ID: 920311597

View in Genome Browser
Species Human (GRCh38)
Location 1:205052023-205052045
Sequence TCTTGCAGGCAGTTGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920311589_920311597 8 Left 920311589 1:205051992-205052014 CCAGAACACTGAGATCCAGAGAT 0: 1
1: 0
2: 1
3: 20
4: 236
Right 920311597 1:205052023-205052045 TCTTGCAGGCAGTTGGTGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 197
920311594_920311597 -7 Left 920311594 1:205052007-205052029 CCAGAGATGGGACGGGTCTTGCA 0: 1
1: 0
2: 3
3: 24
4: 129
Right 920311597 1:205052023-205052045 TCTTGCAGGCAGTTGGTGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 197
920311588_920311597 14 Left 920311588 1:205051986-205052008 CCAGAGCCAGAACACTGAGATCC 0: 1
1: 0
2: 3
3: 19
4: 197
Right 920311597 1:205052023-205052045 TCTTGCAGGCAGTTGGTGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920311597 Original CRISPR TCTTGCAGGCAGTTGGTGAA AGG Intronic
900688680 1:3966105-3966127 GGCTGCAGGCAGTTGGTGCAGGG + Intergenic
900690757 1:3978874-3978896 TGCTGGAGGCAGTGGGTGAAGGG + Intergenic
901785691 1:11622995-11623017 TAAGGCAGGAAGTTGGTGAAGGG - Intergenic
903614894 1:24644108-24644130 TCTTGGAGTCCGCTGGTGAAAGG + Intronic
903622691 1:24709298-24709320 GGTTGCAGTCAGTTGGTGAATGG - Intergenic
904005600 1:27361626-27361648 ACCTGCAGGCAGTTGGGGAGTGG + Exonic
904708183 1:32407786-32407808 TCTTGGTGGCAGTTGGAGCAAGG - Intergenic
906951863 1:50341201-50341223 TGTTGAAGACACTTGGTGAAGGG - Intergenic
907267766 1:53273105-53273127 CCCTGCAGGCATTTGGGGAAAGG - Intronic
911250823 1:95574651-95574673 TCTTGCTGGCAGTTAGCAAAAGG + Intergenic
912645846 1:111391040-111391062 ACATCCAGGTAGTTGGTGAAGGG + Intergenic
913049076 1:115099809-115099831 TCGTGCAGCCAGTTGGGGGAAGG + Intergenic
914771794 1:150693468-150693490 TCTTGCAGGCGGTGGGCGAGGGG + Intronic
915809768 1:158894653-158894675 TCTTGCAGGCCAGGGGTGAATGG + Intergenic
917529565 1:175822629-175822651 TCTTTAGGGCTGTTGGTGAATGG - Intergenic
918728366 1:187955401-187955423 GCTTGCAGTCAGATGGTCAAGGG - Intergenic
919993943 1:202730337-202730359 TCATTCAGGGATTTGGTGAAAGG - Intronic
920311597 1:205052023-205052045 TCTTGCAGGCAGTTGGTGAAAGG + Intronic
921011068 1:211141921-211141943 TCTTGCAGACAGTAAATGAATGG + Intergenic
921713299 1:218394284-218394306 TTGTGCAGGCAGTTTGTGTAGGG - Intronic
922887914 1:229034306-229034328 TCTGGGAGGCATTTGGTAAATGG - Intergenic
923015975 1:230126989-230127011 TCTTCCTGGTAGTGGGTGAATGG + Intronic
924739546 1:246786813-246786835 CCTGGTAGGCTGTTGGTGAAAGG + Intergenic
1065412846 10:25449212-25449234 TCTGGCAGGAAGTTGTTGAAAGG - Intronic
1067080738 10:43210919-43210941 CCTTGCAGGGAGTTGGGGACAGG + Intronic
