ID: 920309697

View in Genome Browser
Species Human (GRCh38)
Location 1:205041860-205041882
Sequence CTGGAAAAGGAGAAGGAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 579}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920309697_920309706 6 Left 920309697 1:205041860-205041882 CCCGACTCCTTCTCCTTTTCCAG 0: 1
1: 0
2: 4
3: 55
4: 579
Right 920309706 1:205041889-205041911 TCATTCTGGCCCAGGTCCCCAGG 0: 1
1: 0
2: 0
3: 26
4: 207
920309697_920309710 22 Left 920309697 1:205041860-205041882 CCCGACTCCTTCTCCTTTTCCAG 0: 1
1: 0
2: 4
3: 55
4: 579
Right 920309710 1:205041905-205041927 CCCCAGGACCTCCTCCACTCAGG 0: 1
1: 0
2: 1
3: 28
4: 329
920309697_920309701 -8 Left 920309697 1:205041860-205041882 CCCGACTCCTTCTCCTTTTCCAG 0: 1
1: 0
2: 4
3: 55
4: 579
Right 920309701 1:205041875-205041897 TTTTCCAGACCCTCTCATTCTGG 0: 1
1: 0
2: 0
3: 17
4: 186
920309697_920309703 -2 Left 920309697 1:205041860-205041882 CCCGACTCCTTCTCCTTTTCCAG 0: 1
1: 0
2: 4
3: 55
4: 579
Right 920309703 1:205041881-205041903 AGACCCTCTCATTCTGGCCCAGG 0: 1
1: 0
2: 2
3: 43
4: 818
920309697_920309712 23 Left 920309697 1:205041860-205041882 CCCGACTCCTTCTCCTTTTCCAG 0: 1
1: 0
2: 4
3: 55
4: 579
Right 920309712 1:205041906-205041928 CCCAGGACCTCCTCCACTCAGGG 0: 1
1: 0
2: 1
3: 28
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920309697 Original CRISPR CTGGAAAAGGAGAAGGAGTC GGG (reversed) Intergenic
901584851 1:10280880-10280902 ATGGAAACTGAGAAGGAGTCAGG - Intronic
901909796 1:12447074-12447096 CTGGACAAGGAAGAGGAGTCAGG - Intronic
902237141 1:15064725-15064747 CCGGAAAATGTGGAGGAGTCTGG - Intronic
902409685 1:16205668-16205690 CTGGAAAATGGGGAGGACTCTGG + Intronic
903428603 1:23273864-23273886 CTGGAAGAGGAGGAGGAGATGGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903615469 1:24651508-24651530 CTGGAGCAGGGGAAGGACTCCGG - Exonic
903790439 1:25889436-25889458 CTGGAGAAGGAGTAGGTGTGGGG - Intronic
904244179 1:29174614-29174636 TTGGAAAAAAAAAAGGAGTCAGG + Intronic
905244562 1:36603571-36603593 TTGGATATGGTGAAGGAGTCTGG - Intergenic
905422700 1:37859395-37859417 ATGGAAACGGAGAAGGGGTGGGG + Intronic
905734422 1:40315975-40315997 CTGGCACAGTGGAAGGAGTCGGG - Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908534409 1:65065699-65065721 CTGGAAAAGCAAAAGGGGCCAGG + Intergenic
908780387 1:67685323-67685345 CTGGCACAGGAGGAGGAGCCCGG + Exonic
909736285 1:78966638-78966660 CTGGAAGAGGAGGGGGAGTGAGG - Intronic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910214796 1:84832450-84832472 ATGGAATAGGCGAATGAGTCAGG + Intronic
910581437 1:88829960-88829982 TTGGAAAAGGAGGAGAAGTATGG + Intronic
912402303 1:109405108-109405130 CGTGAAAAGGAGAGGGAGTAGGG + Intronic
912774968 1:112500988-112501010 CTGGAAAAGGAAGAGGACACTGG - Intronic
913714402 1:121519388-121519410 CTGGAGGAGGAGAAGCAGCCGGG - Intergenic
914398884 1:147297267-147297289 CTGGGAAAGTAGAATGAGACAGG + Intergenic
915723081 1:157998236-157998258 CTGGCAAAGGAGAAGGGTGCAGG - Intronic
915976684 1:160395664-160395686 CTGGAGAAGGCGAATGAGTTGGG + Intergenic
917729699 1:177862371-177862393 CTGAAAGAAGAGAAGGAGTGAGG - Intergenic
919126217 1:193396392-193396414 ATGGAAAAAGAGAAGGCGTCAGG - Intergenic
919235761 1:194839973-194839995 GTGGAAAAAAAAAAGGAGTCAGG + Intergenic
919776812 1:201199586-201199608 CTGAAAAAGGAGCAGGAATGAGG - Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
921127802 1:212193451-212193473 CTGGAAAAGGAAAATGTGTGTGG - Intergenic
921151738 1:212408284-212408306 CTGGCACAGGAGAAGCAGTCAGG + Intronic
921614496 1:217250479-217250501 CTAGAAAAGGAGAGAGAGTGTGG + Intergenic
921673726 1:217954160-217954182 GTAGGAAAGGAGAAAGAGTCAGG - Intergenic
922029166 1:221781420-221781442 CTGGGAAAGGAGGAGAAGCCGGG + Intergenic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
923761639 1:236850938-236850960 CTGGAAAAGGAGAGACAGACGGG - Intronic
923877206 1:238062253-238062275 CTGGAAAAGGAGATGATTTCAGG - Intergenic
1062952653 10:1516261-1516283 CTGGGAAAGGAGAGGGCCTCGGG - Intronic
1063068639 10:2636660-2636682 CTAGATAAGGAAAGGGAGTCTGG - Intergenic
1063134872 10:3207828-3207850 CTCGCAAAGGTGAAGGACTCAGG - Intergenic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063344244 10:5296374-5296396 CTGCAACAGGAGAAGGAAGCTGG - Intergenic
1063358543 10:5427419-5427441 ATGGAGAAGGAGAAGAAGTGGGG - Intronic
1063518818 10:6722514-6722536 ATGCAAAAGGAGAAAGATTCAGG + Intergenic
1063698054 10:8356681-8356703 ATGGTAAAGGAAAAGGAGTTAGG - Intergenic
1063721679 10:8588658-8588680 CCGGCAAAGGAGAAAGAGGCAGG + Intergenic
1064225594 10:13481613-13481635 CTGGCATAGTAGAAGGAGCCAGG - Intronic
1064605445 10:17034174-17034196 GTGGAAAAGGGGAAGGAATAAGG + Intronic
1065514803 10:26514651-26514673 CTGTAAAAGGGAAAGGTGTCTGG - Intronic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1066442695 10:35454090-35454112 CAGGAAAAGTAAAAGCAGTCAGG - Intronic
1069058530 10:63869607-63869629 CTGGAAGAGGGGATGGAGACTGG - Intergenic
