ID: 920308352

View in Genome Browser
Species Human (GRCh38)
Location 1:205033015-205033037
Sequence AGCCACAGGCTGCCAAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920308342_920308352 5 Left 920308342 1:205032987-205033009 CCTGCCCAGGGCCCCTAGCAGGT No data
Right 920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG No data
920308348_920308352 -8 Left 920308348 1:205033000-205033022 CCTAGCAGGTATAGGAGCCACAG No data
Right 920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG No data
920308344_920308352 0 Left 920308344 1:205032992-205033014 CCAGGGCCCCTAGCAGGTATAGG No data
Right 920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG No data
920308347_920308352 -7 Left 920308347 1:205032999-205033021 CCCTAGCAGGTATAGGAGCCACA No data
Right 920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG No data
920308346_920308352 -6 Left 920308346 1:205032998-205033020 CCCCTAGCAGGTATAGGAGCCAC No data
Right 920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG No data
920308340_920308352 15 Left 920308340 1:205032977-205032999 CCATTTGAGGCCTGCCCAGGGCC No data
Right 920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG No data
920308343_920308352 1 Left 920308343 1:205032991-205033013 CCCAGGGCCCCTAGCAGGTATAG No data
Right 920308352 1:205033015-205033037 AGCCACAGGCTGCCAAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920308352 Original CRISPR AGCCACAGGCTGCCAAGGAA GGG Intergenic
No off target data available for this crispr