ID: 920318630

View in Genome Browser
Species Human (GRCh38)
Location 1:205099067-205099089
Sequence TGCACCAGACTTCAAAGAAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920318630 Original CRISPR TGCACCAGACTTCAAAGAAT TGG (reversed) Exonic
901230093 1:7637012-7637034 GGCATCTGACCTCAAAGAATAGG + Intronic
901884088 1:12210624-12210646 TGCACAGGACATGAAAGAATGGG + Intergenic
906195432 1:43927715-43927737 TGCTTAAGTCTTCAAAGAATGGG + Intronic
906441008 1:45844669-45844691 TGCCTCAGACTTCAAACTATCGG + Intronic
907414085 1:54302066-54302088 GGCACCAGGCTGGAAAGAATGGG - Intronic
908436941 1:64116283-64116305 TGCATCAAACTTGAAAGGATGGG + Intronic
908603323 1:65765003-65765025 AGCACTAGATTTCAAAGATTTGG - Intergenic
912021036 1:105109813-105109835 TGCTCCAAACTCCAAAGATTTGG - Intergenic
912304678 1:108555291-108555313 TGCTCTATACCTCAAAGAATAGG - Intergenic
914557509 1:148781371-148781393 TGGAAAAGACTTCAAAGCATAGG - Intergenic
914615325 1:149348859-149348881 TGGAAAAGACTTCAAAGCATAGG + Intergenic
915244987 1:154550461-154550483 TGTACCAGCCTGCAAAGAAATGG + Exonic
916619865 1:166485558-166485580 TGAAGCCGACTTCAAACAATAGG - Intergenic
917927474 1:179801216-179801238 TGCACAAGGCTTCCAGGAATTGG - Intronic
920318630 1:205099067-205099089 TGCACCAGACTTCAAAGAATTGG - Exonic
921974215 1:221183249-221183271 TGCAGCAGACTTCTCAGAACTGG + Intergenic
923151084 1:231233902-231233924 TGCACCAATCTTAAAAGAAAAGG + Intronic
923916055 1:238506078-238506100 TGAACCAAACATCAAAGAAGAGG + Intergenic
1064383676 10:14870432-14870454 TGAATCAGAATTCAGAGAATAGG - Intronic
1066013623 10:31216527-31216549 TGAACCAATTTTCAAAGAATTGG - Intergenic
1067712433 10:48659637-48659659 TGCACCGGATTTGAAAGAGTTGG - Intergenic
1068647390 10:59482595-59482617 TTAACCAGATTTCAAAGAATGGG - Intergenic
1069895346 10:71677080-71677102 TGCACCAGAATGCTAGGAATGGG - Intronic
1070394805 10:76002832-76002854 TGTGCCAGACTGCAAAGAGTGGG + Intronic
1072258877 10:93647802-93647824 TGCAGCAGAATTCACAGCATAGG + Intronic
1073306200 10:102504775-102504797 GGCACGAGACTGCATAGAATGGG + Intronic
1077129480 11:963471-963493 CACACCAGACTTCAAAGACCTGG - Intronic
1078153438 11:8778246-8778268 TGCCACAGGCTTCAAAGACTAGG - Intronic
1078666067 11:13326293-13326315 TGGACCAGGCTTAAAAGACTGGG - Intronic
1079527529 11:21408405-21408427 TGCTTCAGACTACAAAGAAAAGG + Intronic
1080371650 11:31653305-31653327 GTCACCAGTTTTCAAAGAATTGG - Intronic
1083097437 11:60266192-60266214 TTCACCAGAGTGCAGAGAATGGG - Intergenic
1083105524 11:60354735-60354757 TGAAGCAAACTTCAAAAAATAGG + Intronic
1084010248 11:66344386-66344408 TGCACCTGACTTGAAAGGCTCGG + Intronic
1085085982 11:73667083-73667105 TGCATCAGACTTCATAGAAATGG + Intergenic
1085953776 11:81366135-81366157 TCCACTAGACTTCAAATAACAGG - Intergenic
1086483507 11:87271523-87271545 TACATCAGATTTCAAAGACTTGG + Intronic
1088433371 11:109782952-109782974 TGCATGAGACTTCAAAGGCTGGG - Intergenic
1089134290 11:116236994-116237016 TGCACCAAACTTTCAAGAAGAGG + Intergenic
1092464953 12:8722880-8722902 TCCGTCAGCCTTCAAAGAATTGG + Intronic
1092735933 12:11582913-11582935 TTCAGCAGACTTATAAGAATGGG + Intergenic
1093188271 12:16047160-16047182 TGCACCACACTTCTAAGAAAAGG + Intergenic
1094220412 12:27986887-27986909 TGCACCAAAACTCATAGAATTGG + Intergenic
