ID: 920322159

View in Genome Browser
Species Human (GRCh38)
Location 1:205132439-205132461
Sequence AGTGGAGCTGACTTAAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920322159_920322163 2 Left 920322159 1:205132439-205132461 CCCTGTCTTAAGTCAGCTCCACT No data
Right 920322163 1:205132464-205132486 CACAACACAATACCATAGAGTGG No data
920322159_920322165 18 Left 920322159 1:205132439-205132461 CCCTGTCTTAAGTCAGCTCCACT No data
Right 920322165 1:205132480-205132502 AGAGTGGCTGAGTTAAACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920322159 Original CRISPR AGTGGAGCTGACTTAAGACA GGG (reversed) Intergenic