ID: 920312753

View in Genome Browser
Species Human (GRCh38)
Location 1:205058256-205058278
Sequence CATGAACCCCACCAAGGCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920312741_920312753 18 Left 920312741 1:205058215-205058237 CCAGGTTCCCGTCACCAGCTGGT 0: 1
1: 0
2: 0
3: 6
4: 125
Right 920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 150
920312749_920312753 4 Left 920312749 1:205058229-205058251 CCAGCTGGTGGGGGGCAACCTGG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 150
920312748_920312753 10 Left 920312748 1:205058223-205058245 CCGTCACCAGCTGGTGGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 237
Right 920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 150
920312747_920312753 11 Left 920312747 1:205058222-205058244 CCCGTCACCAGCTGGTGGGGGGC 0: 1
1: 0
2: 0
3: 22
4: 173
Right 920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920312753 Original CRISPR CATGAACCCCACCAAGGCAC AGG Exonic
903400089 1:23036993-23037015 CATGCACCACACCAGGCCACTGG - Intronic
904559784 1:31388697-31388719 CAGGCATCCCACCAGGGCACAGG + Intergenic
912136173 1:106662590-106662612 CATGAAAGCCACCAAGGCTTGGG - Intergenic
916314676 1:163436214-163436236 CATCAACCCCACTAATTCACTGG + Intergenic
917444058 1:175091919-175091941 CACCAACCCCACAAAGCCACAGG + Intronic
919256270 1:195128727-195128749 CATGAAGCCCACAAAGGCCTGGG + Intergenic
920176493 1:204104996-204105018 TCTGAACCCCACCAACCCACAGG - Intronic
920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG + Exonic
921838280 1:219800949-219800971 CATGACCACCACCAAGGAGCTGG - Intronic
923477633 1:234349873-234349895 AATGAAGCCTACCAATGCACTGG + Intergenic
1065801131 10:29353576-29353598 CAGGAATCCTACCAAGGCCCTGG + Intergenic
1065881514 10:30041248-30041270 CATGAACACCAGGAAGACACAGG - Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067461558 10:46462059-46462081 CAAGAACCACTCCAAGGCTCTGG - Exonic
1067625636 10:47922542-47922564 CAAGAACCACTCCAAGGCTCTGG + Intergenic
1067758189 10:49022427-49022449 GATGCACCCCAAAAAGGCACGGG + Intronic
1068244147 10:54342381-54342403 CATGTAAGCCACCAAGGCATGGG - Intronic
1069556671 10:69402770-69402792 CATGGAACCCACCAAGGCTGGGG - Intergenic
1069637823 10:69936312-69936334 CATGAACCACACAGAGGCATGGG - Intronic
1070238609 10:74655787-74655809 CATCAAGCCCATCAAGGCAGAGG + Intronic
1071464979 10:85931260-85931282 GAACAACCACACCAAGGCACTGG - Intronic
1071553617 10:86585807-86585829 CATGGAGCCCACAAAGGCACTGG - Intergenic
1071962099 10:90817019-90817041 CAAGGGCCCCACCAAGGGACAGG + Intronic
1075104052 10:119525460-119525482 CATAAACCCACCCAGGGCACAGG + Intronic
1075877462 10:125819854-125819876 CATGAAACTCACCTCGGCACTGG + Intronic
1078407828 11:11086787-11086809 CATAAGCCCCACCAGGGCAGGGG - Intergenic
1078755180 11:14202340-14202362 TAAAAACTCCACCAAGGCACAGG - Intronic
1079140454 11:17805844-17805866 CATGAGCCTCACCACAGCACTGG - Intronic
1079644324 11:22844391-22844413 CATGTAACCCACCAAGGCTTGGG - Intergenic
1085033160 11:73284840-73284862 CATAAACTCCACCAGGGCAGGGG - Intronic
1085277476 11:75309309-75309331 AATGATTCCCACCAAGGCAGGGG - Intronic