1098482991 12:70987258-70987280 ACCAACAAACTTCAAAGAATGGG + Intergenic
1099939386 12:89167119-89167141 TACACCAGAGTCCATAGAATGGG + Intergenic
1101103875 12:101421475-101421497 TGCATCAGAGTACAAAGCATGGG - Intergenic
1102324148 12:111964594-111964616 TGGAGCAGACTTAAGAGAATGGG - Intronic
1103694815 12:122806274-122806296 TGCACCAGCATTCAATGAAAAGG + Exonic
1105399691 13:20078721-20078743 TATACAAGATTTCAAAGAATTGG + Intronic
1110422623 13:75330159-75330181 TGGAGCAAACTTCAAAGAAATGG - Intronic
1112755924 13:102633350-102633372 TACACCAAATTTCAAAGACTTGG + Intronic
1112858574 13:103802036-103802058 CCCACCAGACTGAAAAGAATGGG + Intergenic
1114536444 14:23425928-23425950 TGCACCAGAGCTCATAGAACAGG - Intronic
1116059953 14:39910360-39910382 TGCACCAGAGTTCAGAGAAGGGG - Intergenic
1119847182 14:77839354-77839376 TGCCCCAACCTTCAAAGGATGGG + Intronic
1121092002 14:91189388-91189410 TCCACCAGGCTCCAAAGCATGGG + Intronic
1121408722 14:93734771-93734793 TGGACCAGACTTCAGATAGTGGG - Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124937068 15:34183429-34183451 TGCACCAGCCTTTAAAAATTCGG - Intronic
1132931408 16:2460829-2460851 TCCACAAGACCTCAAAGAGTTGG + Exonic
1133024551 16:2982282-2982304 TGAATCAGACTTTAAAAAATGGG - Intergenic
1133343041 16:5050575-5050597 TGGACGAGACTGAAAAGAATTGG - Intronic
1134182182 16:12056674-12056696 TTCTTCAGACATCAAAGAATGGG - Intronic
1136986383 16:35109424-35109446 TGCACAAGTCTCCAAAGGATGGG + Intergenic
1140976450 16:80064327-80064349 TTCACCAGAATTCACAGAGTAGG - Intergenic
1148731857 17:49841658-49841680 TGCACCAACCCTCAAAGAACTGG - Intronic
1149150527 17:53557939-53557961 AGCAACATTCTTCAAAGAATTGG + Intergenic
1154317551 18:13317127-13317149 TGAAGCAGACATCAAAGCATCGG + Intronic
1155276086 18:24188883-24188905 AGCACCAGACTTCATTGGATTGG - Intronic
1157488415 18:48106016-48106038 TGAACCAGACTACAGAGAAATGG + Intronic
1159024553 18:63170684-63170706 TGCTCAAGACTTCAAATCATGGG + Intronic
1161829404 19:6591448-6591470 TACAGCAGACATCCAAGAATTGG + Intronic
925616497 2:5748825-5748847 TTCACCAGACTTGAAGGAAAGGG - Intergenic
926472198 2:13274512-13274534 TGGGGAAGACTTCAAAGAATGGG - Intergenic
926491680 2:13532471-13532493 TGCACCACAAAACAAAGAATGGG + Intergenic
928044563 2:27916213-27916235 AGCCCCAGAGTTCAGAGAATAGG + Intronic
929090443 2:38211538-38211560 TGCATAAGGCCTCAAAGAATAGG + Intergenic
930215323 2:48690280-48690302 TGCTGCAGAATTCAGAGAATGGG + Intronic
932799145 2:74724027-74724049 GGCAGGAGACTTCAAAGAAAAGG - Intergenic
933153892 2:78948899-78948921 TGCTCCAAATTTCAAAGAGTAGG + Intergenic
933540968 2:83642458-83642480 CCCACCAGTCTTCAAAGATTGGG - Intergenic
937517848 2:122675637-122675659 TGAGCCAGACTTTAAAGAACTGG + Intergenic
939842199 2:147202881-147202903 TGCAAATGACTTCAAAGACTAGG + Intergenic
942824049 2:180152486-180152508 TGCCCCAGAATTGTAAGAATAGG - Intergenic
944272913 2:197804129-197804151 TGGACTTGACTTCTAAGAATTGG + Intergenic
944889027 2:204098120-204098142 ACCACCAGACCTCAAAGCATGGG - Intergenic
946628835 2:221644591-221644613 TGCTCAAGACTACAAAGAAAGGG + Intergenic
1170354426 20:15476964-15476986 TCAGTCAGACTTCAAAGAATGGG - Intronic
1172732483 20:37099652-37099674 TGAACCAGATATCAAAGAATTGG + Intergenic