1069735951 10:70654374-70654396 TCTTGCAGGCTGCTGTTAAAAGG - Intergenic
1070271976 10:74965314-74965336 TCTAGCAGGAAGTTAGAGAAAGG - Intronic
1073068449 10:100778449-100778471 ACTTGCAGGCAGTTGGGATAAGG - Intronic
1074053452 10:109900546-109900568 CCTTGCAGGCAGGTGGTAGAGGG - Intronic
1074077838 10:110145463-110145485 CCTTTCAGGCTGTTGTTGAAAGG + Intergenic
1074114957 10:110449252-110449274 TCTTGCAGGCAGTAGATCAATGG - Intergenic
1075594454 10:123718145-123718167 TGTGCCAGGCAGTGGGTGAAAGG + Intronic
1075703484 10:124484259-124484281 TCTGGCAGGCAGCTGGTGCCGGG - Exonic
1078203213 11:9203517-9203539 TTTTGCAGGTAGGTGGTGGATGG - Intronic
1078750566 11:14158117-14158139 TCTAGCAGGCAGTTGGAGTATGG + Intronic
1079085816 11:17444199-17444221 ACTGGGAGGCAGGTGGTGAAGGG - Intronic
1081195040 11:40151011-40151033 TCTTGCAGGCATATGGAGCATGG - Intronic
1083812763 11:65114991-65115013 GCCTGCAGGCTGTAGGTGAAGGG - Exonic
1083823824 11:65187245-65187267 ACTTTCAAGAAGTTGGTGAAGGG + Exonic
1085571861 11:77566423-77566445 TCTTGCAGGCAGTAGATCATTGG + Intronic
1085655078 11:78306698-78306720 TCTTGAAGGCAGAGAGTGAAAGG + Intronic
1087116718 11:94533353-94533375 TCTAGCAGGCAGTAGCTAAATGG - Intergenic
1087917835 11:103831191-103831213 TCTGGCAGGCCTTGGGTGAAGGG - Intergenic
1088040480 11:105375475-105375497 TCTTGCAGGCACGCAGTGAAAGG + Intergenic
1088221514 11:107575042-107575064 TAATGCATGCAGTTGGTAAAGGG - Intergenic
1089981268 11:122774614-122774636 TTTAGCAGCCAGTTGGGGAAAGG + Intronic
1090335872 11:125964454-125964476 TTTGGCAGGCAGTTGGACAAAGG - Intronic
1090336013 11:125965744-125965766 TTTGGCAGGCAGTTGGACAAAGG - Intronic
1090652510 11:128819805-128819827 TCTGGCAAGCAGTTAGAGAAAGG + Intergenic
1091945074 12:4532236-4532258 TCTTGCAGGTGTCTGGTGAAAGG - Intronic
1092097616 12:5856619-5856641 TCTTCCAGGCAGCGGGTTAAGGG - Intronic
1099067861 12:78006507-78006529 GCTTGCTGGCACTTGGAGAAGGG - Exonic
1100019701 12:90054686-90054708 TCTTGCTGGCAGGTGGAAAAAGG - Intergenic
1104164048 12:126209141-126209163 TTTTGCAGACAGTTGCTGACTGG + Intergenic
1105353219 13:19634234-19634256 GGCTGCAGGCAGCTGGTGAAGGG + Intronic
1105415005 13:20203687-20203709 TCTGGAAGGCAGTTGGGGTAGGG + Intergenic
1105747279 13:23389840-23389862 TTTTGCAGGGAGTTGGGGGATGG + Intronic
1105809680 13:23984004-23984026 TATTTCAGGCTGTTTGTGAAGGG + Intronic
1106117424 13:26829642-26829664 TCCTGCAGGCAGATGGTGGAGGG + Intergenic
1106771227 13:32962419-32962441 TCTGGCAGGCATTTGGTGGTGGG + Intergenic
1107750693 13:43562626-43562648 TCTTGCAGGCAGTGGATCATTGG - Intronic
1108954633 13:56138141-56138163 TGTGGCAGGGAGTTGGTGAGAGG + Intergenic
1109708826 13:66136867-66136889 TCTTGCTGGCTGTTGGTAAGAGG + Intergenic
