030 GAGAGAAAACAGCAGGGGGCAGG + Intergenic
986203235 5:5598876-5598898 CACGCAAAACAGCTGGGGGTGGG + Intergenic
986264627 5:6181314-6181336 CAGGGGAACCACCAGGGAGTTGG - Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
990995411 5:61728125-61728147 TAGGGAAAACAACAGGGGTTAGG + Intronic
993140547 5:84027702-84027724 CAGGATAGACAGCAGGGAGTGGG + Intronic
993246518 5:85459337-85459359 AGTGGTAAAGAGCAGGGGGTTGG + Intergenic
993977145 5:94496502-94496524 CTGGTTAAAAAGCAGGGGGTGGG + Intronic
995335647 5:110996130-110996152 CAAGGTAAACTACAGGAGGTTGG - Intergenic
996336631 5:122390735-122390757 CAGGGTAAAAGGCAGGGCTTTGG - Intronic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
997526514 5:134556255-134556277 CATGGCAACCAGCGGGGGGTGGG + Intronic
997812011 5:136979575-136979597 CAGGGTCAGCAGCAGAGGATGGG + Intronic
998974275 5:147627074-147627096 TAGGGCAAAAAACAGGGGGTGGG + Intronic
999126735 5:149251568-149251590 CAGGGGAAAAGGGAGGGGGTGGG - Intronic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1001847802 5:174937286-174937308 CATGGCAAACAGCAGGTGCTGGG + Intergenic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1005440251 6:25859868-25859890 CAGGGTAAAAAGTAAGGGGGAGG - Intronic
1005763267 6:28987029-28987051 CAGGAGAAAGAGCAGGGGGGCGG + Intergenic
1008145591 6:47888054-47888076 CAGAGTAAAGAGCAGAGAGTAGG + Intronic
1010858334 6:80871795-80871817 CAGGGGAAAATGTAGGGGGTGGG + Intergenic
1012818083 6:104049858-104049880 CAGGGGAAAGGGTAGGGGGTGGG + Intergenic
1013437718 6:110128767-110128789 CAGGCTGTACAGCAGGAGGTGGG + Intronic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1015960005 6:138638754-138638776 CTGGGAAGACAGCAGAGGGTTGG - Intronic
1016307207 6:142696805-142696827 CAGGGTAAACAACCTGGGGCAGG - Intergenic
1017001192 6:149999016-149999038 CAGGGTACAGAGCCAGGGGTAGG - Intergenic
1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG + Intronic
1019497583 7:1347657-1347679 CAGGTTACACAGCAGGGTGCAGG - Intergenic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1022425198 7:30262003-30262025 CAGAGGAAACTGCAGTGGGTTGG + Intergenic
1023562634 7:41491658-41491680 CTGGGGAGACAGCAGTGGGTAGG - Intergenic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1026639621 7:72112958-72112980 AAGGGTAAACAGGCAGGGGTGGG + Intronic
1026987112 7:74561535-74561557 CGGGGTGAACGGCAGGGGTTGGG + Intronic
1027319434 7:77002826-77002848 CAGGGAGAGCAGCTGGGGGTCGG - Intergenic
1029441381 7:100588648-100588670 CAGGAGAAACAGCAGGGGTCAGG - Intronic
1030616858 7:111746295-111746317 CAGGCAAAATAGAAGGGGGTTGG + Intronic
1032467463 7:132155260-132155282 CAGGTTACACAGCAGGGAGGTGG - Intronic
1034529543 7:151687181-151687203 CAGGGCAGACAGCAGAGGCTGGG - Intronic
1035725938 8:1824659-1824681 CAGGGTAAACAGGTGGGGTGCGG - Intronic
1035953789 8:4053415-4053437 CATGATAAAAAGCAGGTGGTGGG - Intronic
1036215667 8:6877825-6877847 GAGAGTAAACAGCAGAAGGTAGG + Exonic
1037600584 8:20390646-20390668 CAGGGTAACCAGCATGGTGCAGG - Intergenic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1039231517 8:35453927-35453949 TAGGAGAAATAGCAGGGGGTAGG - Intronic
1039432126 8:37533161-37533183 CAGGGCTAAAATCAGGGGGTGGG + Intergenic
