ID: 920316161

View in Genome Browser
Species Human (GRCh38)
Location 1:205076972-205076994
Sequence AGGGCCTCCTGGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 386}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920316161_920316171 16 Left 920316161 1:205076972-205076994 CCTTCCTCATTCCAGGAGGCCCT 0: 1
1: 0
2: 1
3: 55
4: 386
Right 920316171 1:205077011-205077033 TTCTTTCTGAGGGAGCTTTGAGG 0: 1
1: 1
2: 1
3: 28
4: 244
920316161_920316170 6 Left 920316161 1:205076972-205076994 CCTTCCTCATTCCAGGAGGCCCT 0: 1
1: 0
2: 1
3: 55
4: 386
Right 920316170 1:205077001-205077023 AGGAAGAGGCTTCTTTCTGAGGG 0: 1
1: 1
2: 1
3: 31
4: 312
920316161_920316169 5 Left 920316161 1:205076972-205076994 CCTTCCTCATTCCAGGAGGCCCT 0: 1
1: 0
2: 1
3: 55
4: 386
Right 920316169 1:205077000-205077022 AAGGAAGAGGCTTCTTTCTGAGG 0: 2
1: 0
2: 3
3: 55
4: 372
920316161_920316166 -8 Left 920316161 1:205076972-205076994 CCTTCCTCATTCCAGGAGGCCCT 0: 1
1: 0
2: 1
3: 55
4: 386
Right 920316166 1:205076987-205077009 GAGGCCCTGGAATAAGGAAGAGG 0: 1
1: 0
2: 5
3: 24
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920316161 Original CRISPR AGGGCCTCCTGGAATGAGGA AGG (reversed) Exonic
901061011 1:6471900-6471922 GGGGCCTCCTGGAACGGGGAAGG - Intronic
901347638 1:8560481-8560503 ATGGCCTACTGGAAAGAAGATGG + Intronic
901442705 1:9288300-9288322 GGGGCATCCTGAGATGAGGATGG + Intergenic
901879427 1:12185230-12185252 CCGGCCTCCTGGATTGAGCAAGG - Intronic
902514887 1:16984846-16984868 AGGGGTTCCAGGAATGAGGTTGG + Intergenic
902784839 1:18726270-18726292 AAGGACCCCTGGAATGGGGAGGG + Intronic
903126520 1:21251890-21251912 AGGGCCTCCTACCAGGAGGAGGG - Intronic
903165600 1:21518231-21518253 AGGTCCTCCTGGAAAGAGTTAGG + Intronic
903165642 1:21518548-21518570 AGGTCCTCCTGGAAAGAGTTAGG - Intronic
904017578 1:27434628-27434650 AGGGGCTCCTGGACTGATCAAGG + Intronic
904046838 1:27614330-27614352 CGGGCGACCTGGAGTGAGGAAGG + Intronic
904376952 1:30087603-30087625 AAGGCTTCCTGGGGTGAGGATGG - Intergenic
904379978 1:30104018-30104040 GAGGCTTCCTGGAAGGAGGAGGG + Intergenic
904449282 1:30600660-30600682 AGGGCTTCCTGGACAGAGTAGGG - Intergenic
905026985 1:34857289-34857311 AGGGCCTCCTGAATTGAAGTAGG + Intronic
906092290 1:43190969-43190991 AGGGCCTCATAGAATGAGTTGGG + Intronic
906264257 1:44416971-44416993 AAGGCAGCCTGGAATGGGGAGGG + Intronic
906686652 1:47767344-47767366 AGGGCCTCCCGGAAGCAGGGAGG + Intronic
906888861 1:49685061-49685083 AGGGCCTTCTTGAAGGTGGAAGG - Intronic
907050408 1:51326260-51326282 ATGGCATCATGGAAGGAGGATGG + Intronic
907500370 1:54875283-54875305 GGGGCCTCCTAGCATGAGGGAGG + Intronic
908512391 1:64859906-64859928 AGGGGCTGCTGCAAAGAGGATGG + Intronic
909824448 1:80109689-80109711 GGGGACTACTGGAATGGGGAGGG - Intergenic
910163388 1:84298403-84298425 GGGGCCCCCAGGAATGGGGAAGG - Exonic
910753053 1:90655140-90655162 GGGGCCTACTGGAAGGTGGAGGG + Intergenic
911409955 1:97491365-97491387 AGCACCTAATGGAATGAGGAAGG + Intronic
915314942 1:155023237-155023259 AGGGACTCCAGCGATGAGGAGGG - Exonic
916295716 1:163217072-163217094 GGGGCCTACTTGAAGGAGGAGGG + Intronic
917762488 1:178177666-178177688 AGGTCCCCATGGAATGAAGAAGG + Intronic
918561797 1:185877891-185877913 AGGGCCTACTTGAGGGAGGAGGG - Intronic
919221648 1:194638284-194638306 GGGGCCTCCTGGAAGGCGGAGGG - Intergenic
920316161 1:205076972-205076994 AGGGCCTCCTGGAATGAGGAAGG - Exonic
920672717 1:208016759-208016781 AGGGCTGCCTCAAATGAGGAGGG + Intergenic
920730091 1:208475271-208475293 AGGGCCTCTGAGAATGGGGATGG - Intergenic
921079448 1:211726784-211726806 AGGACCACATGGAATGAGGGGGG + Intergenic
921363396 1:214351348-214351370 AGGTGCTCATGGAATGAAGAGGG + Exonic
922391466 1:225147789-225147811 AGGGCCTACTGGAGGGTGGAAGG - Intronic
922660842 1:227429169-227429191 AGGGCCTCCTGGACTAGGGAGGG - Intergenic
922856691 1:228780998-228781020 AGTGCCTCCTTAACTGAGGAAGG + Intergenic
923045177 1:230350492-230350514 AAGGCATCCTGGAAACAGGAAGG + Intronic
923084201 1:230689999-230690021 GGGACCTCCTGGAATGATGATGG - Exonic