1112171332 13:96975768-96975790 TGTTGTAGGCAGTTAGTGGAGGG + Intergenic
1112786544 13:102957665-102957687 CCTTGCTGGCTGCTGGTGAATGG - Intergenic
1115577296 14:34724136-34724158 TTTTGTAGGCAGTTTGTGGAAGG - Intergenic
1117582417 14:57165471-57165493 TCTTTCACACAGTTGGTGGAAGG + Intergenic
1122816583 14:104316974-104316996 GGGTGCAGGCAGATGGTGAATGG + Intergenic
1125759457 15:42087098-42087120 TCCCACAGCCAGTTGGTGAAAGG + Intronic
1126096529 15:45094576-45094598 TCCTGCAGGGAGTTGAAGAAGGG + Exonic
1126108828 15:45163883-45163905 TCCTGCAGGGAGTTGAAGAAGGG - Exonic
1127659757 15:61089504-61089526 TCTTTCAGGAACTTGGTGCAAGG + Intronic
1129912653 15:79241153-79241175 CCTTTGAGGCACTTGGTGAATGG - Intergenic
1131422480 15:92318865-92318887 TGATGCAGGCAGTGGGTGTATGG + Intergenic
1133056567 16:3148316-3148338 TCTTGCAGGCAGCTCCTGCAGGG + Exonic
1134120486 16:11580726-11580748 TCCTGGAGGCAGGTGGTGATAGG - Intronic
1134156033 16:11844141-11844163 GCTTGCAGGCAGGTGGTGACAGG - Intronic
1137623477 16:49892386-49892408 TCCCACAGGCAGTTGGTGACTGG - Intergenic
1139214904 16:65118133-65118155 CCATGCAGACAGTTGGAGAAGGG + Intronic
1140217788 16:73022338-73022360 CCAGGCAGGCAGATGGTGAAAGG + Intronic
1143330382 17:6130642-6130664 TCTTGCTGGCTGTTGGTCAGAGG + Intergenic
1144401944 17:14913174-14913196 TCCTGCAAGCAGGAGGTGAAGGG + Intergenic
1146151139 17:30473649-30473671 TCTTGCAGGCAGTTCAGGTAGGG - Intergenic
1148496434 17:48055779-48055801 TCTTGCTGCCAGCTGGGGAATGG + Intronic
1148993672 17:51688681-51688703 TTCTGCAGGCAGATGGGGAAAGG - Intronic
1150948120 17:69769740-69769762 TCTTGAAGGCAGTAGATGAATGG + Intergenic
1159606158 18:70477485-70477507 TCTTCCAGGCAGTTTGAAAATGG + Intergenic
1159856921 18:73599777-73599799 ATTAGCAGGCAATTGGTGAAAGG - Intergenic
1160540909 18:79621953-79621975 TCTTGCTGGCAGCTGGAGCAGGG - Intergenic
1160977985 19:1803161-1803183 CATTGCAGGGTGTTGGTGAATGG - Intronic
1161746055 19:6060919-6060941 TCTGGGAGGCAGCTGGAGAAGGG - Intronic
1163030796 19:14542927-14542949 TCTCTCAGGCAGTCTGTGAATGG - Intronic
1167408638 19:49331663-49331685 TCCTGCAGCCAGTGAGTGAAGGG + Intergenic
925249363 2:2418869-2418891 TCTTGTAGGCAATAGGTTAATGG + Intergenic
926229726 2:10993213-10993235 TCTTGCAGTCAAGTGGTGAGTGG + Intergenic
926718841 2:15943567-15943589 ACTTGCAGCCAGCTGCTGAATGG - Intronic
928062362 2:28127479-28127501 TCTTCCAAGCAGTCTGTGAAGGG + Intronic
928414816 2:31083371-31083393 CCTTCAAGGCACTTGGTGAAAGG + Intronic
929873403 2:45776521-45776543 TCTTGCAGGCTTTTGCTCAAGGG + Intronic
930480685 2:51944430-51944452 TTTTGCAGGCTGTAGGTGGAAGG + Intergenic
932846830 2:75143894-75143916 TGATTCAGGCAGTGGGTGAACGG + Intronic