1069138195 10:64791454-64791476 CTGGAAAAGGAGAAAATGGCAGG + Intergenic
1069757466 10:70782001-70782023 CTGAAACTGGAGAAGAAGTCAGG - Exonic
1069818506 10:71213320-71213342 CTGGAAGGGGTGTAGGAGTCAGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1070912853 10:80133278-80133300 CTGGCAAGAGAGAAGGAGCCAGG + Intronic
1071089382 10:81901043-81901065 GTGGAAAAGGAGAGAGAGTAGGG - Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072914691 10:99530717-99530739 CTGGAAAAAGAAAAGGAGAAAGG - Intergenic
1073081000 10:100860696-100860718 TGGGAGAAGGAGATGGAGTCAGG + Intergenic
1073491336 10:103855319-103855341 CTGGAGAAGGAGCCGGAGCCCGG - Exonic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074315966 10:112362058-112362080 CTGGAGAGGGCGGAGGAGTCAGG - Intergenic
1074631846 10:115265533-115265555 CTGGAAAAAGAAAAGAAGGCAGG - Intronic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1074745287 10:116525811-116525833 CTGTAAATAGAGAATGAGTCTGG + Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1076439513 10:130471447-130471469 CTGGTAAATGAAGAGGAGTCAGG + Intergenic
1076729596 10:132431784-132431806 CTGGAGAAGGAGAAATATTCTGG + Intergenic
1076874056 10:133207374-133207396 CCGGAAAAGGAGACGTAGCCCGG + Intronic
1077379305 11:2221448-2221470 CTGGAAATGGTCAAGGGGTCAGG - Intergenic
1077634373 11:3832032-3832054 CTGGAAAAGGATGATGAGTATGG + Intronic
1079902077 11:26199227-26199249 CTGCAAAAGGATATGGAGTCAGG - Intergenic
1081650294 11:44819100-44819122 CTGGATCTGGGGAAGGAGTCAGG + Intronic
1082645865 11:55724204-55724226 TTTGAAAGGGAGAAGGAATCAGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083389204 11:62335753-62335775 GTGGGATAGGAGAAGGAATCTGG - Intergenic
1083478334 11:62928001-62928023 CCAGAAGAGGAGAAGGAGGCAGG - Intergenic
1083575637 11:63789092-63789114 CTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1084045305 11:66564649-66564671 CTGGAGGTGGAGAAGGAGTAGGG + Intronic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085789045 11:79480184-79480206 CTGGGAAAGAAGAAGAACTCTGG + Intergenic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1088405963 11:109479359-109479381 CTTCAAAAGGAGAAAGAGTTGGG - Intergenic
1089396956 11:118142408-118142430 CTGGAAAAGGCGATAGAGTGGGG - Intronic
1089407041 11:118206318-118206340 CTGGAAAAGGGGAAAGAGAAAGG - Intronic
1089993896 11:122886498-122886520 ATGGAAAAGGATGTGGAGTCAGG + Intronic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090817195 11:130308883-130308905 CTAGTAAGGGAAAAGGAGTCAGG + Intronic
1091370779 11:135056331-135056353 CTAGACAAGGAGATGGGGTCAGG - Intergenic
1091680266 12:2521999-2522021 CTGGAAAACAAGATGCAGTCTGG - Intronic
1092197367 12:6557362-6557384 CTGGAAAAGCCGAAGGGATCAGG - Exonic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1092646391 12:10578530-10578552 ATAGAAACAGAGAAGGAGTCAGG + Intergenic
1092652802 12:10652980-10653002 CTGAAATAGGGAAAGGAGTCAGG + Intronic
1093838958 12:23872434-23872456 CTGGGAAATGGGAAGCAGTCTGG - Intronic
1093844436 12:23951290-23951312 GTGGAAAAGAACAGGGAGTCTGG - Intergenic
1094139006 12:27161248-27161270 TTGGAAGATGAGGAGGAGTCTGG + Intergenic
1095864403 12:46955856-46955878 CTGGAAAAGGAGAGGATTTCGGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098740981 12:74172777-74172799 CTAAAAAAGGAGGTGGAGTCTGG - Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1100066364 12:90650527-90650549 CTGGATATGAAGGAGGAGTCTGG - Intergenic
1100274646 12:93061152-93061174 CTGGAAAACAAGAAGAACTCAGG + Intergenic
1100570930 12:95842367-95842389 CGGGAAAGGGAGAGGGAGACGGG + Intergenic
1100901381 12:99244805-99244827 CTGGTAAAGGAGCAGGTTTCAGG + Intronic
1101064533 12:101005920-101005942 CTGGAAGAAGAGGAGGAGGCAGG - Intronic
1101847387 12:108373412-108373434 CTGGAAAATGAGAAGCAGACAGG - Intergenic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1102733722 12:115138420-115138442 CTGGATAAGTCAAAGGAGTCCGG - Intergenic
1103344782 12:120241964-120241986 GTGGATATGGAGAAGGAGTGAGG + Intronic
1103488974 12:121302241-121302263 CTGGGAAAGGAAAAGAAATCTGG + Intergenic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1104041666 12:125134771-125134793 CTGGAAAGAGAGAAGAGGTCAGG - Intronic
1104410153 12:128551068-128551090 CTGGAAAGGGAGAAGGGGAGAGG - Intronic
1104950988 12:132439927-132439949 CCGGAAATGGAGAAGGTGGCTGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105891847 13:24687718-24687740 GTGGAAAAGGAGCAGGCGTAAGG + Intronic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106480913 13:30136145-30136167 GTGGGAATGGAGAAGGAGACAGG - Intergenic
1106594303 13:31123524-31123546 CTGGGAGAGGAGGAGGATTCTGG + Intergenic
1106679972 13:31999475-31999497 CTGGAGAGGGAGAGGGAGACGGG - Intergenic
1106874254 13:34054746-34054768 CTGGAAAGGGAGCTGAAGTCAGG - Intergenic
1107416976 13:40209994-40210016 CTAGAAAAGGAAAATGAGGCCGG + Intergenic
1108184895 13:47878755-47878777 CTGGAAAATGAGTAAGAGTGAGG - Intergenic