924447339 1:244145515-244145537 AGGGACACCTGGAGTGGGGATGG - Intergenic
924499121 1:244619665-244619687 GGGGCCTCCTGGTTTGGGGATGG + Intronic
1062948091 10:1475826-1475848 AAGGCCACCGGCAATGAGGAGGG + Intronic
1063699203 10:8368380-8368402 AGGGCCTATTGGAAGGTGGAAGG + Intergenic
1064026178 10:11850470-11850492 AGGGCCTCCTGGAATGTACAGGG + Intronic
1064136369 10:12754227-12754249 AGGGACTCCTGGGATGGGGCAGG - Intronic
1064984717 10:21198612-21198634 AGGGACTTCTGGAATAAGAATGG - Intergenic
1065603499 10:27393136-27393158 TGGGCCTCCTGGAAGGGGTAGGG - Intergenic
1066352938 10:34653837-34653859 AGGGTCTTCTGGAATGATCAAGG - Intronic
1067167615 10:43878152-43878174 AGGTTCTCCTGGAAGGAGGGGGG - Intergenic
1067448746 10:46368584-46368606 AGGGTCTCCAGGAATGGGGAGGG + Intergenic
1067581127 10:47446724-47446746 AGGGCTTCCTGGATGGAGGAGGG - Intergenic
1067588624 10:47492181-47492203 AGGGTCTCCAGGAATGGGGAGGG - Intergenic
1067635752 10:48000272-48000294 AGGGTCTCCAGGAATGGGGAGGG - Intergenic
1067774592 10:49153889-49153911 AGGGCCTCCAGGATTCAGTACGG - Intergenic
1067790715 10:49285488-49285510 AGGGCCTGGGGGAAGGAGGATGG + Intergenic
1067877744 10:50020049-50020071 AGGGTCTCCAGGAATGGGGAGGG + Intergenic
1067877762 10:50020116-50020138 CGGGTCTCCAGGAATGGGGAGGG + Intergenic
1068255182 10:54500284-54500306 AGGGCCTACTTGAAGGGGGAGGG + Intronic
1069566095 10:69464439-69464461 ATGGCCCCCTGGCCTGAGGACGG - Intronic
1069686303 10:70321334-70321356 AGGGCCTGCTGGAGGAAGGAGGG - Intronic
1070132311 10:73664279-73664301 AGGGTCTCCAGGAATGGGGAGGG - Intergenic
1071609369 10:87019797-87019819 AGGGTCTCCAGGAATGGGGAGGG + Intergenic
1073215117 10:101832004-101832026 TGGGCACCTTGGAATGAGGAGGG - Intronic
1073524865 10:104170870-104170892 AGAGCCTAATGGAATGAGGTTGG - Intronic
1074114345 10:110444291-110444313 AGGCCCTTTTGGAAGGAGGAGGG - Intergenic
1074706599 10:116138484-116138506 AGATCTTCATGGAATGAGGACGG - Intronic
1075659787 10:124185248-124185270 AGAGCCTGCTGGGATGGGGAGGG - Intergenic
1076030344 10:127152479-127152501 AAGGCCTCCTGGCAGCAGGAAGG - Intronic
1078302087 11:10142334-10142356 AGGTCCTCCTGCAATGTGAAAGG + Intronic
1078430550 11:11285003-11285025 AGGGCCCCTTGGACTGAAGATGG + Intronic
1080391636 11:31853268-31853290 ACACCCTCCTGGAAGGAGGAGGG + Intronic
1083278024 11:61608606-61608628 AAGGCAGCCTGGAATAAGGAAGG - Intergenic
1084461840 11:69300564-69300586 GGGGCCTGCTGGGATGAGCACGG + Intronic
1085392299 11:76188744-76188766 AGGGCCTCCTGGAAGAGGAAAGG + Intronic
1085528027 11:77175357-77175379 AGGTCGCCCTGGAGTGAGGATGG - Exonic
1087360386 11:97151279-97151301 AGGGCCTACTTGAAGGTGGAGGG - Intergenic
1087417774 11:97879884-97879906 AGGGCCTCCTGGAGGTTGGAGGG - Intergenic
1087561154 11:99792624-99792646 CTGGCCTCATGGAATGAGGTAGG + Intronic
1088616229 11:111631747-111631769 AGGCCTTCCTGGAATTAGCAGGG - Intronic
1089225748 11:116919969-116919991 AGGGCCTCCTGGTAATAGGAAGG - Intronic
1089278464 11:117355705-117355727 AGAACCTCCTGGACTGTGGATGG + Intronic
1089579946 11:119475368-119475390 AGGAACTCCTGGAGTGAGAAGGG + Intergenic
1089587622 11:119520315-119520337 AGGGACCCCAGGAATGAGGTGGG + Intergenic
1090203976 11:124874963-124874985 AGGGCCTCCAAGAGTGAGTATGG + Intronic
1090264092 11:125343138-125343160 AGGGGCTCCTGGAATGGGAGAGG + Intronic
1091010706 11:131998045-131998067 AAGGCCTCCAGGAAAGAGGAGGG - Intronic
1091049596 11:132355437-132355459 ATGTCCTCCTGGAAGGATGATGG + Intergenic
1092261984 12:6957803-6957825 AGGGACTCCCGGAATGGGGCAGG - Intronic
1092702593 12:11248678-11248700 AAGGCCTACTGAAATGAGGTTGG - Intergenic
1092852826 12:12646509-12646531 AGACACTCCTGGATTGAGGAGGG + Intergenic
1094764776 12:33580309-33580331 CGGGCCTCCTGGAATAAGTTGGG - Intergenic
1095505126 12:42888646-42888668 AGGGACTACTAGAGTGAGGAGGG - Intergenic
1095617371 12:44206801-44206823 AGGGCCTACTTGAGTGGGGAGGG + Intronic
1096220858 12:49827719-49827741 AGGGGCTGCGGGAAGGAGGAAGG - Intronic
1097968557 12:65607810-65607832 AAGGCCTCTTGCATTGAGGAAGG + Intergenic
1098663614 12:73131655-73131677 AGGGCCTACTTGAAGGTGGAGGG + Intergenic
