ID: 920327268 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:205175377-205175399 |
| Sequence | GCAGCTTCTGGCGGGCACGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 318 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 30, 4: 286} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920327268_920327277 | 25 | Left | 920327268 | 1:205175377-205175399 | CCACCGTGCCCGCCAGAAGCTGC | 0: 1 1: 0 2: 1 3: 30 4: 286 |
||
| Right | 920327277 | 1:205175425-205175447 | AACAAAAATGGATAGAAAACAGG | 0: 1 1: 0 2: 6 3: 76 4: 907 |
||||
| 920327268_920327275 | 13 | Left | 920327268 | 1:205175377-205175399 | CCACCGTGCCCGCCAGAAGCTGC | 0: 1 1: 0 2: 1 3: 30 4: 286 |
||
| Right | 920327275 | 1:205175413-205175435 | TACCTTGTACTAAACAAAAATGG | 0: 1 1: 0 2: 1 3: 24 4: 245 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920327268 | Original CRISPR | GCAGCTTCTGGCGGGCACGG TGG (reversed) | Intronic | ||