ID: 920314941

View in Genome Browser
Species Human (GRCh38)
Location 1:205070404-205070426
Sequence TCTGGGGACCAATACAGAAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920314941_920314959 15 Left 920314941 1:205070404-205070426 CCCATTCTGTATTGGTCCCCAGA 0: 1
1: 0
2: 1
3: 6
4: 116
Right 920314959 1:205070442-205070464 TACCAAGGTGTGGGCCAAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 135
920314941_920314958 14 Left 920314941 1:205070404-205070426 CCCATTCTGTATTGGTCCCCAGA 0: 1
1: 0
2: 1
3: 6
4: 116
Right 920314958 1:205070441-205070463 CTACCAAGGTGTGGGCCAAAGGG 0: 1
1: 0
2: 0
3: 6
4: 90
920314941_920314953 6 Left 920314941 1:205070404-205070426 CCCATTCTGTATTGGTCCCCAGA 0: 1
1: 0
2: 1
3: 6
4: 116
Right 920314953 1:205070433-205070455 GGTGGCCCCTACCAAGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 103
920314941_920314949 0 Left 920314941 1:205070404-205070426 CCCATTCTGTATTGGTCCCCAGA 0: 1
1: 0
2: 1
3: 6
4: 116
Right 920314949 1:205070427-205070449 GCCCAGGGTGGCCCCTACCAAGG 0: 1
1: 0
2: 5
3: 26
4: 182
920314941_920314952 5 Left 920314941 1:205070404-205070426 CCCATTCTGTATTGGTCCCCAGA 0: 1
1: 0
2: 1
3: 6
4: 116
Right 920314952 1:205070432-205070454 GGGTGGCCCCTACCAAGGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 134
920314941_920314957 13 Left 920314941 1:205070404-205070426 CCCATTCTGTATTGGTCCCCAGA 0: 1
1: 0
2: 1
3: 6
4: 116
Right 920314957 1:205070440-205070462 CCTACCAAGGTGTGGGCCAAAGG 0: 1
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920314941 Original CRISPR TCTGGGGACCAATACAGAAT GGG (reversed) Exonic
908756364 1:67472518-67472540 TCTGGGTACCATGACAAAATTGG - Intergenic
909051875 1:70776379-70776401 TCTGGGTAAGAAGACAGAATGGG - Intergenic
912179480 1:107201254-107201276 TCTGGGAACAAATACACAAAAGG - Intronic
915768531 1:158392841-158392863 TCTGTAGGCCAATAAAGAATTGG + Intergenic
915895317 1:159807410-159807432 GCTGGGGACAGATACAGACTGGG + Intronic
916554323 1:165880635-165880657 TGTGGGGACAAATACAAAGTAGG + Intronic
917454169 1:175171366-175171388 TCTGGGCATCCAAACAGAATAGG - Intronic
917470502 1:175322349-175322371 TCTGGGGTCTAAGACAGGATGGG + Exonic
918371775 1:183868191-183868213 TTTGGGGAACAACACAGAATTGG + Intronic
920228729 1:204456401-204456423 TTGGGGGACCAAGAGAGAATTGG - Intronic
920314941 1:205070404-205070426 TCTGGGGACCAATACAGAATGGG - Exonic
921352065 1:214245976-214245998 TCTGGAGACACATACATAATGGG + Intergenic
921956002 1:220983799-220983821 TTTGGGCACCAAAACAGAAACGG - Intergenic
922238670 1:223740457-223740479 AATCGGGACAAATACAGAATGGG - Intronic
922625830 1:227041304-227041326 TCTGGGGACTACTAGAGAAGGGG - Intronic
1062861635 10:815020-815042 TCTGGAGACCACTACAGGAAGGG + Exonic
1066108623 10:32177421-32177443 TCTGGGGAGCAACTCAGATTTGG + Intergenic
1074620606 10:115116394-115116416 TCTGGAGAGCACTACACAATTGG + Intronic
1076202363 10:128568721-128568743 TCAGGGGACCGATGCATAATGGG - Intergenic
1083510759 11:63208067-63208089 TCTGGGGACTCATCCAGGATTGG + Intronic
1085681257 11:78577264-78577286 TCTGGGGAACAAGACAGTCTGGG + Intergenic
1087250385 11:95892563-95892585 TCTGGGGACCAAAATGGTATCGG - Intronic
1087584421 11:100100260-100100282 TCTGGAAACTAATCCAGAATGGG - Intronic
1087947603 11:104183020-104183042 ACTGGGGAAAAAAACAGAATTGG + Intergenic
1089322803 11:117637951-117637973 TCTGGGGGCCTCTACAGAATGGG - Intronic
1089712599 11:120326276-120326298 TCTAGGGACAGAGACAGAATTGG + Intronic