932931335 2:76043153-76043175 ACTTGTAGGCAGATGGTGATGGG + Intergenic
933836814 2:86252454-86252476 TCTGGCAGTCAGTTGGTGGCAGG - Intronic
934616614 2:95775186-95775208 ACTTGGAGGCTGTTGGTGGATGG - Intergenic
934644276 2:96049373-96049395 ACTTGGAGGCTGTTGGTGGATGG + Intergenic
934837691 2:97605463-97605485 ACTTGGAGGCTGTTGGTGGATGG + Intergenic
934972498 2:98774608-98774630 TCTTGCAGGAAGTGGATGAAGGG - Intergenic
935050937 2:99524551-99524573 CCTTGCTGGCTGTTGGTGAAGGG - Intergenic
935379715 2:102439288-102439310 TCAAGCAGGCAGTTGCTGATAGG + Intronic
936728246 2:115348949-115348971 TACTACAGCCAGTTGGTGAAGGG - Intronic
937509114 2:122573146-122573168 TCTTCCAGGATGTTGGGGAATGG + Intergenic
940068017 2:149651501-149651523 TCTTGCATGCAGATGATCAAAGG + Intergenic
944012271 2:194986341-194986363 TCTTGTAGGCAGTAGGTGGTTGG - Intergenic
944665882 2:201959138-201959160 TTTTGCAGGCAGTGGTTGAGGGG - Intergenic
945646203 2:212498196-212498218 ACTTGCAGGAAGTTGGGGAAGGG - Intronic
945898120 2:215507697-215507719 TCTTGCATCCATCTGGTGAATGG + Intergenic
947077161 2:226357376-226357398 GCATGCAGGAATTTGGTGAAGGG + Intergenic
947106169 2:226669973-226669995 TCTTGCTGGCTGTTGGTCAGGGG + Intergenic
947314228 2:228837777-228837799 TTTTGAAGCCAGCTGGTGAAAGG - Intergenic
1171017293 20:21553344-21553366 TTTTGCAGGGAGTTGGTGGTGGG + Intergenic
1171783879 20:29445598-29445620 TCTTGCAGCCCGGTGATGAAAGG + Intergenic
1172420341 20:34811629-34811651 GCTAGTAGGCAGTTGGTAAAGGG - Intronic
1173878019 20:46388535-46388557 TGTGGCAGGGAGATGGTGAATGG + Intronic
1175583399 20:60118135-60118157 TAATGATGGCAGTTGGTGAATGG + Intergenic
1175776282 20:61655830-61655852 ACCTGCATGCAGTCGGTGAACGG + Intronic
1177131252 21:17258732-17258754 TCTAGCAGGCAGTTGGAAATGGG + Intergenic
1178049833 21:28735414-28735436 CCTTGCAGGCTGTTAGTGAGAGG + Intergenic
1181274835 22:21681799-21681821 TCTGGCAGGGAGTGGGTGTAGGG + Intronic
1184186223 22:42867046-42867068 TCCTACAGGAAGTTGGGGAACGG + Intronic
951033983 3:17912920-17912942 TTTTGCAGGCACTGTGTGAATGG - Intronic
953302284 3:41789801-41789823 TCTGGAAGGCAGTAGGAGAATGG + Exonic
954627497 3:52030559-52030581 TCTGGCAGGCAGTGGAGGAATGG + Intergenic
958607550 3:96378123-96378145 TCTTGTGGGCATTTAGTGAATGG - Intergenic
958650382 3:96930269-96930291 TGTTGCAGTCATTTGGAGAAGGG + Intronic
960589429 3:119351144-119351166 TCTTCCAGGCAGTAGGTGCTGGG - Intronic
963780463 3:149481258-149481280 TTTTGCAAGCATTTGGTGTAAGG + Intronic
963926455 3:150956672-150956694 TCCTGCAGTCATTTGGTGAGGGG + Intronic
964153884 3:153562086-153562108 TCTTGCAAGCTGTTGGTCAGAGG + Intergenic
965236661 3:166133656-166133678 TCTTGCAGGCAATAGATCAATGG + Intergenic