1085382547 11:76133528-76133550 CATGAAGCCAACCCAGGAACTGG - Intronic
1088187375 11:107186612-107186634 CCTCAACCCCACCCAGGCTCAGG + Intergenic
1090268255 11:125368332-125368354 CATCAAGCCCACCAGAGCACTGG + Intronic
1092684626 12:11028163-11028185 CATGACCACCACCAAGGGACTGG + Intronic
1092689318 12:11089240-11089262 CATGACCACCACCAAGGGACTGG + Intronic
1092692670 12:11131065-11131087 CATGACCACCACCAAGGGACTGG + Intronic
1097420951 12:59378822-59378844 CATGATCCCCACCATGACATGGG - Intergenic
1101343043 12:103860008-103860030 CATCAGCCCCACCAGGGCCCAGG - Intergenic
1103721452 12:122977742-122977764 CATGACTCCCAACAAAGCACAGG - Intronic
1106412495 13:29520291-29520313 AGTGTACCCCACCAAGACACAGG + Intronic
1108186996 13:47897847-47897869 CCTGAAGCTCACCAAGGCAAAGG + Intergenic
1112488652 13:99842423-99842445 CCTGAACCCCATCAATGAACAGG + Intronic
1114066781 14:19066797-19066819 AATGAACACCAGCAAGGCAGAGG - Intergenic
1114095485 14:19333230-19333252 AATGAACACCAGCAAGGCAGAGG + Intergenic
1114227384 14:20751709-20751731 AAAGACCCCCACCAAGGAACTGG + Intergenic
1114233537 14:20804349-20804371 GGTGGACCCCACTAAGGCACTGG + Intergenic
1117731708 14:58728983-58729005 CCTTCTCCCCACCAAGGCACTGG - Intergenic
1119408044 14:74410995-74411017 CATAAACCCCCCCAACACACTGG + Intronic
1120197624 14:81502831-81502853 CATGAACCATACCAAAGCCCTGG - Exonic
1121081875 14:91114914-91114936 CATCAACACCAACATGGCACAGG + Intronic
1123807503 15:23889559-23889581 GATAGACCCCACCAAGGAACAGG + Intergenic
1124056638 15:26246220-26246242 AATGAATCCCTCCAAGGCAGTGG - Intergenic
1128286608 15:66442255-66442277 CCAGAACCCCACCAAGGAACCGG - Intronic
1129478804 15:75806966-75806988 CCTGAGCCCCACCATGGGACTGG - Intergenic
1130510290 15:84583378-84583400 CCTGAGCCCCACCATGGGACTGG + Intergenic
1130584791 15:85172617-85172639 CCTGAGCCCCACCATGGGACTGG - Intergenic
1130650487 15:85759669-85759691 CAGGACCCGCACCAAGGCATGGG + Exonic
1131797662 15:96036058-96036080 CATAAACCACACCTAGGTACTGG - Intergenic
1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG + Exonic
1132995495 16:2820414-2820436 GCTGACCCCCAGCAAGGCACTGG - Intronic
1133231540 16:4369356-4369378 CATGAGCCCCAGCCAGGCAGAGG + Intronic
1134820936 16:17246896-17246918 CATGTACCCCAGCAGGGAACAGG + Intronic
1136298419 16:29317119-29317141 CATGCCACCCACCAAGGCACAGG + Intergenic
1137500779 16:49010383-49010405 AATGAACCCCACCAAGGGCCAGG - Intergenic
1139033279 16:62911574-62911596 CATGAAAGCCACCAAGGCTTGGG + Intergenic
1139249107 16:65477689-65477711 CATGAAAACCACCAGGGGACTGG + Intergenic
1141896705 16:86963058-86963080 CCGGCACCCCACCAAGGCAGCGG - Intergenic
1144789148 17:17847884-17847906 CATGAAGCCCACCTAGGAGCAGG + Intronic
1145771613 17:27497287-27497309 GATGAAGCCCACCCTGGCACTGG - Intronic
1155608669 18:27637199-27637221 CATGAACTCCACAGAGGCTCTGG - Intergenic
1160494065 18:79359447-79359469 CAAGGACCTCACCAAGGTACGGG + Exonic
1162361803 19:10224860-10224882 CCTGAACCCCAACAAGGTCCAGG - Exonic
1162404221 19:10463825-10463847 CAGCAACCCCACCAAGCCGCTGG + Exonic
1163300002 19:16438948-16438970 CGTGGACCCCACCTAGACACGGG + Intronic
1163711681 19:18850891-18850913 CAGAAACCACACGAAGGCACGGG - Intronic