1098785257 12:74745302-74745324 AGGGCCTGCTTGAGGGAGGAGGG - Intergenic
1099172438 12:79380825-79380847 AGGGCTTCCAGGAAGGAAGAAGG - Intronic
1099926464 12:89024590-89024612 AGGGACTACTAGAATGGGGAGGG - Intergenic
1100362587 12:93892163-93892185 AGGGCCTCCTTGAAGGAGCTCGG - Intronic
1102173029 12:110856462-110856484 AGCCCCTCCTGGAAGGAGGCGGG - Intronic
1102316742 12:111894360-111894382 AGGACCTCCTGGAAGGGGAAAGG - Intronic
1102396497 12:112590488-112590510 GGGGACTCATGGAATGAGGAGGG - Intronic
1104419960 12:128627109-128627131 AGGGCCTCCAGGGATGAGGTGGG - Intronic
1104772133 12:131370055-131370077 AGGGCTTCTTGGGATGAGGCAGG + Intergenic
1105063586 12:133176910-133176932 AGGGCCTTGTAGAATGAGGTAGG - Intronic
1106076964 13:26468572-26468594 AGAGCCTCCTTGAATGAGGGAGG - Intergenic
1106963755 13:35034527-35034549 CGGGCCTCATGGAATGAGTTTGG + Intronic
1107813679 13:44224534-44224556 AGGAGCTACTGGAATGAGTAAGG + Intergenic
1112356618 13:98678928-98678950 AGGGCCTCCTGTAAGGATGTTGG - Intergenic
1113405674 13:110037117-110037139 AGGGCCAGCTGCAATGATGATGG - Intergenic
1113693840 13:112330372-112330394 GGGGCCTCGTGGCATGTGGAGGG - Intergenic
1113697302 13:112355352-112355374 AGGGCTTCCTGGTTTGTGGACGG + Intergenic
1115735716 14:36327113-36327135 AGGGTCTGCTGGAGGGAGGAGGG - Intergenic
1120059198 14:79961753-79961775 AGGGACTACTAGAATGGGGAGGG - Intergenic
1121312358 14:92941987-92942009 ATGGGCTCCTGGGATGAGGCAGG + Intronic
1121825491 14:97006954-97006976 AGGGCATCTTGGAGTAAGGAAGG - Intergenic
1122896593 14:104760604-104760626 GGGGCTTCCTGCAATGAGGACGG + Intronic
1123069048 14:105632247-105632269 TGGGCCCCCAGGAAGGAGGATGG + Intergenic
1123073207 14:105652234-105652256 TGGGCCCCCAGGAAGGAGGATGG + Intergenic
1123093132 14:105751005-105751027 TGGGCCCCCAGGAAGGAGGATGG + Intergenic
1124651687 15:31478818-31478840 AGGGCCTCCTGGGGTGAGCGTGG + Exonic
1125499303 15:40228807-40228829 ACGGCCTTGTGGAATGAGAATGG - Intergenic
1127637078 15:60881313-60881335 GGGGCCTCCTGGCCTGATGAGGG - Intronic
1127859173 15:62978820-62978842 AGGGCCCCATTGAATGAGAATGG + Intergenic
1128215311 15:65930466-65930488 AGGGCCACCTGGTAAGAGGTGGG - Intronic
1128266089 15:66267893-66267915 AATGCCTCCTGGCATGAGGCAGG - Intergenic
1128816232 15:70610735-70610757 AGGGGATCCTGGAATGAGATGGG - Intergenic
1129300766 15:74624225-74624247 ATGGCCTCCTGGGGTGAGGTTGG + Intronic
1129387802 15:75205448-75205470 AGGGGCTCCTGGAGTGGGGATGG + Intronic
1130189463 15:81719106-81719128 GGGGCCTACTGGAAGGTGGAGGG - Intergenic
1131531286 15:93194823-93194845 GGGGCCTCCTGGAGGGTGGAGGG - Intergenic
1132379924 15:101359239-101359261 AGGGCCTACTGGAATTTGGGGGG - Intronic
1132563432 16:609399-609421 AGGGCCTCCTGATATGCAGATGG + Intronic
1132600241 16:769901-769923 ATTGCCTCCTGGGATGAGGCTGG - Intronic
1132616279 16:842549-842571 AGGTCATCCTGGATTGAGGATGG - Intergenic
1132787375 16:1665172-1665194 AGGCCCTCCTGTGAGGAGGAGGG - Intronic
1133907321 16:10034077-10034099 ACGGCCGCCTGGCATCAGGAAGG - Intronic
1133985557 16:10665566-10665588 AGGAGCTGCTGGAATCAGGAAGG - Intronic
1135620618 16:23952257-23952279 AGGCTCTCTTGGAATGAGGGGGG - Intronic
1137904215 16:52302770-52302792 GGGGCCTCCTGGAGGGTGGAGGG - Intergenic
1140774661 16:78239031-78239053 AGAGCATCCTGGAATCAGGCAGG - Intronic
1141032611 16:80602752-80602774 AGGGCCTCCAGGAATACGCAGGG + Exonic
1141881720 16:86864586-86864608 AGGGCCTCCTGGAGGGTGGAGGG - Intergenic
1142155833 16:88532545-88532567 TGGGACTCCAGGGATGAGGAAGG - Intronic
1142194449 16:88733028-88733050 AGGGTCTCCGGCAGTGAGGACGG - Intronic
1142290237 16:89190734-89190756 AGGGCCTCCTGGGATGGACACGG - Intronic
1142508513 17:380703-380725 AGGGCTTCCAGGAAGGATGAGGG - Intronic
1142619330 17:1154834-1154856 AGTGGCTGCTGGAATGGGGAAGG - Intronic
1144790418 17:17855297-17855319 GGGGCCTCCAGGTCTGAGGAGGG + Intronic
1144829263 17:18122365-18122387 AGGGGCTCCTGGGAGGAGGTCGG + Exonic
1146447507 17:32944130-32944152 GGGAACTCCTGGAATGAGGCAGG - Exonic
1146821114 17:35984271-35984293 AGGGCCTCCTGGAGGGAAGCAGG - Intronic