1108677001 13:52745718-52745740 CTTGAGAAGGAGAGAGAGTCAGG + Intergenic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1110237768 13:73234342-73234364 CTGGAAAGGGAGGAGGAGGTGGG - Intergenic
1110515795 13:76411308-76411330 ATGGAAAAGGGAAAGGAGTAGGG + Intergenic
1112198934 13:97256510-97256532 CTGGAAAAAGTGAAGCAGACAGG + Intronic
1112659645 13:101492892-101492914 TTGGAAAAGGAAAGGGAGTGAGG - Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113782501 13:112984792-112984814 CTGGAAGGGGAGAGGGCGTCAGG + Intronic
1113842989 13:113371010-113371032 TTGGAGATGGAGATGGAGTCTGG - Intergenic
1114046557 14:18881191-18881213 CTGGCAAGAGAGAAGGAGCCAGG + Intergenic
1114117655 14:19638257-19638279 CTGGCAAGAGAGAAGGAGCCAGG - Intergenic
1115788225 14:36850161-36850183 ATGGGAAAGGGGAAGGAGTGAGG + Intronic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1116394425 14:44430575-44430597 GTGGAGAAGGAGGAGGAGTGGGG - Intergenic
1116852243 14:49919980-49920002 CTAGAAAAGGACAAGAAGTTTGG - Intergenic
1116894506 14:50302901-50302923 CTGGAAAAGGAGAAAGATTTAGG - Exonic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1117827005 14:59714494-59714516 ATGGCAAAGGAGAAGGAACCTGG - Intronic
1118477806 14:66134719-66134741 TTGAGAAAGAAGAAGGAGTCAGG - Intergenic
1119037826 14:71245642-71245664 CTTGCAAAGGAGAAGGAATGAGG + Intergenic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119806481 14:77485457-77485479 CTGGAATAGAAAAAGGAGCCAGG - Intronic
1120034589 14:79681771-79681793 CTGGAAAAGAAGAAAGGCTCTGG + Intronic
1120133264 14:80832674-80832696 CAAGCAAAGGAGAAGGAGTTGGG + Intronic
1120886347 14:89454889-89454911 CTGGAGAAGGAGAGGGAGTGGGG + Intronic
1121277138 14:92676205-92676227 CTAGGAAAGGGGAAGGGGTCAGG + Intronic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121433984 14:93906764-93906786 AAGGAAAAGGAGCCGGAGTCTGG + Intergenic
1121888620 14:97568035-97568057 CAGGAACAGGACAAGGAGTAAGG - Intergenic
1122500912 14:102198834-102198856 CTGGGAAAGGAGCAGTTGTCAGG + Intronic
1122537165 14:102473509-102473531 GTGGAAAAGGAAATGGAGGCAGG + Intronic
1122672865 14:103385495-103385517 CTAGAGAGGGAGAAGCAGTCGGG + Intronic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1125058819 15:35393951-35393973 TTGGAAAAGGATAAGGCCTCTGG - Intronic
1125511877 15:40296565-40296587 GAGGAAGAGGAGGAGGAGTCAGG - Exonic
1125998455 15:44186737-44186759 CTGGAAAAGGAGAAAAAGAAGGG - Intronic
1126008077 15:44277571-44277593 CTGGTAAAGGAGGAAGAGACTGG + Intergenic
1126896358 15:53261230-53261252 CTGGAGTAGGAGAAGCAGACTGG + Intergenic
1127242657 15:57134917-57134939 CAGGAAAAGGAGGAGGAATGTGG - Intronic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1127291955 15:57579109-57579131 CTGGAAGGGGAGGAGGAGTCAGG - Intergenic
1127505721 15:59596136-59596158 CTGGAACAGCAGCTGGAGTCTGG - Intronic
1128545677 15:68566092-68566114 CTGGATGAGGAGAAGGGGTTGGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129053174 15:72799184-72799206 CTGGAGAATGAGAAGGGGACAGG - Intergenic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129772491 15:78211734-78211756 CTGGCAAGGTAGAAGGAGTAAGG - Intronic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1132126205 15:99227457-99227479 CTGGAAAAGGAGCATCAGTTAGG - Intronic
1132651577 16:1023596-1023618 CCGGAAGAGGAGAAGGAGCCAGG - Intergenic
1134759477 16:16701336-16701358 CTGCAGAAGGAGATGGAGTGAGG - Intergenic
1134855564 16:17515849-17515871 CTGGAAAAAGACAGGAAGTCTGG - Intergenic
1134986593 16:18657858-18657880 CTGCAGAAGGAGATGGAGTGAGG + Intergenic
1135464354 16:22672422-22672444 CTGGAAAAGCAGGAAGAGTGGGG - Intergenic
1135566850 16:23517615-23517637 CTGGACCAAGAGTAGGAGTCAGG - Intronic
1135992255 16:27225203-27225225 CCTGAGAAGGAGAGGGAGTCTGG - Exonic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136618722 16:31413824-31413846 CTGGAGAATGAGCAGGAGCCAGG - Intronic
1137033248 16:35544169-35544191 ATGGAGATGGAGAAGCAGTCAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138279885 16:55764674-55764696 CTGGATATGGAGAAGAAATCAGG - Intergenic
1140025115 16:71281501-71281523 ATGGAAAAGTAGAAGAAGACAGG - Exonic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1141990169 16:87604782-87604804 CCCGAAGAGGAGGAGGAGTCTGG + Intronic
1143184827 17:5003828-5003850 CTGGAAAAGGATGAGGAATGTGG - Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143772312 17:9176508-9176530 CTGGAAAGGGAGAATGTGACTGG - Intronic
1144343664 17:14331549-14331571 CTGGAAGAGGAGGAGGGCTCGGG + Intronic
1145781988 17:27569438-27569460 GTGGGAAAGGAGGAGGAGCCAGG + Intronic
1146430034 17:32784342-32784364 TTGGAGAAGGAGAGGGAATCTGG - Intronic
1146587274 17:34093219-34093241 CTAGAAAAGGTGAAGGAGTTAGG - Intronic
1146644005 17:34564370-34564392 CAGGAAAATGAGGAAGAGTCAGG - Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146802965 17:35842010-35842032 CTGGGGAAGGAGATGGTGTCAGG - Intronic
1147320174 17:39641169-39641191 CTGGAACAGGAGAAAGGGTGTGG - Intronic
1147369792 17:39984476-39984498 CTGGAAGAGGTGAGTGAGTCAGG + Exonic