1041056101 8:53987988-53988010 CAAGCTAAGCAGCAGTGGGTGGG + Intronic
1041455126 8:58050829-58050851 CAGGGCATACACCAGGGGGTGGG + Intronic
1043152423 8:76734577-76734599 GTGGCTAAACAGCAGGGGTTTGG + Intronic
1047024850 8:120813235-120813257 GAGGGTAGACAGCAGTGGGAAGG - Exonic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048607315 8:135982896-135982918 GTGGATAAACAGCAGAGGGTGGG + Intergenic
1048829124 8:138458999-138459021 CAGGGAATACAGCAGAGGTTGGG + Intronic
1049684424 8:143933668-143933690 CTGGGCAATCAGCAGTGGGTTGG + Intronic
1050633375 9:7583585-7583607 AGGGGTAAACAGCAGGGGAAGGG + Intergenic
1051349402 9:16184930-16184952 CAGGGGTAACAGCAGGCAGTGGG + Intergenic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1051836258 9:21341479-21341501 CAGGGGAGACAGCAGGGCCTAGG - Intergenic
1053283204 9:36834937-36834959 CAGGTGAAACAGCAGGGTGGGGG - Exonic
1053696309 9:40642395-40642417 CAGGCAAATCAGCAGGGGATGGG + Intergenic
1054307560 9:63441623-63441645 CAGGCAAATCAGCAGGGGATGGG + Intergenic
1054439916 9:65251098-65251120 CAGGCAAATCAGCAGGGGATGGG + Intergenic
1054456053 9:65430933-65430955 TAGGGAAACCAGCAGGGGCTGGG - Intergenic
1054490490 9:65770841-65770863 CAGGCAAATCAGCAGGGGATGGG - Intergenic
1055552988 9:77448037-77448059 CAGGGTAAACTGCAGCTGATGGG + Intronic
1056549061 9:87636259-87636281 CAGGGGACACAGCAGGGCCTGGG - Intronic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057478524 9:95426173-95426195 CAGGGTGAGATGCAGGGGGTGGG - Intergenic
1058234836 9:102476964-102476986 CAGGGTACAGAGCAGGGAGTGGG - Intergenic
1059318552 9:113448156-113448178 CGGGGTAAAGATCAGGGGTTAGG - Intronic
1060051815 9:120383478-120383500 CAGAGGAAACAGCAGGGACTAGG - Intergenic
1061119287 9:128633351-128633373 CAGGGCAAGCAGCGAGGGGTGGG - Exonic
1061405976 9:130393306-130393328 CAGGGTATGGAGCAGGGGGTGGG + Intronic
1061619282 9:131800930-131800952 CAGGGTGCACAGCAGGCAGTGGG - Intergenic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1061940872 9:133883096-133883118 CAGAGAGAGCAGCAGGGGGTGGG - Intronic
1062206211 9:135338871-135338893 CAGGGTTAGCTGCAGGGGCTGGG - Intergenic
1202778757 9_KI270717v1_random:16056-16078 CAGGCAAATCAGCAGGGGATGGG + Intergenic
1203585834 Un_KI270747v1:2464-2486 CAGGCAAATCAGCAGGGGATGGG + Intergenic
1185532468 X:832905-832927 CATGGGAAAGAGGAGGGGGTTGG + Intergenic
1186457075 X:9718132-9718154 CTGGGTCACCAGCAGTGGGTAGG + Exonic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1188286214 X:28328041-28328063 ATAGGTAAACAGTAGGGGGTGGG + Intergenic
1190440287 X:50469790-50469812 CGGGGGTGACAGCAGGGGGTGGG - Intronic
1193701643 X:84769904-84769926 GAGGGTAAAAAGGAGGTGGTAGG - Intergenic
1194778304 X:97992227-97992249 CAGGGTAAAAGGCAGAGGTTGGG - Intergenic
1195067505 X:101250817-101250839 CAGGAGAACCAGCAGGGGCTGGG - Intronic
1195783610 X:108491653-108491675 CAAGCTAGAGAGCAGGGGGTGGG - Intronic
1196270462 X:113704552-113704574 CAGGGTGAACAGTTTGGGGTTGG + Intergenic
1197798381 X:130322418-130322440 CAGGGGAAAGAGGAAGGGGTTGG - Intergenic
1198394617 X:136208946-136208968 GAGGGTAGAAAGAAGGGGGTGGG + Intronic
1199087789 X:143648852-143648874 CAGGGTAAAGGGCAGTGGTTGGG + Intergenic
1201459042 Y:14202013-14202035 TAGGGAATACAGCAGGGAGTTGG - Intergenic