1146971124 17:37073231-37073253 AGGGCCTGCTGGGAGGTGGAGGG + Intergenic
1147207665 17:38849645-38849667 AGCTTCTCCTGGAGTGAGGAAGG - Exonic
1147378106 17:40035009-40035031 AGATCCTCCTGGAAAGAGGTGGG + Intronic
1147439018 17:40436221-40436243 AGGGCCTCCAGGAAAGGTGAGGG - Intergenic
1148352329 17:46950060-46950082 GGGGCCTCCTGGAGGGAGCATGG + Intronic
1148487906 17:48003206-48003228 AGCGTCTCCTGGAAGGGGGAGGG + Intergenic
1149663303 17:58347919-58347941 AGGGCCTAGTGCAAAGAGGAGGG + Intronic
1151366055 17:73617195-73617217 GGGGCCTCCTGCAGAGAGGAGGG + Intronic
1151654712 17:75490490-75490512 AGGCCCTTCTGGAATGGAGAGGG - Intronic
1152021196 17:77781220-77781242 GGGGCCTGCTGGAGTGGGGAGGG - Intergenic
1152021244 17:77781354-77781376 AGGGCCTGCTGGAGTGGGGGGGG - Intergenic
1152021253 17:77781373-77781395 AGGGCCTGCTGGAGTGGGGAGGG - Intergenic
1152021290 17:77781466-77781488 GGGGCCTGCTGGAGTGGGGAGGG - Intergenic
1152021305 17:77781503-77781525 GGGGCCTGCTGGAGTGGGGAGGG - Intergenic
1152292909 17:79450638-79450660 AGGTGCTCCTGGAATTATGATGG - Intronic
1152500058 17:80701883-80701905 ACGGCCACCTGGGAAGAGGAGGG - Intronic
1153227708 18:2910628-2910650 AGGGCCTCCTGGAGGGGGGTGGG + Intronic
1154065590 18:11104334-11104356 AGAGCCTCCTGGCTTGAGGTGGG - Intronic
1156337409 18:36183781-36183803 AGAGGCTCCTGGGATGAGGAAGG - Intergenic
1157424896 18:47576616-47576638 AGGCCCCCATGGAGTGAGGAGGG - Intergenic
1157431151 18:47627563-47627585 AGGGCCTTATTGAAAGAGGAAGG - Intergenic
1157770281 18:50339636-50339658 AGTGTCTCCTGAGATGAGGATGG - Intergenic
1158482044 18:57830745-57830767 AGGGCCACGTGGGATGAGGTTGG + Intergenic
1160070510 18:75623838-75623860 TGGGCACCCAGGAATGAGGATGG + Intergenic
1160218848 18:76957664-76957686 GGGGCCTCCTTGAGGGAGGAGGG - Intronic
1160280906 18:77489765-77489787 AGGGCCTACTGGAGGGTGGAGGG + Intergenic
1160319656 18:77878413-77878435 AGGGCCTACTGGAGGGTGGAGGG - Intergenic
1160958844 19:1708245-1708267 GGGCCCTCCTGGAAGGAGGCAGG - Intergenic
1162325450 19:9996461-9996483 TGGGCCTGCTGGAATGAGACTGG + Exonic
1162848827 19:13415075-13415097 AGGAACTACTGGGATGAGGAGGG + Intronic
1163352454 19:16786496-16786518 GGGGACTACTGGAATGGGGAAGG - Intronic
1164466225 19:28489616-28489638 AGGGCCTCCTGGCTGGAAGAGGG - Intergenic
1165136706 19:33674207-33674229 GAGGCCTCCTGGACAGAGGAGGG + Intronic
1165323370 19:35099826-35099848 AGGGCCTGCAGGCATGAGGGTGG - Intergenic
1166361046 19:42253232-42253254 AGGGCCGCCTGGAGTGGGGGAGG - Intronic
1167377540 19:49119809-49119831 GGGGTCCCCTGGGATGAGGAAGG - Intronic
1167498920 19:49834906-49834928 AGAGCCTTCTGGAATGGGGAGGG + Intronic
1167579298 19:50332477-50332499 AGGGCCTGATGGAATGTGGACGG - Intronic
1167589931 19:50398942-50398964 AGGTCCTCCTCGAATTGGGATGG - Exonic
1167596480 19:50430962-50430984 AGGGCCCCCTGCAACGGGGAAGG + Exonic
1168147564 19:54428632-54428654 AGGGACTCCTCCAATGAGAATGG - Intronic
925289892 2:2740451-2740473 AGGACCTGCTGGAGTGAGGGAGG + Intergenic
926744150 2:16136735-16136757 AGGGCTTCCTGGAGAGAGTAAGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
928817649 2:35319106-35319128 AAAGCCTCCTGTAATGAGGTGGG + Intergenic
929633987 2:43497525-43497547 AGGGCCTGTTGGAGTCAGGAAGG + Intronic
930966918 2:57340039-57340061 AGGGCCTCTTGGAGGGTGGAGGG - Intergenic
931769081 2:65481967-65481989 AGGGCCACTTGGAAGGAGGTGGG + Intergenic
932166247 2:69510201-69510223 GGGGCCTCCTTGAAGGTGGAGGG - Intronic
932297936 2:70642328-70642350 TGGGCCTCCTGGGATAAGGCAGG - Intronic
933970659 2:87467498-87467520 AGGGCCTCCTGGAAGCAGTAGGG + Intergenic
937956974 2:127427090-127427112 AGGACCACCTGGAATGGGGTGGG - Exonic
941898340 2:170653338-170653360 AGGGCCCCATGGGATGAGAAAGG - Exonic
944858565 2:203792194-203792216 AGGGCATGCTGGAAAGATGATGG + Intergenic
945790866 2:214304011-214304033 GGGGCCTACTGGAAGGTGGAGGG - Intronic
946051106 2:216863285-216863307 CGGACCTCCTGGAGTGAGGATGG + Intergenic
946075510 2:217070356-217070378 AGAGCCTTCGGGAAGGAGGAAGG - Intergenic
946103245 2:217345691-217345713 GGGGCCTACTGGAAGGTGGAGGG - Intronic