967640094 3:191852324-191852346 TCTTGCCAGCAGTGGATGAAGGG - Intergenic
973970019 4:56204063-56204085 TGTAGCTGGCACTTGGTGAATGG + Intronic
974307756 4:60162694-60162716 TCTTCCATGCACTTGGTCAAAGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
979287365 4:118941306-118941328 TCCTGAATGCAGTTGGTGACTGG - Intronic
980582244 4:134770377-134770399 TCTTAAAGGACGTTGGTGAAGGG - Intergenic
980694555 4:136337888-136337910 TCTTGGAGGCAGCAGGGGAAGGG - Intergenic
982787199 4:159549754-159549776 TCTTGGAGGCAGTAGGGTAATGG - Intergenic
983737171 4:171075976-171075998 TCATGCAGGTAGTTTCTGAATGG + Intergenic
983743937 4:171170548-171170570 TCTTGCAGGTATTTGGAGAATGG - Intergenic
987216111 5:15739098-15739120 ACTTGCAGGCAGCTGGTATAGGG - Intronic
989027534 5:37084840-37084862 TCTTGAAGGCAGCAGGTGATTGG - Intergenic
990614716 5:57495791-57495813 TCTTGAAGGCAGGTTGGGAAAGG - Intergenic
996248172 5:121291931-121291953 CCTTGCAGGCAGCTGGTGGGAGG + Intergenic
997376526 5:133401468-133401490 TATTGCAGGCAGGGGGTGGAGGG - Intronic
998388366 5:141771562-141771584 TCTTGCAAGCATTTTGTGAAAGG + Intergenic
998786361 5:145714117-145714139 TCTTGCTGGGAGTTGGGGAGGGG - Intronic
999085207 5:148882181-148882203 GCGTCCAGGCAGCTGGTGAAGGG - Intergenic
999330958 5:150672995-150673017 TCTTCTAGGCCATTGGTGAAAGG - Intronic
999738079 5:154527675-154527697 CCTGGGAGGCAGTCGGTGAAGGG - Intergenic
1000177537 5:158772373-158772395 TTTTGAAGACAGTTGGTGATAGG + Intronic
1000448102 5:161349744-161349766 TCCTGCAGGCTGTTGGAAAAGGG - Intronic
1000725409 5:164763503-164763525 TCTTGCAGCCAGTGGCTGCATGG + Intergenic
1003461441 6:6332448-6332470 TCTTGCATGCGGTTTGTGCAGGG - Intergenic
1004188858 6:13446830-13446852 TGTTGCTGCCAGTTGGTGAAAGG - Intronic
1008312443 6:49992669-49992691 TCTTGCAGGCAGGAGATCAATGG - Intergenic
1008618815 6:53251875-53251897 TCTTGAAGGCCGATGGTGAAGGG + Intergenic
1009773469 6:68175297-68175319 GCTTGCATGCTGGTGGTGAAGGG - Intergenic
1009874662 6:69490867-69490889 TAATGCAGGCAGTTGGGGGAGGG - Intergenic
1009946390 6:70346703-70346725 GCTTGGAGGCAGCAGGTGAAGGG + Intergenic
1012063981 6:94523948-94523970 TCTTGCAGGCAGTCGTGTAAAGG + Intergenic
1015134848 6:129856411-129856433 TCTGGCAGGCATTTGTTAAAAGG + Intronic
1018519325 6:164628730-164628752 TCTTGCTGGCTGTTGGTGGAAGG - Intergenic
1020052226 7:5089247-5089269 TCTTGCATGCAGTTGGTGGAAGG - Intergenic
1021641225 7:22738270-22738292 TCTTGCAGGCAATGGATCAATGG - Intergenic
1022565081 7:31391484-31391506 TCATGGAGGCAGTTGGTCATTGG + Intergenic
1023069480 7:36414850-36414872 TCTTGCACACAGTTAGTGACTGG - Intronic
1026393099 7:69922197-69922219 TCATGCACGCAGTCTGTGAAAGG + Intronic