1147659339 17:42108917-42108939 CTGGACAAGGACTAGGTGTCAGG - Intronic
1148268012 17:46241997-46242019 TTAGAAAAGGAGAAGGAGAGTGG - Intergenic
1148357123 17:46982896-46982918 CGGAAAAAGGAGAAGGCTTCAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1150588264 17:66538097-66538119 CAAGAAAAAGAAAAGGAGTCAGG - Intronic
1151451207 17:74199493-74199515 CTGGGAAAGGATGGGGAGTCGGG - Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1151800356 17:76375870-76375892 CTGGAAAAAGACATGGAGCCCGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1155016783 18:21850102-21850124 CTCAAAAAGCAAAAGGAGTCAGG - Intronic
1155407997 18:25511648-25511670 GAGGAATAGGAGAAGGAGACAGG - Intergenic
1156469205 18:37367000-37367022 CTTGAAAAGGAGTGGGAGACTGG + Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1158555540 18:58471719-58471741 ATGGAAAAGGAGCAGAAATCTGG + Intergenic
1159623788 18:70669272-70669294 CTGAGATTGGAGAAGGAGTCAGG - Intergenic
1160111871 18:76040326-76040348 CTTGAAAAGAAGAAGAAATCAGG + Intergenic
1160231357 18:77052037-77052059 CTGGAAGAGGATGAGGAGGCTGG + Intronic
1160770912 19:830685-830707 CTGGGGAAGGAAATGGAGTCAGG - Intronic
1161355175 19:3814995-3815017 CTGGAAAAGTCAAAGGAGTAAGG + Intronic
1161622125 19:5303572-5303594 CTGGAAAAAGAGAGGGGGACTGG + Intronic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163626068 19:18390477-18390499 CTGGAGGAAGAAAAGGAGTCGGG + Intergenic
1164011914 19:21210933-21210955 ATGGAAATGATGAAGGAGTCTGG + Intergenic
1164477335 19:28585699-28585721 TTGGAAACAGAGAAGCAGTCTGG - Intergenic
1165281983 19:34805570-34805592 CTGGAAATGGAGAAAGTGGCTGG - Intergenic
1165820396 19:38671192-38671214 ATGGGAAAGGGGGAGGAGTCCGG - Intronic
1166131855 19:40750434-40750456 CTGGAAAAAGGAAAGGAGTCAGG + Intronic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1166830802 19:45638679-45638701 CTGGAAGAGGAGAGGGAATAGGG - Intronic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
1167448894 19:49555929-49555951 CTGGCTAAGGAGTAGGAGTTGGG + Intronic
1168056715 19:53868574-53868596 CTGGGAAAGGAGGAGAAGACAGG + Intronic
1168635007 19:57989365-57989387 CTGGAAAACGAGAAGGAAAAAGG + Intronic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
926355686 2:12038864-12038886 CTGTAAAAGGAGAAGGGTCCAGG + Intergenic
927043710 2:19255805-19255827 CTGGAAAAGGAAAATGCTTCTGG - Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927284768 2:21345210-21345232 CTGGAGAAAGAGAAGCAGTGTGG - Intergenic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
929391678 2:41475682-41475704 CTGGGAAAGGAGAAGAATTAGGG - Intergenic
929632523 2:43479379-43479401 CTGCAAAATGAGAATGAGACTGG + Intronic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
930374778 2:50551293-50551315 ATGGAAATTGAGAAGGAGTTGGG - Intronic
930735685 2:54776208-54776230 GTGGAAAAGGAGGAGGAGAAAGG + Intronic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
931164536 2:59732860-59732882 CTGGAAGAGAATAAGGAGACAGG - Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931644770 2:64411924-64411946 CTGGCAGAGGAGGAAGAGTCAGG - Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932674627 2:73768654-73768676 CTTAAAAAGAATAAGGAGTCTGG + Intronic
933162558 2:79041896-79041918 CTGGAAAACAAGAAGGAACCAGG - Intergenic
933166823 2:79085783-79085805 CTGGAAGAGGAGGAGGAATTCGG - Intronic
933812218 2:86039962-86039984 CTGGACAAGGGGAATGAGTGTGG - Intronic
933847323 2:86336842-86336864 CTGCAAAAGGAGTCGGAGCCGGG + Intronic
935300783 2:101692239-101692261 CAGGAAAAGAAGAAGCAGACAGG - Intergenic
936756368 2:115717662-115717684 CTGGAAAATGAACAGGAGTTAGG + Intronic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937905723 2:127051906-127051928 CTGTAAAAGGAGGAAGTGTCTGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938463671 2:131513227-131513249 CTGGAAGAGGAGAAAGATCCTGG + Intergenic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
938757807 2:134396913-134396935 CTTGTAAAGGAGGAGGAGGCAGG + Intronic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
940052324 2:149477816-149477838 TTGGAAAATGAGAAGGTGTCAGG + Intergenic
940082476 2:149819715-149819737 CTGGAAATGGATTGGGAGTCAGG - Intergenic
940114390 2:150192340-150192362 CTGGAAAAGGGGATGAAGCCAGG + Intergenic
940619719 2:156096388-156096410 ATGAAAAAGGGGGAGGAGTCTGG + Intergenic
941108897 2:161395541-161395563 CTTGAAAGGGACAAGGAGTAAGG + Intronic
941122148 2:161542685-161542707 GTGGGGCAGGAGAAGGAGTCGGG + Intronic
941384991 2:164841542-164841564 CTGGAAAAGGAGGAGGAGCGGGG + Intronic
942449416 2:176099862-176099884 TTGGAGAAGTAGAAAGAGTCTGG - Exonic
942944516 2:181657798-181657820 CTGGAAAAGGAGAAGAGCCCTGG + Intronic
943174804 2:184457097-184457119 CAGGAAAAGGAGTAGGGATCAGG + Intergenic
945203147 2:207305064-207305086 CTGGAAAGGAGGAAGGGGTCTGG + Intergenic
945538868 2:211057123-211057145 CTGGGAAAGAGCAAGGAGTCTGG - Intergenic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946629676 2:221653437-221653459 CTGTCAAGGGAGGAGGAGTCAGG + Intergenic