1091969121 12:4771352-4771374 TCTGGGCACCCATCCAGCATTGG - Intronic
1094403058 12:30083480-30083502 TCTGGGGACCAAAAGAGGGTTGG + Intergenic
1100928154 12:99574236-99574258 TCTCGGGAACAATACAGTAAAGG - Intronic
1103233976 12:119356562-119356584 TCTGGGGACTGATACTGTATTGG - Intronic
1104188330 12:126454085-126454107 AATCGGGACAAATACAGAATCGG - Intergenic
1107790149 13:43993968-43993990 GCTGGGGAACAATACACACTGGG + Intergenic
1108704534 13:52973360-52973382 TCTGGGGACCCTTGCTGAATTGG + Intergenic
1110663643 13:78089462-78089484 AATGGGGACAAATACTGAATGGG + Intergenic
1116595293 14:46834499-46834521 TGGGGGGACTAATTCAGAATGGG + Intergenic
1117758049 14:58996976-58996998 ACTGGGGACCTTTACAGAAAAGG - Intergenic
1118151798 14:63197398-63197420 TCTGGGGACCAACCCTCAATGGG - Intergenic
1124652705 15:31485073-31485095 TCTGGGGACCAAGACCAAGTAGG - Intronic
1124871306 15:33545742-33545764 TCTGGGGAGCATGATAGAATAGG + Intronic
1126076300 15:44913621-44913643 ACTGGGGGCCAAAACAGAATTGG - Intergenic
1126082546 15:44979381-44979403 ACTGGGGGCCAAAACAGAATTGG + Intergenic
1126390587 15:48146228-48146250 TGTGGGGTCCAATACTAAATAGG + Intronic
1129224508 15:74160455-74160477 TCGGGGGAACAACACACAATGGG - Intergenic
1137549507 16:49427620-49427642 GATGGGCACAAATACAGAATGGG + Intergenic
1141018068 16:80468781-80468803 TCCGGGAACAAACACAGAATGGG + Intergenic
1145102832 17:20090921-20090943 TCTGGAGACCCATAAGGAATAGG - Intronic
1148873784 17:50674652-50674674 TCTGTGAGCCAATCCAGAATTGG - Intronic
1151006136 17:70438211-70438233 TCTGGGAACAAATACAGGAAGGG - Intergenic
1152655345 17:81516853-81516875 TCTGGGGACCAGGTGAGAATTGG - Intronic
1152655353 17:81516897-81516919 TCTGGGGACCAGGTGAGAATTGG - Intronic
1157079304 18:44505392-44505414 ACTGCGGACCAAGTCAGAATAGG + Intergenic
1159998425 18:74991575-74991597 TTTAGTGACCAATACCGAATAGG - Intronic
1161761496 19:6176312-6176334 TCTGGGTACCCATAAAGATTGGG - Intronic
1161761626 19:6177338-6177360 TCTGGGTACCCATAAAGATTGGG + Exonic
1162822291 19:13230220-13230242 CCCGGGGACCAAGAGAGAATGGG + Intronic
1165182721 19:33986602-33986624 ACTGGGGACCACTAGAGCATCGG - Intergenic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
1168717450 19:58537790-58537812 TTTGGGGACCAGTGCAGGATAGG + Intronic
933483069 2:82881697-82881719 TCGGGGGAACAATACACATTGGG + Intergenic
939505142 2:143036366-143036388 AATCGGGACAAATACAGAATGGG - Intronic
940615484 2:156044050-156044072 AGTGGGGAACAATACACAATGGG - Intergenic
943661643 2:190565524-190565546 TCTGTGGAAGGATACAGAATTGG + Intergenic
944354716 2:198773535-198773557 TCTGATCAACAATACAGAATTGG - Intergenic
948019439 2:234718283-234718305 TCTGGGAAACAAGGCAGAATCGG - Intergenic
1170914806 20:20612574-20612596 TCTGGGGACCAAAATCAAATGGG - Intronic
1174653600 20:52151436-52151458 TCTGGGGAGTATTCCAGAATGGG + Exonic
1176949056 21:15022354-15022376 TCTGGGGAACAATACACACTGGG + Intronic
1178148601 21:29768376-29768398 TCTGGGGAGAAATACAGGACAGG + Intronic
1178810703 21:35878664-35878686 TCTGGGGACAAAGGCAGACTGGG + Intronic
1179648740 21:42792897-42792919 GCTGGGGTCCCATACAGAAGGGG + Intergenic
1180592913 22:16956050-16956072 TGTGGGCAGCAGTACAGAATGGG - Intergenic
1180667551 22:17526263-17526285 TGTGGGGACCAAAACAATATGGG + Intronic
1181390499 22:22577034-22577056 TCTGGGGAACCATAAATAATGGG - Intergenic
1182747906 22:32619782-32619804 TCTGGGGACCTAGGCAGAACTGG - Intronic
954879048 3:53821618-53821640 TCTGGGGAGCAGTAAAGAAGGGG + Intronic