1167302015 19:48683500-48683522 CATGCTCCCCACCCAGGCGCTGG + Intergenic
1168469689 19:56630159-56630181 CATCAACCCCACAAGGGCAGGGG - Intergenic
928812729 2:35248594-35248616 CATGTAAGCCACCAAGGCTCAGG + Intergenic
929612815 2:43284441-43284463 CATGAAAGCCACCAAGGCTTGGG - Intronic
933749145 2:85591937-85591959 CCTCAACCCCACCAAGGAACTGG - Intronic
934748038 2:96772390-96772412 CATGCCCCCCACGTAGGCACAGG + Intronic
934748055 2:96772503-96772525 CATACCCCCCACAAAGGCACAGG + Intronic
934748102 2:96772866-96772888 CATACTCCCCACAAAGGCACAGG + Intronic
934748110 2:96772925-96772947 CATACCCCCCACAAAGGCACAGG + Intronic
936434076 2:112488058-112488080 ACTGAACCCCACCAAGGCTCTGG - Intronic
936511198 2:113149074-113149096 CCTGAAACCCAGCACGGCACTGG + Intergenic
938484179 2:131686892-131686914 AATGAACACCAGCAAGGCAGAGG - Intergenic
940333470 2:152500764-152500786 CTTGAACCCCAGCGAGGCAGAGG + Intronic
948321619 2:237074184-237074206 CGAGAACACCACCAAGGCAATGG - Intergenic
948712536 2:239833881-239833903 CATCAACCCCACCAAGGAGATGG + Intergenic
1175824806 20:61931067-61931089 CATGCACCCCACCAGGGCTGAGG - Intronic
1176303905 21:5113669-5113691 CATGAACCCGGTCTAGGCACAGG + Intergenic
1179853125 21:44148281-44148303 CATGAACCCGGTCTAGGCACAGG - Intergenic
1180084952 21:45504362-45504384 CCTGAACCCCTACAAGCCACAGG - Intronic
1180144697 21:45912702-45912724 CTCGACCCCCACCCAGGCACAGG - Intronic
1180485263 22:15789381-15789403 AATGAACACCAGCAAGGCAGAGG - Intergenic
1180709210 22:17828416-17828438 CATGAGGCCCACTAAGGGACGGG - Intronic
1182083881 22:27548247-27548269 CATGAACCCCAGAAAGGACCAGG + Intergenic
1182999637 22:34844432-34844454 GATGAACCCCGCAAAGCCACAGG + Intergenic
1183082312 22:35464319-35464341 CTTGATCCCAACCAAGGGACAGG - Intergenic
1183164791 22:36139535-36139557 CATCAGCACCACAAAGGCACAGG + Intergenic
1183975088 22:41507314-41507336 CCTCAGCCCCACTAAGGCACAGG - Intronic
950080110 3:10215946-10215968 CATAAACCTCCCCAAGGCAGGGG - Intronic
951532857 3:23714013-23714035 CATTAGCCCAACCAAGTCACAGG + Intergenic
959666847 3:108932239-108932261 TATGAACCCCACTCAGGCTCAGG - Intronic
959977335 3:112475385-112475407 CATAAAACCCCCCAAGGCACAGG + Intronic
960987378 3:123289828-123289850 CAAGACCCACATCAAGGCACTGG - Exonic
961202280 3:125055016-125055038 GTTGAACCCCTGCAAGGCACAGG - Intronic
962002298 3:131311012-131311034 CAGGAACCCCACTAATCCACAGG - Intronic
962850950 3:139307975-139307997 CATGCACACCACCCAGGCACGGG - Intronic
964926400 3:161963595-161963617 CATGTACACCACCAAGGCTTGGG - Intergenic
965115635 3:164484234-164484256 CATGAACCCCAAAAGGCCACTGG + Intergenic
967468988 3:189841108-189841130 CAAGGACACCACAAAGGCACAGG + Intronic
968323890 3:197795308-197795330 TATGAACCCCACCCTGGCATAGG + Intronic
971982016 4:33763715-33763737 CAAGAGCCCCAACAAAGCACTGG - Intergenic
971997812 4:33989131-33989153 CATGATCCCCACAAAGGCTCTGG - Intergenic
974850689 4:67402211-67402233 CATGAACACCTACAAGGGACTGG + Intergenic
978265669 4:106821521-106821543 GATGAACCCTACAAAGTCACAGG + Intergenic
978991238 4:115084677-115084699 CATGAAAGCCACCAAGGCTTGGG - Intronic
979278635 4:118840061-118840083 CATGGATCCCTCAAAGGCACTGG + Intergenic