947049085 2:226021904-226021926 ATGGTAGAGGAGAGGGAGTCAGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947240990 2:227994435-227994457 CTGGAAACAGAGAAGGTGTGAGG - Intronic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
947487375 2:230564393-230564415 TTTGGAAAGGAGGAGGAGTCTGG + Intergenic
947497724 2:230650477-230650499 CTGGAAAAGGGGATCGAGTGGGG + Intergenic
947732221 2:232437559-232437581 CTGGTAAAAGAGACGGAGGCTGG + Intergenic
947818575 2:233054764-233054786 CTGGAAAAGGAAAGGCAGGCTGG + Intergenic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
948253802 2:236551611-236551633 GGGGGAAAGGGGAAGGAGTCTGG - Intergenic
948502398 2:238405126-238405148 CTGGGAAGGGAGTAGGAGACAGG + Intergenic
949036046 2:241816176-241816198 CTGTAGAAGGCGAAGGAGTGAGG - Exonic
1168965104 20:1894277-1894299 CTGGAGGCGGCGAAGGAGTCGGG - Exonic
1169136130 20:3198809-3198831 CTGGAAAAGAAAAAGGATACTGG + Intronic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1169694230 20:8369386-8369408 CTGGAAGAGGAGAAACAGTAAGG - Intronic
1169783102 20:9330189-9330211 CTGGGAAAGCAGGTGGAGTCTGG - Intronic
1169893620 20:10479073-10479095 CTGGCATTGGAGAAGGAGTTAGG + Intronic
1170077585 20:12436620-12436642 TTGGTAAAGCAGAAGGAATCTGG + Intergenic
1170554113 20:17502064-17502086 ATGGAAAAGGAGACGGAGAGCGG + Intronic
1170875490 20:20246303-20246325 TTGGAAAAGGAGAAGTGGTGGGG + Intronic
1171080454 20:22177300-22177322 ATGGGAAAGGAGGAGGAGCCAGG - Intergenic
1171084093 20:22219958-22219980 CTGGAGAAAGATAAGGAGCCAGG - Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171266630 20:23776492-23776514 CTGGAAAAGGGGTGGGAGTGAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171276179 20:23858128-23858150 CTGGAAAAGGGGTGGGAGTGAGG - Intergenic
1173018030 20:39244481-39244503 CTGGAAGCACAGAAGGAGTCAGG - Intergenic
1173235873 20:41244897-41244919 CAGGAAAAGCAAAAGGAGTTGGG + Intronic
1173571391 20:44078961-44078983 CTGGAAGGGGAGATGCAGTCTGG - Intergenic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1177319445 21:19501138-19501160 CTGGCAAAGGAGAAAGAGAGAGG + Intergenic
1178513939 21:33230330-33230352 CAGGAGGAGGAGGAGGAGTCGGG - Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179477769 21:41658887-41658909 GGGGAAAGGGAGAAGGAGACAGG + Intergenic
1180465095 22:15603829-15603851 CTGGCAAGAGAGAAGGAGCCAGG + Intergenic
1180866059 22:19120559-19120581 CTGGCAAGGAAAAAGGAGTCGGG + Intronic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181270865 22:21657758-21657780 CTGGAAGCGGAGCAGGCGTCTGG - Intronic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1181752313 22:24997340-24997362 CAGGAAAAAGAGAAGGCGACTGG + Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182160203 22:28114020-28114042 CTGGAAAAGGATATGGAGGCTGG - Intronic
1182469931 22:30542324-30542346 CTGGAGGCGGCGAAGGAGTCGGG - Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182996294 22:34815959-34815981 CTGGAGCAGGAGAAAGAGACGGG + Intergenic
1183029859 22:35095473-35095495 CTGGCAATGGAGAAGGAGGTTGG + Intergenic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183337955 22:37261402-37261424 CTGGAAAAGGGGAAGGGTCCAGG + Intergenic
1183696572 22:39427004-39427026 CTTGAAACGGAGATGGAGTCAGG + Intronic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1184300264 22:43554591-43554613 CAGGGAAGGGAGAAGGAGTGTGG + Intronic
1184329898 22:43820786-43820808 CTGGAAATGGGGCAGGAGTCAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185346839 22:50314096-50314118 CTGGAAGAGGATCAGGGGTCTGG + Intronic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
949494400 3:4618263-4618285 CTGGAAAGTGAGAAGGCGTGAGG - Intronic
949520046 3:4843153-4843175 CTGCTAAAGGAGAAGGAATTGGG - Intronic
950348870 3:12327145-12327167 GTGGTAAAAGAGAAGGAGACTGG + Intronic
950774945 3:15341307-15341329 GTGGATGATGAGAAGGAGTCAGG - Intronic
951752953 3:26057412-26057434 CTGGGACAGGAGAGGGAGCCAGG - Intergenic
952281123 3:31924286-31924308 GTGGAAAAGGAAAGGGACTCTGG + Intronic
952307226 3:32157031-32157053 CTGGAAAAGTGGAAGGGGCCAGG + Intronic
952806546 3:37360031-37360053 CTGGCATAGCAGAAGTAGTCTGG - Intronic
952836190 3:37604207-37604229 CTTTAAATGGAGAAGGAGTGGGG + Intronic
953465985 3:43119948-43119970 CTGGAATTGGAGAAGGAGCATGG - Intergenic
953482977 3:43268242-43268264 CTGGAAAAGGAGAAAGCCTAGGG - Intergenic
953670070 3:44955056-44955078 GTGGGCAAGGAGAAGGCGTCAGG + Intronic
955685201 3:61542413-61542435 CTTGAAATTGAGAGGGAGTCAGG - Intergenic
956783954 3:72626866-72626888 CTGCAAAAGGAAAAAGAGCCAGG + Intergenic
956956920 3:74351895-74351917 CTGGAAAAAGAAAAGGAATGAGG - Intronic
959378769 3:105616961-105616983 ATGGAAAAAGTGATGGAGTCTGG + Intergenic
959800979 3:110495181-110495203 CTGGAAAGGGAGATGAAGTCAGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
961502730 3:127349587-127349609 CTGGAAAAGGAGACTGGGTCTGG + Intergenic
961719300 3:128882010-128882032 CTGAAAAAGCAAAAGGAATCTGG - Intronic
