ID: 920327268

View in Genome Browser
Species Human (GRCh38)
Location 1:205175377-205175399
Sequence GCAGCTTCTGGCGGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920327268_920327277 25 Left 920327268 1:205175377-205175399 CCACCGTGCCCGCCAGAAGCTGC 0: 1
1: 0
2: 1
3: 30
4: 286
Right 920327277 1:205175425-205175447 AACAAAAATGGATAGAAAACAGG 0: 1
1: 0
2: 6
3: 76
4: 907
920327268_920327275 13 Left 920327268 1:205175377-205175399 CCACCGTGCCCGCCAGAAGCTGC 0: 1
1: 0
2: 1
3: 30
4: 286
Right 920327275 1:205175413-205175435 TACCTTGTACTAAACAAAAATGG 0: 1
1: 0
2: 1
3: 24
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920327268 Original CRISPR GCAGCTTCTGGCGGGCACGG TGG (reversed) Intronic