947753222 2:232543487-232543509 CAGGCCTCCTGAATTGAGGATGG - Intronic
948281840 2:236753010-236753032 TGTGTCTCCTGGAGTGAGGAGGG - Intergenic
948558377 2:238833987-238834009 AGGGCCTTTTTGAAGGAGGAAGG + Intergenic
948868926 2:240788678-240788700 GGGTCATCCTGGAAGGAGGAAGG + Intronic
1169931718 20:10840081-10840103 AGTGGGTCCTGTAATGAGGATGG + Intergenic
1170270300 20:14520052-14520074 GGGGCCTTCTGGAAAGTGGAGGG + Intronic
1172426602 20:34860073-34860095 AGGTCCTGGGGGAATGAGGAGGG + Intronic
1173594833 20:44252147-44252169 AGGGGCTCCTTGAACTAGGATGG - Intronic
1174680845 20:52406759-52406781 AGGGCCTACTTGAAGGTGGAGGG - Intergenic
1175553845 20:59833850-59833872 AGGGGCTGCTGGAAAGAGGCAGG + Intronic
1175578682 20:60081875-60081897 AGGGCCCACTGGAAAGACGATGG + Intergenic
1175873082 20:62217493-62217515 AGGGCCTCTTGGGAAGAAGAGGG + Intronic
1175894831 20:62331390-62331412 AGGGCATCTTGGAAAGAGCAGGG - Intronic
1175921034 20:62450808-62450830 AGGGGCTCCTGGGAGGAGGATGG - Intergenic
1175943713 20:62549358-62549380 AGTGCCTCCCGGACTTAGGAAGG - Intergenic
1175950454 20:62580773-62580795 AGGCCCTCCAGGAATGGGCAAGG + Intergenic
1176089857 20:63313929-63313951 GGGGCCTCCTGGAAGGGGTATGG + Intronic
1178003353 21:28189460-28189482 TGGGCCTCATGGAATGAGTTTGG + Intergenic
1178488681 21:33034252-33034274 AGGGCCTCCAGGACTCAGCAGGG - Intergenic
1178581730 21:33844145-33844167 TGGGCCTCCTGCTATCAGGAAGG - Intronic
1178924161 21:36761313-36761335 AAGGCCTGTTGGAAGGAGGAAGG - Intronic
1179825474 21:43963297-43963319 AGGACCTCCTGAACTGATGAAGG + Intronic
1179984745 21:44914085-44914107 AGGGCCTTGGAGAATGAGGAGGG - Intronic
1181584961 22:23848212-23848234 AGGGCCTCTTGGAAGGGGGTGGG - Intergenic
1182524575 22:30907247-30907269 GGGGCCTCCTAGGATGAGGAGGG - Exonic
1183107012 22:35622237-35622259 AGGGCCTGCTGGCAGGAGGGAGG - Intronic
1183320956 22:37164748-37164770 AGGGCCACCAGGAATGCAGAGGG + Intronic
1183674409 22:39291627-39291649 GGGGCCGGCTGGGATGAGGAGGG + Intergenic
1183758353 22:39791889-39791911 AGGGCCTACTTGAGGGAGGAGGG - Intronic
1184388363 22:44188923-44188945 AGGGTCTCCTGGAAGCTGGAGGG + Intronic
1184454118 22:44599407-44599429 AGGGGCCCCTGCAATGAGGCCGG + Intergenic
1184522417 22:45002925-45002947 AGGGCCTCCTGGGGAGCGGATGG - Intronic
1184593266 22:45499872-45499894 AGGGACTGCTGGGAGGAGGAGGG - Intergenic
1184785466 22:46669445-46669467 AGCGCCTCCTGGGGTGAGGGGGG - Intronic
1185058545 22:48593528-48593550 AGGGACTGCTGGGTTGAGGAGGG + Intronic
1185169437 22:49284107-49284129 GGGGTTTCCAGGAATGAGGAGGG + Intergenic
950591012 3:13935730-13935752 TGGGCCTGCTGGGAGGAGGAGGG + Intergenic
952238950 3:31510001-31510023 AGGGCCACTGGGAATGAGGCAGG - Intergenic
952372653 3:32738170-32738192 AAGGCCTCCTGGAGGGTGGAGGG + Intronic
953205757 3:40827427-40827449 AGAGCCACTTGGAAGGAGGAGGG - Intergenic
953576180 3:44114737-44114759 GTGGCCTCCTGGAGAGAGGAAGG + Intergenic
954283435 3:49601002-49601024 TGGCCCCCCAGGAATGAGGAAGG + Intronic
954329665 3:49882926-49882948 AGGGACTTGTGGCATGAGGAAGG + Intergenic
954858121 3:53664203-53664225 AGGTTCTCCAGGAATGAGGGAGG - Intronic
956051925 3:65257299-65257321 AGGGCCTCCTAGGAGGAGGTGGG + Intergenic
958961882 3:100518573-100518595 AAGGCCTGCTGGAATGAGTGTGG - Intronic
959006841 3:101029146-101029168 GGGGCCTACTGGAGTGTGGAGGG - Intergenic
959128246 3:102317619-102317641 AGGGCCTGCTTGAAAGTGGAGGG - Intronic
959945166 3:112118406-112118428 AGGGCCTCAGAGAAAGAGGAGGG - Intronic
960987796 3:123291949-123291971 GGGACCCCCTGGGATGAGGATGG + Intronic
961169505 3:124786619-124786641 AGGGAGCCCTGGAAAGAGGAAGG + Intronic
961307026 3:125965237-125965259 AGGGCCTCTTAGAAGAAGGAAGG + Intergenic
961333672 3:126157584-126157606 AGGGCCTCCTGGAGGGTGGCAGG - Intronic
961393548 3:126570634-126570656 AGGGCCTCCTGGAAGGGGCTGGG + Intergenic
961768712 3:129232261-129232283 AGGACCTCCTGTCATGGGGATGG - Intergenic
961910592 3:130312317-130312339 AGGGCCTACTGGAAGGTGAAGGG + Intergenic
961910635 3:130312723-130312745 AGGGCCTACTGGAAGGTGGAGGG + Intergenic
962484654 3:135830832-135830854 AGGCCCTCCTGGCATGACCATGG + Intergenic