962452595 3:135533038-135533060 CTGGAACAGGTGAAGGACTGTGG + Intergenic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
963327347 3:143877129-143877151 GAGGAAAAGGAGAAGGTGTGGGG - Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963772076 3:149397036-149397058 CTGGAACAAGAGTAGGGGTCAGG + Intergenic
963836268 3:150060925-150060947 TTGGAAATAGAGAAGGAGGCTGG - Intergenic
964263025 3:154861768-154861790 CTGGAAAGGGAAAAAGAGTGGGG - Intergenic
964414673 3:156434793-156434815 CTGAGAAAGAAGAAGGAGTTGGG + Intronic
964431391 3:156610315-156610337 CAGGAAAGGCAGAAAGAGTCTGG + Intergenic
964503792 3:157376487-157376509 ATTGCAAAGGAGAAGGTGTCAGG - Intronic
964920748 3:161892567-161892589 GTGGAAAAGGGGAAGGAGAAAGG + Intergenic
965283809 3:166789651-166789673 CTGTAAAAGGACAAAAAGTCAGG + Intergenic
965817870 3:172655507-172655529 CTGGAGAAGGAGAGAGAGTTGGG + Intronic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
965902393 3:173658225-173658247 ATGGAAAATGAGAAGTAGTTAGG - Intronic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967722771 3:192832789-192832811 CTGGAAAAGAAAAAGGGGACCGG + Intronic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
969158821 4:5237264-5237286 CAGGAAAAGCAGTAGGAATCTGG - Intronic
969478079 4:7432532-7432554 CGGGAAAAGCCGGAGGAGTCTGG - Exonic
971324900 4:25635715-25635737 CCGGAAAACCAGAAGGACTCAGG + Intergenic
971366683 4:25983292-25983314 CTGGAAAAGGAGCAGGAAGGAGG + Intergenic
971394164 4:26213418-26213440 TAGGAAAATGAGAAGGGGTCAGG + Intronic
972918259 4:43905914-43905936 CTGGAAAAGGAGACGCTTTCAGG + Intergenic
973796762 4:54435026-54435048 CTTGAAAAGGAGAGGGAGTAGGG - Intergenic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
974103410 4:57441507-57441529 TTCGTAAAGGAGAAGTAGTCTGG + Intergenic
975302306 4:72804764-72804786 CTGAAAGATGAGAAGAAGTCAGG + Intergenic
975395366 4:73869031-73869053 CTGGGAACGGAGAAGGAGCTGGG - Intergenic
976438272 4:85043809-85043831 CTGGAAAAGGGGCTGGAGCCAGG + Intergenic
977289862 4:95153351-95153373 GTGGAACAGGAGGAGGAGTCAGG - Intronic
977750413 4:100603195-100603217 CTGGAAAAGGAGAGGAAGTCAGG - Intronic
978152414 4:105452695-105452717 CTGGAAAGGTAAAAGGAGACAGG + Intronic
978220182 4:106262771-106262793 AGGGAAAAGGAGAAGGAAACTGG - Intronic
980908382 4:138971559-138971581 CTGGAAGAGGTGAAAGAGGCAGG + Intergenic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
981874453 4:149523740-149523762 ATGGAAAATGAGAAAGAGACTGG + Intergenic
982171359 4:152664907-152664929 CAGGAGAATGAAAAGGAGTCAGG - Intronic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
983570681 4:169204844-169204866 CTTCAAAAGGAGAAGGTGGCCGG - Intronic
983644563 4:169976783-169976805 CCGGACAATAAGAAGGAGTCAGG + Intergenic
983873930 4:172854118-172854140 GAGGAAAAGGAGAAGCATTCTGG - Intronic
984466042 4:180101208-180101230 CTGGAAAAGGAAAACGAGCCAGG - Intergenic
984662923 4:182392682-182392704 GTGGAAACAGAGAAGGAGGCAGG + Intronic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
984824566 4:183913137-183913159 ATGGAGAAGGAGAAGGATTTGGG + Intronic
985285521 4:188332947-188332969 CTGGAACAGGAGAAGGAGCTTGG + Intergenic
985354143 4:189099019-189099041 TTGGAAGAGGAGATGGATTCCGG + Intergenic
986773791 5:10995901-10995923 ATGGAAAATGAGAAGAAGTGAGG + Intronic
986838915 5:11673084-11673106 CTGGAAAATGAGAAGAAATTTGG - Intronic
986848042 5:11778712-11778734 CTGGAAAAGGAAAAGGATACTGG + Intronic
987170359 5:15250322-15250344 GTAGAAAAGTAGAAGGAGCCTGG - Intergenic
987241680 5:16006502-16006524 CTGGAAAATGAAAACTAGTCTGG - Intergenic
987901248 5:24014648-24014670 CAGGAAAAGCAGAAGCAGTTCGG - Intronic
988194873 5:27992152-27992174 CTGGAGTAGGAGAAGGAATTAGG - Intergenic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
988492000 5:31712799-31712821 CTGGAAAAGGATTTGGAGCCTGG + Intronic
989235354 5:39141907-39141929 CTGGAGAAAAGGAAGGAGTCAGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
991133835 5:63157346-63157368 CTGGGAAAGGCAAAGGAGTTGGG - Intergenic
991283255 5:64940093-64940115 CTGGAAAAGGGGCTGAAGTCAGG - Intronic
991646597 5:68807537-68807559 CTGAAAAAGGAGATCAAGTCTGG + Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992402983 5:76428297-76428319 CTGGGAAGGGAGAAGGAGTAGGG + Intronic
992686692 5:79206272-79206294 CTGGAAATGGAGACGGAGACAGG - Intronic
994163412 5:96582533-96582555 CTGGCAAGGGAGCAGGCGTCAGG - Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997632563 5:135379857-135379879 CTTGAAAAGCAGAGGAAGTCAGG - Intronic
997959063 5:138304986-138305008 CTGGGAAAGAATAAGTAGTCAGG - Intronic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
998055101 5:139068353-139068375 GTGGACAAGGACAAGAAGTCTGG + Intronic
998586017 5:143428482-143428504 TTGGAAAGGCAGAAGGAGTCAGG - Intronic
998698536 5:144669281-144669303 CTGGTAAATATGAAGGAGTCAGG - Intergenic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