1027748174 7:82105605-82105627 TCATACAGGCCGTTGGTGGAAGG - Intronic
1028403671 7:90452807-90452829 GCATGCATGCATTTGGTGAAGGG + Intronic
1028506077 7:91571637-91571659 TATAGCAGGCAGTTTGTGCATGG + Intergenic
1029045540 7:97624044-97624066 TCTTACAGCAAGTTGGAGAAAGG + Intergenic
1030488906 7:110206584-110206606 GCTAGCAGGCAGGTGGGGAATGG - Intergenic
1030754514 7:113271819-113271841 TCTTGTAGGCAGCAGGTGGATGG - Intergenic
1032199896 7:129812700-129812722 ACTTGCCGGAAGTTGATGAAGGG + Intergenic
1032201268 7:129824911-129824933 TCTTGCTGGCTGTTGGTTCAGGG + Intergenic
1035326420 7:158068960-158068982 TCTGGCAGGCAGCTTGGGAAGGG - Intronic
1036040324 8:5072433-5072455 TCTTGCAGGCAAATGGTAACAGG - Intergenic
1037633010 8:20675401-20675423 TCTTGCAAGAGGGTGGTGAAGGG - Intergenic
1038302277 8:26363622-26363644 ACTTGTAGGGAGTTTGTGAATGG + Intronic
1039552098 8:38450704-38450726 TCTTGCTGCCAGTGGGGGAAGGG - Intronic
1041795150 8:61739048-61739070 TCCTGCTTGCAGTGGGTGAAGGG + Intergenic
1042732559 8:71953598-71953620 TCTTCCAGTCTGTTGGTGATGGG - Intronic
1043990579 8:86748280-86748302 TATTCCAGGCAGATGTTGAAAGG + Intergenic
1044959837 8:97519500-97519522 ACTTGCAGGGAGGTGGAGAAGGG - Intergenic
1046729139 8:117706626-117706648 TCTTCCAGGGAGCTGTTGAAGGG - Intergenic
1047303619 8:123635788-123635810 TGCTGCAGGCAGCTGGGGAAAGG - Intergenic
1052913052 9:33901352-33901374 TATTTCAGGCAGGTGATGAAAGG - Intronic
1056021778 9:82445500-82445522 TCTTCCAGGCCTATGGTGAAGGG - Intergenic
1057260447 9:93580116-93580138 TCTTGCGAGAACTTGGTGAAGGG - Intronic
1057834006 9:98429639-98429661 TCTTGCAGGCAGTGGATTACAGG + Intronic
1058815042 9:108675263-108675285 TCCAGCAGACAGTTGTTGAAGGG + Intergenic
1060558671 9:124524603-124524625 TCTTTCATGCAGTTGGTGATGGG + Intronic
1203444506 Un_GL000219v1:42513-42535 TCTTGCAGCCCGGTGATGAAAGG + Intergenic
1188805834 X:34588924-34588946 TCTTGAAGACAGTAGATGAATGG + Intergenic
1189767204 X:44383988-44384010 TCTAACAGGGAGCTGGTGAATGG + Intergenic
1190245244 X:48686651-48686673 TCATGGAGGTAGTGGGTGAAGGG - Intronic
1191780256 X:64856836-64856858 TCTAGTGGGCAGTTGGTGGAGGG - Intergenic
1191861834 X:65671888-65671910 TGTTGCAGGCAGCTAGAGAATGG - Intronic
1192400832 X:70833579-70833601 TTTTTCAGGCAGTTGCTCAAGGG - Exonic
1193689433 X:84622572-84622594 TCTTGGAGGGAGTTGGGGGATGG + Intergenic
1194959377 X:100217493-100217515 TCTTTCAGTCAGTAGGTCAAGGG - Intergenic
1196512915 X:116533179-116533201 ACTTCCAGGGACTTGGTGAATGG - Intergenic
1199156428 X:144554030-144554052 TCTTGTAGGCAGTAGTTCAATGG - Intergenic
1199332859 X:146582298-146582320 TTTTGCAGGCAGATGCGGAAGGG - Intergenic
1199575448 X:149309211-149309233 TCTTGCAGGCAGAAGATGACTGG + Intergenic