963103065 3:141623815-141623837 AGGCCCTGCTGGAGGGAGGAAGG - Intergenic
964375269 3:156043078-156043100 GGGGCCTCCTTGAAGGTGGAGGG - Intronic
964555795 3:157936613-157936635 AGGGACAGCTGGAATGTGGAGGG - Intergenic
964860673 3:161197504-161197526 AGGGTCTCCTGGAAATAGAATGG + Intronic
964887256 3:161498699-161498721 AGGGACTGCTGGAATGTTGATGG + Intronic
965036716 3:163449335-163449357 AGGGCCTACTTGAAAGTGGAGGG + Intergenic
965394214 3:168142585-168142607 AGAGCCCACAGGAATGAGGATGG + Intergenic
965830560 3:172782691-172782713 GGGGCCTACTGGAAGGTGGAGGG - Intronic
965922727 3:173938713-173938735 AGGGCCTCCTCTAATCTGGAGGG - Intronic
966442717 3:179964156-179964178 AGGGCCTGCTTGAAGGTGGAGGG - Intronic
966516154 3:180822896-180822918 AGGGCCTCCTTGAAGGCAGAGGG + Intronic
966746663 3:183283468-183283490 AGGGCATTCCAGAATGAGGAAGG - Intronic
968548945 4:1212728-1212750 AGGGCCTCTTGGAAGGAGCCTGG - Intronic
969348921 4:6586916-6586938 AGGGTCCCCTGGGGTGAGGATGG + Intronic
969741960 4:9035020-9035042 ATGGCCTCGTGGGATGAGAAAGG - Intergenic
970368981 4:15389151-15389173 ATGGCCTTCTGAAATCAGGAAGG + Intronic
970369400 4:15392505-15392527 AGGGCTTCTTGGAATGTGGAAGG - Intronic
970875374 4:20862957-20862979 GGGGCCTAGTGGAATGTGGAGGG + Intronic
972572988 4:40327601-40327623 AGAACCTCCTGGGATGAGAAGGG + Intergenic
973286821 4:48427649-48427671 AGGGCCTCCTGTATTGAGCCAGG - Intergenic
974035357 4:56813460-56813482 TGGGCCTCCTGTTAGGAGGAGGG + Intronic
975683106 4:76896253-76896275 AGGGCTTCCTGGATCGAGGTGGG + Exonic
976435304 4:85011353-85011375 AGAGCCTCCTGGTCTGAAGAGGG + Intergenic
977281700 4:95047953-95047975 GGGGCCTACTGGAGTGGGGAAGG - Intronic
978086810 4:104665015-104665037 AGGGCCTCCTGGAATTAATAAGG - Intergenic
980398864 4:132253431-132253453 AGGGCCTATTGGAAGGTGGAGGG - Intergenic
983456612 4:167972750-167972772 CTGGCCTCATGGAATGAGTATGG - Intergenic
983485166 4:168324132-168324154 AAGGCCTCCTGGATGCAGGATGG - Intergenic
984764012 4:183385726-183385748 GGGGCCTCCTGGAGTGTGGAGGG + Intergenic
984870681 4:184322343-184322365 AGGGCCTTCTGGAGGGTGGAGGG - Intergenic
985658932 5:1146139-1146161 AGAGCCTTTGGGAATGAGGAGGG - Intergenic
985792804 5:1939493-1939515 AGTGCCTCCTGCAGTGGGGAAGG - Intergenic
986013645 5:3739175-3739197 AGCGCCTCCTGAGATGAGCAAGG - Intergenic
986220338 5:5763348-5763370 AGGGACTCCTGGCAAGAGGTGGG - Intergenic
986269303 5:6217404-6217426 AGTGCCTCCAGGAAGGAGGGAGG + Intergenic
986346328 5:6838765-6838787 AGGGGCTCCTGGAAGGAGGTGGG + Intergenic
986510883 5:8505129-8505151 AGGTCCCACTGGATTGAGGATGG - Intergenic
987456798 5:18157556-18157578 CAGGCTTCCTGGAATGTGGATGG - Intergenic
989339933 5:40362797-40362819 AGGGCCTACTGGAGGGTGGAGGG - Intergenic
990337998 5:54794009-54794031 AGGGCCACCGGGAGTCAGGATGG + Intergenic
990512517 5:56501455-56501477 AGGGACTCCTGGAAGCAGAATGG + Intergenic
992396303 5:76372387-76372409 ACTGCTTCCTGGAATGAGCAAGG + Intergenic
992496196 5:77296580-77296602 AGTGACTCCTGGAAGGAGAAAGG + Intronic
992744217 5:79803525-79803547 AGAGCCTGCAGGAGTGAGGAAGG - Intergenic
994469939 5:100190713-100190735 GGGGCCTACTGGAGTGTGGAGGG - Intergenic
994638242 5:102370040-102370062 AGGGCCTACTTGAAGGTGGAGGG + Intergenic
996781077 5:127187118-127187140 GGACCCTCCTGGAATGAGGTTGG + Intergenic
996991508 5:129637954-129637976 GGGGCCTACTTGAATGGGGAGGG + Intronic
998489577 5:142534576-142534598 AGAGCCTGCTGGTGTGAGGAGGG - Intergenic
998590149 5:143469431-143469453 AGGGTCTCATGGAATGAAGGAGG + Intergenic
998997538 5:147882012-147882034 AGCGCCTCCTGAAATGTAGAAGG - Exonic
999113575 5:149142177-149142199 CGGGCTGCCTGGAAAGAGGAAGG + Intronic
999434469 5:151552719-151552741 AGTGCCTCGTAGAATGAGAATGG + Intronic
999590047 5:153134988-153135010 AGGAGCCCCTGAAATGAGGAAGG - Intergenic
1001798083 5:174518805-174518827 AGGGCATCCTGCAATGTGTACGG - Intergenic
1002414351 5:179111616-179111638 AGGGCTTCCTGGCTTGAGGCTGG - Exonic
1002586788 5:180253593-180253615 AGGGCCAGCAGGAGTGAGGAAGG - Intronic
1002868939 6:1148214-1148236 TGAGCCTCCTGGAATCAGCAGGG - Intergenic