1000738466 5:164934408-164934430 CTGGAAAAGGAGTTGAAGCCAGG - Intergenic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1001474592 5:172041438-172041460 CTAGAAAATGAGAATGAGCCTGG + Intergenic
1001871727 5:175161977-175161999 CTGGAAAATGTAAAGGTGTCAGG + Intergenic
1002177704 5:177410831-177410853 CTGGAACATGAGAAGAAGACGGG + Intronic
1002373798 5:178774549-178774571 CTGGAAAGCGAGAAAAAGTCAGG + Intergenic
1002854305 6:1023702-1023724 CTGCAGAAGGAAAAGGAGTCTGG - Intergenic
1003051918 6:2787962-2787984 CTGGAGTAGGAGAGGGTGTCTGG + Intergenic
1003313081 6:4986257-4986279 CTGGAACAGGAAAAGGACTCAGG + Intergenic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1004947042 6:20626975-20626997 CGGGGAAGGGAGAAGGAGTTTGG + Intronic
1005286277 6:24330481-24330503 CTTCAAAAGGAGAAGGAATTTGG + Intronic
1006130396 6:31865661-31865683 CTGGAGTCGGAGTAGGAGTCAGG - Intronic
1006689591 6:35870382-35870404 GAGGAAATGGAGAAAGAGTCGGG - Exonic
1006722825 6:36170070-36170092 CTAGAATGGGAGATGGAGTCAGG + Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007219218 6:40265266-40265288 CTGGGAAAGGAAAAGGAGCTGGG - Intergenic
1007546527 6:42698711-42698733 CTGGAAAGGGAGGAGGAGAGGGG - Intronic
1007737222 6:43989454-43989476 CTGGCAAAGGGGAAGGATTTGGG + Intergenic
1008014003 6:46497457-46497479 ATGGAAAAGGAGAAGAAGTATGG - Intergenic
1008046284 6:46854541-46854563 CCAGAAAAGAAGCAGGAGTCAGG + Intronic
1008419035 6:51275011-51275033 CTGGAAAATGAGAGGAAGTTGGG + Intergenic
1008614591 6:53214081-53214103 CTGGTAAAGGTAAAGGAGACTGG + Intergenic
1009568347 6:65345139-65345161 CTGGAAAAAAAGAAGGAGCTAGG + Intronic
1011153093 6:84297373-84297395 CTGGAGAAGCTGAAGTAGTCTGG + Intergenic
1011166629 6:84454900-84454922 CTAGAAAAGGGTGAGGAGTCTGG + Intergenic
1011420723 6:87169335-87169357 CTGGAAAAAAAAAAGGAGGCTGG - Intronic
1011629730 6:89311904-89311926 TTGGCAAAGGAAAAGGAGTTGGG - Intronic
1012520855 6:100119555-100119577 CTGGAAAAAGAGGATGATTCGGG + Intergenic
1012793045 6:103724698-103724720 ATGGAAATGGAGAATTAGTCTGG - Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013735524 6:113222445-113222467 ATTGAAAAGGATAATGAGTCCGG + Intergenic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1014064772 6:117111624-117111646 TTGGAGAAGGAGAAGTACTCTGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015837048 6:137431699-137431721 TTGCAAAAGGAGAAGGAATAGGG + Intergenic
1016390610 6:143570837-143570859 TTGGAAGAAGAGGAGGAGTCCGG - Intronic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1018041382 6:159926024-159926046 CTAGGAAAGGAGAAGCAGGCTGG - Intergenic
1018842614 6:167528807-167528829 TTGGAGAAGGTGAAGGAGTTAGG - Intergenic
1019391947 7:793366-793388 CTGGAAAATGGGGAGAAGTCAGG - Intergenic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1021907257 7:25347468-25347490 GTGGGAAAAGAGAAGGTGTCTGG + Intergenic
1022597154 7:31723584-31723606 CTGGGAGAGGAGGCGGAGTCAGG + Intergenic
1022615560 7:31926670-31926692 CTGGGAAAGTGCAAGGAGTCAGG + Intronic
1022809232 7:33852517-33852539 CTGCAAAAGGAAAAAGATTCTGG - Intergenic
1023040169 7:36165993-36166015 CTGTAAACGGAGAGGGATTCAGG + Intronic
1023054146 7:36278376-36278398 CTGGAAAAGGAGAACAATCCTGG + Intronic
1023891842 7:44398429-44398451 CTGGAAAATGAGAACGTGCCAGG - Intronic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024161798 7:46683521-46683543 CAAGAAAAGGATAAGGAGTTTGG + Intronic
1024773981 7:52760605-52760627 CGAGAAAAAGGGAAGGAGTCAGG - Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026457037 7:70581653-70581675 TTGGATAGGGAGAAGGGGTCAGG - Intronic
1026942141 7:74293364-74293386 AGGGGAAAGGAGAAGGAGACGGG - Intronic
1027900657 7:84110130-84110152 ATGGAAAAGGAGGAGAAGGCTGG + Intronic
1028504554 7:91556943-91556965 CTGGGAGAGGACAAGGAGCCTGG - Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031738003 7:125391197-125391219 CTGGCAAGGAAGAAGTAGTCTGG - Intergenic
1031973442 7:128079473-128079495 CTGGAAGGTGAGAAGGGGTCAGG + Intronic
1032351518 7:131168310-131168332 GTGGCAAAGAGGAAGGAGTCAGG - Intronic
1032413555 7:131718772-131718794 CTGGAAAAGCAAAAGCATTCAGG - Intergenic
1032419385 7:131765574-131765596 CTAGAGAAGGAAGAGGAGTCAGG + Intergenic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033284444 7:140028269-140028291 CGAGAAAAGGAGAAGCAGCCTGG - Intronic
1033430983 7:141289417-141289439 CTTGAAAAGGAGAATGCGGCTGG + Intronic
1034221362 7:149449051-149449073 CTGCAAAAGGAGAAGGCGCTTGG + Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035705244 8:1670030-1670052 CTGGAGACGGAGACGGAGACGGG - Intronic
1035852699 8:2936794-2936816 GTGGAAAAGGAAAAGCAGTCAGG - Intronic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1037350862 8:17953988-17954010 GTGGAAAAGGAAAAGGAGATAGG - Intronic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1038300162 8:26337112-26337134 GTTGAACAGGAGAATGAGTCTGG + Intronic
1038602079 8:28954801-28954823 GTGGAAAAGAAGAAGGACTTTGG + Intronic
1038936468 8:32257261-32257283 CTGGAAAGGGGGCTGGAGTCAGG - Intronic
1039839549 8:41284198-41284220 ATGGAAGAGGAGAAGGAGAACGG + Intronic
