ID: 920322163

View in Genome Browser
Species Human (GRCh38)
Location 1:205132464-205132486
Sequence CACAACACAATACCATAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920322158_920322163 17 Left 920322158 1:205132424-205132446 CCGTGGGGAAACGGGCCCTGTCT No data
Right 920322163 1:205132464-205132486 CACAACACAATACCATAGAGTGG No data
920322160_920322163 1 Left 920322160 1:205132440-205132462 CCTGTCTTAAGTCAGCTCCACTG No data
Right 920322163 1:205132464-205132486 CACAACACAATACCATAGAGTGG No data
920322159_920322163 2 Left 920322159 1:205132439-205132461 CCCTGTCTTAAGTCAGCTCCACT No data
Right 920322163 1:205132464-205132486 CACAACACAATACCATAGAGTGG No data
920322157_920322163 22 Left 920322157 1:205132419-205132441 CCAGGCCGTGGGGAAACGGGCCC No data
Right 920322163 1:205132464-205132486 CACAACACAATACCATAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920322163 Original CRISPR CACAACACAATACCATAGAG TGG Intergenic