979938212 4:126724329-126724351 CATGAACTTCAGCAATGCACAGG - Intergenic
980481303 4:133390700-133390722 CATGGGCCCCAGCAAGGCCCTGG + Intergenic
982524980 4:156466872-156466894 CATGAAAGCCACCAAGGCTTGGG + Intergenic
986083406 5:4417557-4417579 CACTAACCCCAGCAAGTCACAGG + Intergenic
986360757 5:6975803-6975825 GCTGAACCCCACCAAGTCACAGG + Intergenic
987081331 5:14427710-14427732 CATGACCCCCACCAAAGAACTGG - Intronic
994093807 5:95830841-95830863 CTTGAACCCCTCCATGGAACAGG + Intergenic
997301891 5:132812577-132812599 CATGAGCCCCACTAGGTCACGGG + Intergenic
998294290 5:140952145-140952167 ACTGAACCCCACAAAGCCACAGG - Intronic
1001366977 5:171151940-171151962 GATGAACTCCCCCAAGGAACTGG + Intronic
1002291223 5:178202322-178202344 CACTAACTCCACCCAGGCACTGG - Intergenic
1004430462 6:15538116-15538138 CATGGACATCACCTAGGCACAGG - Intronic
1006050158 6:31335994-31336016 CAAGAACCCCACCAACACATGGG - Intronic
1007589165 6:43011211-43011233 CGTGTACACCATCAAGGCACTGG + Exonic
1008902544 6:56638024-56638046 CATGTACCCAAACAAGACACAGG + Intronic
1009826079 6:68867320-68867342 CATGGAAGCCACCAAGGCATGGG - Intronic
1016935647 6:149447487-149447509 CATGAAGCCCACCAAAGTGCTGG + Intergenic
1017424536 6:154306713-154306735 CAAGAAACCTACGAAGGCACTGG - Exonic
1017684135 6:156895019-156895041 CATGAACACCACCACACCACTGG - Intronic
1019401506 7:856734-856756 CCTGACACCCACCATGGCACGGG - Intronic
1020265328 7:6556600-6556622 CCCAAACCCCACCTAGGCACAGG - Intergenic
1023891534 7:44395580-44395602 CCTCAACCCCACCAAGCCACTGG + Intronic
1024797410 7:53036009-53036031 CATGCAACCCTCCCAGGCACAGG - Exonic
1028383184 7:90222246-90222268 CATGGACCACACCAAGGGAGTGG + Intronic
1030628070 7:111865580-111865602 CAGGAACACCACCAGGGAACAGG - Intronic
1037907438 8:22723848-22723870 CATGGAGCCCAGAAAGGCACAGG - Intronic
1042663122 8:71177749-71177771 CACTACCCCCACCAAGGCAAGGG - Intergenic
1043274214 8:78373026-78373048 AATGGACCCCACAAAGGCTCTGG + Intergenic
1044933934 8:97276193-97276215 CACGAAGCCCAGCAAGTCACTGG + Exonic
1047060468 8:121219407-121219429 CATGAAAGCCACCAAGGCTTGGG + Intergenic
1053319825 9:37086831-37086853 GATGAACCACATCCAGGCACTGG + Intergenic
1054159416 9:61663586-61663608 CTACAACCCCACCAGGGCACAGG - Intergenic
1054479188 9:65594591-65594613 CTACAACCCCACCAGGGCACAGG - Intergenic
1058907636 9:109494773-109494795 CATGAATCCTTCCAAGGCAGGGG + Intronic
1062234997 9:135503515-135503537 CAGAGACCCCACCAAGGCAAGGG - Intronic
1062590733 9:137273363-137273385 CAGGACACCCACCATGGCACAGG - Exonic
1186385926 X:9110222-9110244 CATGAACCCACCAAAAGCACTGG + Intronic
1186993716 X:15096854-15096876 CATCAACCCCTGCAAGTCACTGG + Intergenic
1187614357 X:20977015-20977037 CATCAACCCCTCCAATGCATGGG + Intergenic
1189245120 X:39557484-39557506 CAGGAACCCCAGCAGGGCAAGGG + Intergenic
1191141486 X:57120608-57120630 CATGAAGACCCCCAACGCACAGG - Exonic
1191143131 X:57136576-57136598 CATGAAGACCCCCAACGCACAGG - Exonic
1192378300 X:70587475-70587497 CATGAAAGCCACCAAGGCTTGGG - Intronic
1199327155 X:146512975-146512997 CATGTACGCCACCAAGGCTTGGG - Intergenic
1199931843 X:152531002-152531024 CATGAAAGCCACCAAGGCTTGGG + Intergenic