ID: 920322160

View in Genome Browser
Species Human (GRCh38)
Location 1:205132440-205132462
Sequence CAGTGGAGCTGACTTAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920322160_920322165 17 Left 920322160 1:205132440-205132462 CCTGTCTTAAGTCAGCTCCACTG No data
Right 920322165 1:205132480-205132502 AGAGTGGCTGAGTTAAACAACGG No data
920322160_920322163 1 Left 920322160 1:205132440-205132462 CCTGTCTTAAGTCAGCTCCACTG No data
Right 920322163 1:205132464-205132486 CACAACACAATACCATAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920322160 Original CRISPR CAGTGGAGCTGACTTAAGAC AGG (reversed) Intergenic