ID: 920319575

View in Genome Browser
Species Human (GRCh38)
Location 1:205108633-205108655
Sequence CTGGGTAAAGTATCGGTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920319575_920319582 -3 Left 920319575 1:205108633-205108655 CCCAAAACCGATACTTTACCCAG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 920319582 1:205108653-205108675 CAGGTTTTGAAATCAAGAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 288
920319575_920319583 19 Left 920319575 1:205108633-205108655 CCCAAAACCGATACTTTACCCAG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 920319583 1:205108675-205108697 GTGCTATTGAGAAACTCAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 142
920319575_920319579 -6 Left 920319575 1:205108633-205108655 CCCAAAACCGATACTTTACCCAG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 920319579 1:205108650-205108672 ACCCAGGTTTTGAAATCAAGAGG 0: 1
1: 0
2: 0
3: 25
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920319575 Original CRISPR CTGGGTAAAGTATCGGTTTT GGG (reversed) Intronic
912143920 1:106768269-106768291 CTGAGTAAGGGATCAGTTTTTGG - Intergenic
920319575 1:205108633-205108655 CTGGGTAAAGTATCGGTTTTGGG - Intronic
922434867 1:225594252-225594274 CTGCGCAAAGTCTCAGTTTTGGG + Intronic
922553279 1:226513252-226513274 CTGGTTATGGTATCGATTTTGGG - Intergenic
923897090 1:238283405-238283427 CTGGGTAAAGCATCTTTTTGTGG + Intergenic
1074330852 10:112507563-112507585 TTGGGTATAGTATAGGTTTGAGG - Intronic
1087719981 11:101651765-101651787 CTGGGAAAGGAATAGGTTTTAGG + Intronic
1090806707 11:130207224-130207246 CTGGAGACAGTATTGGTTTTAGG + Intronic
1093225884 12:16482784-16482806 CTGGGTAAGGTCTCTGATTTCGG - Intronic
1098634771 12:72768857-72768879 CTTGGTAAATTATCAGTTTCAGG - Intergenic
1100339313 12:93663231-93663253 CTGGGTAAAGCATTATTTTTGGG + Intergenic
1101630210 12:106485702-106485724 TTGGGTAAAGAATAGTTTTTTGG + Intronic
1107847898 13:44536626-44536648 CTGGGTAAAGGAACTGTTTTTGG + Intronic
1118046263 14:61974658-61974680 TTGGATAAAGTATCAGTCTTTGG - Intergenic
1125930595 15:43596979-43597001 CTTGTTAAAGTATCGGGTCTAGG + Intronic
1125943763 15:43696800-43696822 CTTGTTAAAGTATCGGGTCTAGG + Intronic
1135727178 16:24864309-24864331 CTGGGAAAATTATTGGTTTCAGG + Intronic
1135797934 16:25463508-25463530 ATGAGTAAAGAATGGGTTTTGGG + Intergenic
1143262699 17:5611901-5611923 CTGGTAAGAGTATGGGTTTTAGG - Intronic
1153734330 18:8048919-8048941 CTGGGTAAAATATCAGTTCCGGG + Intronic
1156169746 18:34468324-34468346 CTGAGTAAAGTATGGGCTTTAGG - Intergenic
1159638013 18:70829477-70829499 CTGAATAAAGTATAGATTTTAGG - Intergenic
1168284089 19:55321842-55321864 CTGGGTGAAGCTTCTGTTTTGGG + Intronic
928331142 2:30358918-30358940 CTGGGCAAAGTAGCGGTGTTGGG - Intergenic
937119719 2:119432928-119432950 CTGGCTATAGAAGCGGTTTTGGG - Intronic
938211757 2:129471652-129471674 CTGGGTATAGTTTCTGTTTAGGG - Intergenic
939421697 2:141979739-141979761 CTGGGCAAAGTATAGTTATTAGG + Intronic