1173284919 20:41661586-41661608 GGCACCAGGCTTCAAGGAAAAGG + Intergenic
1173665492 20:44760064-44760086 AGAAACAGACTTGAAAGAATAGG + Intronic
1173994741 20:47329077-47329099 TGCACAACTTTTCAAAGAATAGG + Intronic
1178181471 21:30166620-30166642 TGAACCAGTCTTCAAAGTAAAGG - Exonic
1179247710 21:39648215-39648237 TGCATCAGATTTAAAAGAATTGG + Intronic
1180648890 22:17362503-17362525 TACACCAGATTTCAAAGACTTGG + Intronic
1180930627 22:19588313-19588335 TGCACCATTTTTCAATGAATTGG + Intergenic
949142876 3:656153-656175 TTCACCAGACTTCCAAGTTTTGG - Intergenic
950504119 3:13383400-13383422 TGCCACAGACATCAAGGAATTGG - Intronic
950606565 3:14086590-14086612 CACACCAGATTTCAAAGACTTGG - Intergenic
952504247 3:33993639-33993661 AGCTGCAGATTTCAAAGAATGGG - Intergenic
954926875 3:54243721-54243743 GGCTCCAGACTTCAAACAACTGG + Intronic
955649758 3:61181404-61181426 TACAACAGACCTCTAAGAATGGG + Intronic
955995752 3:64678814-64678836 TGCATCTGAATTCAAAGAAGGGG + Intronic
956227964 3:66980887-66980909 TGAACCAGAAGTCAAAGAAATGG + Intergenic
956285159 3:67600921-67600943 TGCACCAGGCTACTGAGAATGGG + Intronic
959109070 3:102100034-102100056 CACACCAGATTTCAAAGAGTTGG - Intronic
959205056 3:103297264-103297286 TGCCACAGACTTCAAAGTTTAGG - Intergenic
960096016 3:113690700-113690722 TGCACCGGACTTTAAAGGGTTGG - Intronic
961146278 3:124596565-124596587 CACACCAGATTTCAAAGACTTGG - Intronic
963377217 3:144483597-144483619 TGCTCCAGGCTTGAAAGAAAAGG + Intergenic
964442186 3:156723367-156723389 TGCACCCTACTTCACAGAGTGGG + Intergenic
966297267 3:178438913-178438935 TGTGCCAGGCTTTAAAGAATGGG + Intronic
969477881 4:7431615-7431637 TGCACCAGACTCCAAAACACAGG - Intronic
970482470 4:16490379-16490401 TGCACCTGACATTTAAGAATTGG + Intergenic
971362543 4:25951178-25951200 TGCATCAGACTTAACAGAAGTGG + Intergenic
973148596 4:46860549-46860571 TTCACCAGATGTCAAAGAAGGGG - Intronic
974596969 4:64026641-64026663 TTCACCAGGCTGCAGAGAATAGG + Intergenic
975293814 4:72708743-72708765 TGCACCAGAATCAAAAGAAAAGG - Intergenic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
977381453 4:96279328-96279350 TTCACCAGACTCCAAGGAGTTGG - Intergenic
977827196 4:101547224-101547246 TGAACCAGTTTTCAAAGAACTGG + Intronic
977830039 4:101579426-101579448 TGAAACAGATTGCAAAGAATTGG + Intronic
982954795 4:161750365-161750387 TACACCAGGTTTCAAAGACTTGG + Intronic
985053380 4:186015186-186015208 TGGATCAAACTTCAAATAATAGG - Intergenic
985541842 5:491038-491060 TGAACCAGACTCACAAGAATTGG - Intronic
987094379 5:14535070-14535092 TGAACCAGACTCCAGAGCATGGG - Intergenic
987316449 5:16729041-16729063 TGCACCAGTCCTCAATGAATTGG + Intronic
988496869 5:31752761-31752783 TGAAACAGGCTTCAAAGAAGGGG - Intronic
988801010 5:34696771-34696793 TGCAACAGACTTCTACCAATAGG - Intronic
989762834 5:45039833-45039855 TGGATTAGGCTTCAAAGAATGGG + Intergenic
996119811 5:119658437-119658459 TGTACCAGGCTTCAAACAAGTGG - Intergenic
1001451657 5:171830279-171830301 CCCACCAGACTTCAAATTATGGG - Intergenic
1001798983 5:174527008-174527030 TGCACCAGACTTCCAAGAGCTGG + Intergenic
1004241003 6:13922455-13922477 CACACCAGATTTCAAAGACTTGG - Intergenic
1008046771 6:46859265-46859287 TGCCCCAGAGGTCAAAGTATGGG + Exonic
1008165534 6:48133667-48133689 TGAACAAGACTCCAAAGTATTGG + Intergenic