1040543524 8:48380063-48380085 CTGGCAAGGGAGAAGGAAACAGG + Intergenic
1041216448 8:55606349-55606371 CTGGAGAAGGAGGAGGAGAGAGG - Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041838911 8:62247918-62247940 CTAGAAATGGAGAAGGTTTCCGG - Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042346831 8:67736146-67736168 CAGGAAAGTGAGATGGAGTCAGG - Intronic
1042775029 8:72420565-72420587 CTGGAAGTGGAGGAGGAGTGGGG - Intergenic
1043812123 8:84753664-84753686 CTGGAATAGGAGAAAGGGTGGGG - Intronic
1045910248 8:107399177-107399199 CTGGAATAGGAGATGAAGTGAGG - Intronic
1045913159 8:107434303-107434325 ATGAAACAGGAAAAGGAGTCTGG + Intronic
1047035911 8:120938165-120938187 TTCAAAAAGGAGAAGGAGCCTGG + Intergenic
1047086837 8:121526898-121526920 ATGTGAAGGGAGAAGGAGTCAGG - Intergenic
1047340060 8:123972492-123972514 AAGGAAGAGGAGAAGGATTCTGG - Intronic
1048462301 8:134631410-134631432 CTGGTAACGGGGCAGGAGTCGGG + Intronic
1048650379 8:136469318-136469340 CTGGAAAAGGGGCAAGAATCAGG + Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049684628 8:143934375-143934397 CTGGATGTGGAGAAGGAGTGGGG - Exonic
1049737654 8:144218381-144218403 CTGGAATAGGTGCAGGAGTCCGG - Intronic
1049802637 8:144525277-144525299 GTGGAGAAGGAGAAGGTGACAGG - Intronic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1050058011 9:1676082-1676104 CTTGCAGAGGGGAAGGAGTCAGG - Intergenic
1050357454 9:4796229-4796251 CTGGAAAAGGAGGAAGATTGAGG - Intronic
1050673562 9:8025644-8025666 CTGGAAAAGTGGAATCAGTCTGG + Intergenic
1050923363 9:11233941-11233963 GTGGAGAAGGAGGAGGAGTGGGG + Intergenic
1051026888 9:12623796-12623818 CTAGAAAATGGGAAGGAGTCAGG - Intergenic
1052093176 9:24354985-24355007 CTGGAAAGAGAAAAGGAATCAGG - Intergenic
1052305493 9:27004171-27004193 GTGGAAATGGAGACGGAGTATGG + Intronic
1052406038 9:28062135-28062157 CTGGAAAAGTAAAAGGAGCTAGG + Intronic
1052980427 9:34444369-34444391 CTGGAAATGGAGAAAGTCTCTGG - Intronic
1053102667 9:35384140-35384162 CTGGATGAGTAGAAAGAGTCGGG - Intronic
1053651114 9:40170758-40170780 CCAGAAAAGAAGCAGGAGTCAGG - Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1053901499 9:42800106-42800128 CCAGAAAAGAAGCAGGAGTCAGG - Intergenic
1054533466 9:66205445-66205467 CCAGAAAAGAAGCAGGAGTCAGG + Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054825806 9:69572412-69572434 CTGGGGAAGGAGTAGGAGTGAGG - Intronic
1054981770 9:71214896-71214918 CTGGAAAAGTGTAAGGACTCAGG - Intronic
1055729308 9:79264316-79264338 CTGGAAAAGGAGAGAGAGAAAGG - Intergenic
1056246264 9:84698155-84698177 TTGGGAAAGGAGAATGGGTCTGG - Intronic
1058131339 9:101257230-101257252 CTGGGAAAGAAGAGGGAGTGTGG - Intronic
1059623997 9:116041188-116041210 ATGGAAAAGAAAAAGGAGACGGG + Intergenic
1059925528 9:119205576-119205598 CTGGGAAAAGTCAAGGAGTCTGG - Intronic
1060209743 9:121702277-121702299 CTGGAAAAGGAGTCGGTTTCAGG + Intronic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061551075 9:131335025-131335047 CTGGAGAAGGAGTAGGGGTGGGG - Intergenic
1061858519 9:133456046-133456068 CTGAAAAGGGAGCAGGAGACAGG - Intronic
1062744633 9:138203510-138203532 GGGGAGAAGGAGGAGGAGTCGGG + Intergenic
1203772640 EBV:57466-57488 GAGGAAGAGGAGAAGGAGCCCGG + Intergenic
1187042668 X:15613353-15613375 CTGGAAAGGTAGAAGGACCCGGG + Intergenic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189684652 X:43551449-43551471 CTGGAAAAGGAGAAAGGCCCAGG + Intergenic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1191736602 X:64394766-64394788 ATGGAAAAGGAAGAGGAGTGGGG - Intronic
1192106808 X:68325781-68325803 CGGGAAAAGGAGAAGGATACCGG - Intronic
1192197472 X:69038236-69038258 GTGGGAATGGAGAAGGAGTTTGG - Intergenic
1192448076 X:71225044-71225066 AAGGAAAAGGAGGAGGTGTCTGG + Exonic
1192573066 X:72222061-72222083 GTGGAGAAGGAGGAGGAGTGGGG - Intronic
1192582713 X:72298422-72298444 CTAGAGAAGGAGAGGGAGTAAGG - Intronic
1192749132 X:73969979-73970001 ATGGAAAAGAATAAGCAGTCCGG - Intergenic
1193829986 X:86278706-86278728 CTGGAAAAGGGGATGAAGCCAGG + Intronic
1194821467 X:98511918-98511940 TTGAAAAAGGAGACTGAGTCTGG + Intergenic
1195097412 X:101516590-101516612 CTAATAAAGGAAAAGGAGTCAGG + Intronic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196349544 X:114710021-114710043 CTGGAAAAGAAGCAGGAGACTGG + Intronic
1197827448 X:130605361-130605383 CTGGAAAAAAAAAAGTAGTCTGG - Intergenic
1198117242 X:133555980-133556002 ATGAAAAAGGAGGAGGAATCTGG - Intronic
1198316276 X:135469693-135469715 CTTGAAAAGCAGTAGCAGTCAGG - Intergenic
1198474858 X:136985071-136985093 CTGGAGCAGGAAAAGGACTCTGG + Intergenic
1198499411 X:137228087-137228109 CTTCAAAAGGAGGAGGAATCAGG - Intergenic
1199676819 X:150196293-150196315 CTGGAAAAGGAGAAGATCTTAGG - Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201329330 Y:12800887-12800909 CTTGAAAAGGAGAAGAAATAAGG - Intronic
1201330244 Y:12811569-12811591 ATAGAAAAGGACAAGGAGTTAGG - Intronic
1201376716 Y:13330677-13330699 CTGGAAAAGGAGCTGAAGCCAGG + Intronic