940139704 2:150480487-150480509 CTGGAGAAAGTATTGGTTCTTGG + Intronic
940278601 2:151965978-151966000 CTGAGTAAGGTATCAGTGTTCGG - Intronic
940395752 2:153189222-153189244 CTGGGAAAGGTGTGGGTTTTGGG - Intergenic
946912448 2:224477767-224477789 CTGGGTAAAGTATTGGTAGAGGG - Intronic
1181752967 22:25002548-25002570 CTGGCTAAAGGCTTGGTTTTTGG - Intronic
951999565 3:28770616-28770638 TCTGGTAAAGTATTGGTTTTGGG + Intergenic
952890931 3:38040182-38040204 CGGGGTAAAGGATCGGGTATGGG - Intronic
956235206 3:67061907-67061929 GAGGGTAAAGTAACTGTTTTTGG + Intergenic
958121128 3:89289915-89289937 GTGGGTAAAGTTTAGGTTTCTGG + Intronic
962346432 3:134622582-134622604 ATGGGTAGAGTTTCTGTTTTGGG + Intronic
966250707 3:177862112-177862134 CTGGGTAAAGTATTCTTGTTTGG + Intergenic
974328885 4:60450843-60450865 CTGGGTAAAGTATCATTTCTGGG + Intergenic
974362350 4:60898437-60898459 CTGGGTAAAATATCCGATATTGG - Intergenic
977047991 4:92091000-92091022 CTGGGTAAAGAATGGGGTTGAGG - Intergenic
983367568 4:166814341-166814363 ATAGGTAAAGTATTGTTTTTAGG + Intronic
986864855 5:11974404-11974426 TTTGGTAAAGGATGGGTTTTAGG - Intergenic
991369378 5:65902546-65902568 CTTGGTAAAGCATCATTTTTGGG + Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
996380858 5:122861349-122861371 CTGGGTCAAGTTTCTTTTTTTGG - Intronic
997183091 5:131852966-131852988 CTGGAAAAAGTATTGATTTTTGG + Intronic
997435301 5:133869739-133869761 CTGGGTGAAGTAACGGTCCTCGG + Intergenic
1000733936 5:164874340-164874362 CTAGGTAAACTGTGGGTTTTGGG + Intergenic
1010188709 6:73171863-73171885 CTGGGTTAAGTATGACTTTTAGG - Intronic
1010614768 6:77999277-77999299 CTTGGGAAAGTATTGTTTTTGGG + Intergenic
1011527918 6:88286363-88286385 CTGGGTAAAGTATTCTTTGTTGG + Intergenic
1013885216 6:114956601-114956623 CTCTCTAAAGAATCGGTTTTTGG + Intergenic
1021887888 7:25157801-25157823 CTGGATAAAGCATGGATTTTGGG + Intronic
1022018019 7:26369569-26369591 CTAGGTACAGTTTTGGTTTTTGG - Intronic
1022967601 7:35487883-35487905 CTGGATGAATTATCTGTTTTTGG + Intergenic
1039152655 8:34524464-34524486 CAGGGTAAAGGATAGGATTTAGG - Intergenic
1040969731 8:53122036-53122058 ATGGGTAAAGTATCCTCTTTTGG + Intergenic
1049530949 8:143154777-143154799 CTGGGTAATTTATGGTTTTTTGG - Intergenic
1050918057 9:11162356-11162378 CTGGGCACAGTGACGGTTTTGGG - Intergenic
1050998043 9:12244357-12244379 CTGTGTAAAGTATAGATATTTGG - Intergenic
1051042979 9:12837029-12837051 CTGGGTAATGAATAGGTTTATGG + Intergenic
1052424287 9:28284377-28284399 CTTTGTAAACTATTGGTTTTGGG - Intronic
1052560421 9:30077573-30077595 CTGATTAAAGTATTGTTTTTGGG - Intergenic
1052750335 9:32483607-32483629 CTGGGTAGAGTATGGGTTAGAGG - Intronic
1054953170 9:70876780-70876802 CTGGGTAAAGAATGGGTTGTGGG - Intronic
1059650933 9:116315274-116315296 CTGGGTTCAGGATGGGTTTTCGG - Intronic
1194521389 X:94922506-94922528 GTTGGTAAAGTATTGTTTTTGGG + Intergenic
1195949872 X:110258653-110258675 CTGGCTAAAGTATGCATTTTGGG - Intronic
1199182333 X:144873087-144873109 CTGGCTAAAGTTTTGTTTTTTGG + Intergenic