1003443063 6:6161157-6161179 CGGGCCTCCCTGCATGAGGAAGG + Intronic
1004152918 6:13137837-13137859 TGGGCCTCCTGGAATAGGAATGG + Intronic
1004174584 6:13328607-13328629 AGAGCTTCCTGGAGTGAGGGTGG - Intergenic
1004867272 6:19866431-19866453 ATAGGCTCCTGGAATGAGGATGG + Intergenic
1005478353 6:26231303-26231325 AGGGTCCTCTAGAATGAGGAAGG + Intergenic
1006634179 6:35450444-35450466 GAGGGCTCCTGGAATGAGGAAGG + Intergenic
1006793958 6:36720588-36720610 AGGGCCTCCTGGAACCAGTGGGG + Intronic
1006917394 6:37603309-37603331 CTGGTCTCCTGGAATGAGCAGGG - Intergenic
1007363765 6:41375813-41375835 AGGGCCTCCAGGCCTGGGGAGGG + Intergenic
1008853467 6:56052888-56052910 GGGGCCTACTGGAAGGTGGAGGG + Intergenic
1009193718 6:60660353-60660375 ATGGCCTCATGGAATGAGAAAGG + Intergenic
1009285262 6:61807655-61807677 AGGGCCTCCTTGAAGGTTGAGGG + Intronic
1009874562 6:69489538-69489560 GGGGCCTACTGGAAGGTGGAGGG - Intergenic
1011281458 6:85681928-85681950 AGGGCCTCCTTGAGGGTGGAGGG - Intergenic
1012145393 6:95673965-95673987 AGGGCATACTGGGAAGAGGAGGG - Intergenic
1015565621 6:134567576-134567598 AGGGTCTCCTGGGAAGAGCAGGG - Intergenic
1016848747 6:148595054-148595076 AGGGCCAGCTGGCAGGAGGAGGG - Intergenic
1016909248 6:149180974-149180996 AGGGACTCCTCTAATGAGTATGG + Intergenic
1017070089 6:150568331-150568353 AGGGCCTCCTTGTGTGGGGAGGG + Intergenic
1018156255 6:160988047-160988069 AGGGCCTATTGGAAGGTGGAGGG + Intergenic
1019010654 6:168841556-168841578 AGGTCCCCCTGGAGTCAGGAGGG + Intergenic
1019432767 7:1007104-1007126 AGGGCATCCTGGAATGGGTGGGG + Intronic
1019549991 7:1597426-1597448 AGGTCATCCTGGATTCAGGATGG - Intergenic
1019721261 7:2573122-2573144 AGGGACTCACGGAAGGAGGAGGG - Intronic
1020665949 7:11044156-11044178 GGGGCCTACTAGAATGGGGAGGG + Intronic
1022446127 7:30472196-30472218 AGGGCCTCCTGGGCTGGGTAAGG - Intronic
1022571109 7:31455087-31455109 AGGGCCTCCTTGAATTACGATGG + Intergenic
1025689048 7:63744422-63744444 TGGGCCTCCTGCAAAGAGGCAGG - Intergenic
1026025512 7:66740974-66740996 AGGGCGGCCTGGAACGGGGAAGG - Intronic
1026987085 7:74561452-74561474 AGGGTTTCCTGGAGTAAGGATGG + Intronic
1028359688 7:89952883-89952905 GGGGCCTTCTGGAAGGTGGAGGG - Intergenic
1030385091 7:108858437-108858459 TGGTCATCCAGGAATGAGGAAGG - Intergenic
1031059258 7:117031175-117031197 GGGGCCTACTTGAAGGAGGAGGG + Intronic
1032361667 7:131261977-131261999 AGGACCTACTGGAGTGTGGAGGG + Intronic
1034433790 7:151053595-151053617 AGGCCCTCCTGGGCAGAGGAAGG + Intergenic
1034556648 7:151854579-151854601 AGGGCCTCATGGAATGCTAATGG + Intronic
1034872680 7:154697494-154697516 AGGGCCACCTGGAATGCCAAGGG - Intronic
1034905900 7:154945628-154945650 TGGGCCTCCTGCAATGAGGCTGG - Intronic
1034940770 7:155228742-155228764 AGGGCCTCCTGGAGCCCGGAAGG + Intergenic
1035267706 7:157700776-157700798 AGGGGCTCCTGGTGTGGGGAAGG - Intronic
1035924319 8:3710923-3710945 TGGTCCACCTGGAAGGAGGAGGG + Intronic
1036179795 8:6574396-6574418 AGGTCCTCCTGGAGTGGGGTGGG - Intronic
1036764770 8:11542521-11542543 AGCAGCCCCTGGAATGAGGATGG + Intronic
1037822997 8:22144259-22144281 AGGGGCTCCAAGACTGAGGATGG + Intergenic
1039090213 8:33819925-33819947 AGGCCCACCTGTATTGAGGAGGG + Intergenic
1039854095 8:41397844-41397866 AGGGACACATGCAATGAGGAAGG - Intergenic
1039895992 8:41716865-41716887 AGCCCCGCCTGGAATGAGGATGG + Intronic
1040672760 8:49712452-49712474 AGGGCCTATTGGAAGGTGGAGGG + Intergenic
1041914039 8:63121694-63121716 GGGGCCTCCTTGAGGGAGGAGGG - Intergenic
1042751664 8:72164088-72164110 AGGGCCTACTGGAAGGTGGAGGG - Intergenic
1042764228 8:72302852-72302874 AGGGCCTACTGGAAGGTGGAGGG - Intergenic
1043355830 8:79411512-79411534 AGGGCCTACTGGAGAGTGGAGGG + Intergenic
1043587151 8:81782589-81782611 AGGGCCTACTTGAAGGTGGAGGG - Intergenic
1043968018 8:86501035-86501057 GGGGCCTACTAGAATGGGGAGGG + Intronic
1044769179 8:95611346-95611368 AGGGCCTACTTGAGAGAGGAAGG - Intergenic
1044950234 8:97428784-97428806 AGGGTCTCCTGCATTGAAGAGGG + Intergenic
1047085587 8:121512067-121512089 AGGGCCTCCTTAAGAGAGGATGG + Intergenic