955161745 3:56470042-56470064 TGTGGGGAACAAAACACAATAGG - Intergenic
956172688 3:66445033-66445055 TCTGGGAACCAAAACAGCTTCGG + Intronic
962807199 3:138936277-138936299 TCTGGGGACCCAGTGAGAATGGG + Intergenic
966960129 3:184927242-184927264 TCTGGCTATCAATACAAAATGGG - Intronic
967595894 3:191326831-191326853 CTTGGGGACCTATACAGAACAGG + Intronic
977411217 4:96667610-96667632 TCTGAGGAATAATACAGCATGGG + Intergenic
978367810 4:108000826-108000848 GCTGGGGAAGACTACAGAATCGG + Intronic
980642799 4:135601571-135601593 TCTTGGGACCATAAGAGAATAGG + Intergenic
983187417 4:164716131-164716153 TCTGAGGACCTCAACAGAATCGG + Intergenic
983245437 4:165282437-165282459 TCTGGACACGAATACATAATTGG - Intronic
986853380 5:11839276-11839298 GCTAGGGACCAATAAAGCATGGG + Intronic
987150303 5:15032537-15032559 TCTGAAGACCAAAACACAATGGG + Intergenic
989774723 5:45190716-45190738 TCTAAGGACCAAAAAAGAATTGG - Intergenic
995768145 5:115640772-115640794 CCTGGGAACTAATAGAGAATTGG + Intergenic
997304500 5:132827778-132827800 TCTGGGGAAGAGGACAGAATGGG + Intronic
999551843 5:152696095-152696117 TCTGGGGAACAGTAAAGAGTTGG - Intergenic
1000272748 5:159702292-159702314 ACTGAGGACCAAGACACAATAGG + Intergenic
1002916303 6:1530463-1530485 TCTGGGGACTAATGCTTAATTGG - Intergenic
1003755598 6:9116161-9116183 TCTGTGGAACAATAGAGAGTAGG + Intergenic
1003815536 6:9836150-9836172 TGTGGGGAACAATACACACTGGG - Intronic
1004545588 6:16595404-16595426 TCTGGGCATGAGTACAGAATTGG + Intronic
1010111916 6:72246724-72246746 TCTGGTGACCAATACAAAGAGGG + Intronic
1010467096 6:76180769-76180791 TCGGGGGAACAATACACACTGGG - Intergenic
1011773652 6:90703680-90703702 TCTGAAAACCAATATAGAATTGG - Intergenic
1015126578 6:129761874-129761896 TCTGGGGACAGATAAAGAAGTGG + Intergenic
1016371704 6:143381367-143381389 TCTGTGGCCCATTACATAATTGG - Intergenic
1018040460 6:159917087-159917109 ACTGGAGACCATTTCAGAATGGG - Intergenic
1021427779 7:20522336-20522358 TCCAGGCATCAATACAGAATTGG + Intergenic
1024504502 7:50150263-50150285 TCTGGGCACCAATTTTGAATAGG + Intronic
1031390255 7:121204524-121204546 TCTGGAGATCAATTCAGATTTGG - Intronic
1032863296 7:135902091-135902113 GCTGGGGAGGAAGACAGAATGGG + Intergenic
1037331799 8:17750240-17750262 ACTGGAGAACAATACAGAATTGG + Intronic
1037775419 8:21832470-21832492 TCTGGGGTCCTTTACAGAAAAGG + Intergenic
1038521032 8:28232167-28232189 TCTAGGGAACAATATAGAAATGG - Intergenic
1041431452 8:57785299-57785321 TCTGGGGAACAACACATATTGGG - Intergenic
1045073013 8:98530333-98530355 TCTGGGGAACAACACACACTGGG - Intronic
1046835094 8:118791736-118791758 TATGGGGCCAAAGACAGAATTGG - Intergenic
1048848995 8:138626575-138626597 TCTGGGGACAAATACAGAGTTGG - Intronic
1056206690 9:84326103-84326125 TCTGTGGAATAATACAGATTTGG + Intronic
1056515031 9:87342235-87342257 TGTGGGGAACAATACAAATTAGG + Intergenic
1057389149 9:94628440-94628462 TCTTAGGCCCAATACAGAAAAGG - Intronic
1059067017 9:111096077-111096099 TCTGGGAACCAGTGCAGAAGAGG - Intergenic
1060515373 9:124262497-124262519 TCTGTGGAAAAATCCAGAATTGG - Intronic
1060973572 9:127752653-127752675 TCTTGGGAGCAATGCAGACTAGG - Intronic
1062629162 9:137455926-137455948 TGTGGGGACCAATGCAGCAAAGG + Intronic
1186771067 X:12818628-12818650 TTTGGGGACCAATACACACATGG - Intronic
1187556105 X:20353328-20353350 GCTGGAGACCAATGGAGAATTGG - Intergenic
1189783956 X:44542847-44542869 GGTGGGGACCACTCCAGAATTGG - Exonic
1191951088 X:66593949-66593971 TGAGGGAACCACTACAGAATGGG - Intergenic