ID: 920322158

View in Genome Browser
Species Human (GRCh38)
Location 1:205132424-205132446
Sequence AGACAGGGCCCGTTTCCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920322158_920322163 17 Left 920322158 1:205132424-205132446 CCGTGGGGAAACGGGCCCTGTCT No data
Right 920322163 1:205132464-205132486 CACAACACAATACCATAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920322158 Original CRISPR AGACAGGGCCCGTTTCCCCA CGG (reversed) Intergenic