1047169119 8:122473475-122473497 AGGGCCTACTGGAAGGTGGAGGG + Intergenic
1047228499 8:122976346-122976368 ACAGCCTCATGGAATGGGGAGGG - Intergenic
1047907301 8:129486132-129486154 TGTGCCTCCTGGAATGAGTGAGG - Intergenic
1048526097 8:135204426-135204448 AGGGACTACTGGAGTGGGGAGGG + Intergenic
1049190472 8:141284799-141284821 AGGGCCTCCTGGGGTGCGGAGGG - Intronic
1049425359 8:142535668-142535690 GGGGCCTCCTGGGCTGAGGCTGG + Intronic
1049443341 8:142619070-142619092 AGGGCCACCTGCAGTGGGGACGG + Intergenic
1050041402 9:1497777-1497799 AGGACCTACTGGAGGGAGGAGGG - Intergenic
1051903707 9:22070580-22070602 AGGGCGTCCTGGGCAGAGGAAGG + Intergenic
1053493200 9:38527037-38527059 AGGCCCTCCCGGACTGACGAAGG + Intergenic
1055007718 9:71527595-71527617 AGGATCTTCTAGAATGAGGATGG - Intergenic
1055301860 9:74890818-74890840 AGGGCCTCCTTGAGAGTGGAGGG - Intergenic
1055361958 9:75501143-75501165 AGGGCCTACTTGAAGGTGGAGGG - Intergenic
1056399786 9:86215415-86215437 AGAGGCTCCTTGAATGAGAATGG + Intergenic
1056416867 9:86385572-86385594 TGGGCTTGGTGGAATGAGGATGG + Intergenic
1056535505 9:87524221-87524243 AGGGCATGCTGGAATGTGCAGGG - Intronic
1056959500 9:91110347-91110369 AGGGCCTACTTGAAGGAAGAGGG + Intergenic
1057673885 9:97121599-97121621 AGGCCCTCCCGGACTGACGAAGG + Intergenic
1058170764 9:101678417-101678439 AGGGCCTTCTGTTCTGAGGATGG - Intronic
1059866743 9:118522731-118522753 ACAGCCTCCTGGCAGGAGGAAGG - Intergenic
1061424833 9:130492424-130492446 AGGGCCTCTAGGAGTGAGGCTGG - Intronic
1061708095 9:132468421-132468443 AAAGCATCCTGGAATGAGGCTGG - Intronic
1061798184 9:133100585-133100607 AGGCCTCCATGGAATGAGGAGGG + Intronic
1062146411 9:134992180-134992202 AGGGTCTCCCGGAAGGAGGAAGG + Intergenic
1062146438 9:134992252-134992274 AGGGTCTCCCGGAAGGAGGAAGG + Intergenic
1062146469 9:134992326-134992348 AGGGTCTCCCGGAAGGAGGAAGG + Intergenic
1062146484 9:134992360-134992382 AGGGTCTCCCGGAAGGAGGAAGG + Intergenic
1062146533 9:134992489-134992511 AGGGTCTCCTGGAAGGAGGAAGG + Intergenic
1062591325 9:137276118-137276140 GAGGCCTCCTGGAATGGGAATGG + Intergenic
1062626860 9:137447210-137447232 AGGGTCTGCTGGAGTGAGTAAGG - Intergenic
1185505128 X:627694-627716 CGAGCCTCCAGGAATGAGCATGG - Intronic
1185730178 X:2455281-2455303 GGGGCCTGCTGGAAGGTGGAGGG + Intronic
1185808973 X:3087509-3087531 AGCTCATCCTGGAATTAGGATGG - Intronic
1185816239 X:3158963-3158985 AGTGCCTTATGGAATCAGGATGG + Intergenic
1188327963 X:28830142-28830164 CTGGCCTCATGGAATGAGGTAGG + Intronic
1189548516 X:42069407-42069429 AGGGCCTGTTGGAGAGAGGAGGG + Intergenic
1191629568 X:63307397-63307419 AGGGTCTCCTTGAAGGAGGAGGG + Intergenic
1191747411 X:64504508-64504530 CGGGCCTCCTAGAATGAGTTGGG - Intergenic
1193013210 X:76701595-76701617 ATGGCCTCATGGAATGAGTTTGG - Intergenic
1193085166 X:77442408-77442430 AGGGCCTACTTGAAGGTGGAGGG - Intergenic
1193171691 X:78344771-78344793 CTGGCCTCATGGAATGAGTAGGG - Intergenic
1193244572 X:79212849-79212871 AGGTCATCATGGAAAGAGGAGGG + Intergenic
1193340533 X:80343953-80343975 AGGGCCTACTTGAGGGAGGAGGG - Intronic
1195155693 X:102121732-102121754 AGGGCCTACTTGAAGGTGGATGG + Intergenic
1196765366 X:119237070-119237092 GGGGATTCCTGGAAGGAGGAGGG + Intronic
1197176078 X:123486955-123486977 AGGGCATCCTTGAAAGATGAGGG + Intronic
1198582985 X:138087271-138087293 AGAGCCTACTGAAATGAGAAGGG + Intergenic
1199595922 X:149505622-149505644 AAGGCCTCATGGAAGGAGAATGG - Intronic
1199943509 X:152647663-152647685 AGGGCCTCCAGGAGTGCGGAGGG + Intronic
1200158622 X:153992470-153992492 AGAGCTTCCTGGAATGAGTGAGG - Intergenic
1200184897 X:154175842-154175864 AGGGCCTGCTGGCATGAGGCAGG + Intergenic
1200190550 X:154212980-154213002 AGGGCCTGCTGGCATGAGGCAGG + Intergenic
1200196301 X:154250782-154250804 AGGGCCTGCTGGCATGAGGCAGG + Intergenic
1200201956 X:154287900-154287922 AGGGCCTGCTGGCATGAGGCAGG + Exonic
1200604868 Y:5250601-5250623 GGGGCCTACTGGAAGGTGGAGGG + Intronic
1200830228 Y:7681516-7681538 AGGGCCTGAGTGAATGAGGATGG - Intergenic
1201718902 Y:17076049-17076071 AGGGCCTGCTGTAATGAGTATGG - Intergenic