1009864512 6:69380047-69380069 TGGATCATATTTCAAAGAATTGG - Intronic
1012478788 6:99644841-99644863 CACACCAGATTTCAAAGACTTGG - Intergenic
1013572710 6:111445771-111445793 TACACCAGTCTTTAAAGGATGGG + Intronic
1014382926 6:120766385-120766407 TTCACCAGACTACAATTAATTGG + Intergenic
1014896452 6:126905922-126905944 TGTTCCAGACTTGAAAGAATGGG - Intergenic
1015040689 6:128715170-128715192 TGCAACAGTATTAAAAGAATGGG + Intergenic
1016557838 6:145359335-145359357 TGCATCAGAGTTCAAGGAGTAGG - Intergenic
1018574777 6:165248365-165248387 AGCACAAGAGCTCAAAGAATAGG - Intergenic
1019403419 7:869078-869100 TACAACATACTTCAAAGAAAAGG - Intronic
1020588717 7:10106186-10106208 AGCATCAGTCTTCAAAGTATAGG + Intergenic
1020969499 7:14917707-14917729 TGCAACAGATTTTAGAGAATTGG - Intronic
1021179392 7:17488305-17488327 GGCACCAGACTCATAAGAATAGG - Intergenic
1021906921 7:25343565-25343587 TGCAGCTGACTTGAGAGAATAGG - Intergenic
1024349452 7:48348810-48348832 TGATCCAGAATTCAAAGAATTGG - Intronic
1027970743 7:85077928-85077950 TGTACCAAACTTCTAACAATAGG + Intronic
1028238991 7:88396782-88396804 ATCACCAGACTTGAAAGAAGAGG + Intergenic
1028606306 7:92660127-92660149 GGAACCAGACATCTAAGAATGGG - Intronic
1029615007 7:101650768-101650790 TGAACAAGACTTCAGAGGATTGG + Intergenic
1030738880 7:113085034-113085056 TGCTCGAGATTTCAGAGAATTGG + Intronic
1031895494 7:127343594-127343616 TTCTCCAGACCCCAAAGAATAGG + Intergenic
1034193960 7:149231644-149231666 TGCCCCACACTTCAAGGATTTGG + Intergenic
1035357848 7:158289655-158289677 AGCAGCAGACTCCAAAGAAATGG - Intronic
1037213676 8:16423485-16423507 TGCAGCAGACTTCTGAGAGTTGG - Intronic
1038329172 8:26594018-26594040 TGGACCAGGCTTCAGAGGATGGG + Intronic
1038519657 8:28219539-28219561 AACACCAGATTTCAAAGACTTGG + Intergenic
1039504397 8:38041493-38041515 AGGGCCAGACCTCAAAGAATGGG + Intronic
1041569905 8:59326178-59326200 TGCAAAATACTTCAAAGACTTGG - Intergenic
1043267424 8:78284204-78284226 TGCAACAGAGATGAAAGAATAGG - Intergenic
1044398370 8:91741257-91741279 TGCTCCAGTATTAAAAGAATGGG + Intergenic
1046991833 8:120466552-120466574 AGCACTAGATTTCAAAGAACTGG - Intronic
1051279420 9:15426487-15426509 TGCACCACAGTTCTAGGAATTGG - Intronic
1053901017 9:42795628-42795650 TGCCCCAGAGGTCAAAGTATGGG - Intergenic
1054260627 9:62861935-62861957 TGCCCCAGAGGTCAAAGTATGGG + Intergenic
1054967910 9:71050829-71050851 TGGACCTCACTTCAAAGAAGAGG + Intronic
1056252054 9:84759336-84759358 TGTGTCAGACTTCTAAGAATTGG + Intronic
1057477591 9:95415983-95416005 TGAACCAGAGTTTAAAGATTTGG - Intergenic
1187169489 X:16837159-16837181 TGCAACAGAAGCCAAAGAATTGG - Intronic
1189128917 X:38478391-38478413 TGGAGAAGACTTCCAAGAATTGG + Intronic
1191661335 X:63654630-63654652 TGCACCAGGATTCAATGAGTAGG + Intronic
1194750064 X:97673949-97673971 AACACCAGACTTAAGAGAATTGG - Intergenic
1195771079 X:108352082-108352104 TTCACCTGACTCCAAAGAAAAGG - Intronic
1196549541 X:117006366-117006388 TGGATCATACTTTAAAGAATGGG - Intergenic
1198053148 X:132968378-132968400 TGCAGCAGACTTCTGAGAAAAGG - Intergenic
1198055255 X:132988045-132988067 TGCACAAGATTTCATAGAGTAGG + Intergenic
1198395503 X:136215116-136215138 AGCACCAGACCCCAAAGACTTGG + Intronic
1201112026 Y:10806525-10806547 TGCATCAGACTGCAAAGGAATGG - Intergenic