ID: 920327487

View in Genome Browser
Species Human (GRCh38)
Location 1:205177423-205177445
Sequence ATTCTCATGGGGCATTTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920327480_920327487 19 Left 920327480 1:205177381-205177403 CCCATATTCTAGCTACTTTACTT 0: 1
1: 0
2: 2
3: 24
4: 284
Right 920327487 1:205177423-205177445 ATTCTCATGGGGCATTTGAAAGG 0: 1
1: 1
2: 0
3: 21
4: 196
920327481_920327487 18 Left 920327481 1:205177382-205177404 CCATATTCTAGCTACTTTACTTC 0: 1
1: 0
2: 0
3: 17
4: 272
Right 920327487 1:205177423-205177445 ATTCTCATGGGGCATTTGAAAGG 0: 1
1: 1
2: 0
3: 21
4: 196
920327482_920327487 -4 Left 920327482 1:205177404-205177426 CCAATTCTCCTCTCGTGACATTC 0: 1
1: 0
2: 0
3: 5
4: 145
Right 920327487 1:205177423-205177445 ATTCTCATGGGGCATTTGAAAGG 0: 1
1: 1
2: 0
3: 21
4: 196
920327478_920327487 26 Left 920327478 1:205177374-205177396 CCTTGTCCCCATATTCTAGCTAC 0: 1
1: 0
2: 0
3: 17
4: 180
Right 920327487 1:205177423-205177445 ATTCTCATGGGGCATTTGAAAGG 0: 1
1: 1
2: 0
3: 21
4: 196
920327479_920327487 20 Left 920327479 1:205177380-205177402 CCCCATATTCTAGCTACTTTACT No data
Right 920327487 1:205177423-205177445 ATTCTCATGGGGCATTTGAAAGG 0: 1
1: 1
2: 0
3: 21
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920327487 Original CRISPR ATTCTCATGGGGCATTTGAA AGG Intronic
900499621 1:2995484-2995506 ATTCTAATGGGGTATTTTATGGG + Intergenic
901329328 1:8392893-8392915 ATTCTCTGGGGGCATTTTCAAGG + Intronic
902769876 1:18639670-18639692 ATTCTTGTGGGGAATTTGATAGG + Intronic
903562462 1:24238171-24238193 ATTCTCATGGGAGAGTTCAAAGG - Intergenic
905442384 1:38003914-38003936 GTTGGCATGGGGCATTGGAAAGG - Intronic
906316853 1:44791940-44791962 CCTCTCATGGGGAATTTAAAAGG - Intergenic
906647086 1:47483055-47483077 ATACTAATGGGGCTTTAGAAGGG - Intergenic
907599277 1:55750404-55750426 ACTCTGATTAGGCATTTGAAAGG + Intergenic
907784640 1:57599672-57599694 CTGGTCATGGGGCATTTCAAGGG + Intronic
910581520 1:88831369-88831391 ATTCTCAATGGGAATTTCAATGG - Intronic
912051160 1:105529294-105529316 TTGCACATGGGGCCTTTGAAAGG - Intergenic
913247756 1:116885201-116885223 ATTATCATGTGGCATTTGGTAGG + Intergenic
915685132 1:157624997-157625019 GATCTGATGAGGCATTTGAAGGG - Intergenic
917136420 1:171792239-171792261 CTGCTCTTGGAGCATTTGAAGGG + Intronic
920327487 1:205177423-205177445 ATTCTCATGGGGCATTTGAAAGG + Intronic
920586334 1:207165978-207166000 ATTCTTCTGGGGCATTTGGAAGG + Intergenic
922072704 1:222211786-222211808 ATTCTCATGTGGCTTCTCAAGGG + Intergenic
922477390 1:225916031-225916053 ATTCTCATGTGGCCTTTCAGAGG + Intronic
922626419 1:227049521-227049543 TTTCACATGGGGCTTTTGATTGG - Intronic
1063709341 10:8462097-8462119 ATTCTGAGGGGGTATTTCAAAGG + Intergenic
1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG + Intergenic
1067750947 10:48970505-48970527 ATTCCCATGGTGCATTTGACAGG + Intronic
1072846422 10:98836368-98836390 ATTTGCATGGGGTATTTGAAGGG - Intronic
1073607778 10:104913729-104913751 AGTCTCATGAGGCATTTGTGAGG - Intronic
1073839360 10:107480722-107480744 TTTCACATGGGGTATTTGTAGGG + Intergenic
1074003513 10:109395114-109395136 TTTCTCATGGAGCATCTTAATGG - Intergenic
1075263138 10:120979977-120979999 ATTTTTATGTGGCATTTCAAAGG + Intergenic
1076193497 10:128499084-128499106 TTTCTCGGGGGCCATTTGAATGG + Intergenic
1077114896 11:879720-879742 ATTCTGGTTGGGCTTTTGAAAGG - Intronic
1077236112 11:1482732-1482754 ATTCCCATGGGGCAGGTGGACGG + Intronic
1078596017 11:12687567-12687589 GTTTTCTTGTGGCATTTGAAGGG + Intronic
1083840714 11:65302596-65302618 ATTCTAAGGGGCAATTTGAAGGG - Intronic
1085993480 11:81881005-81881027 ATTCTCATAGGGAAAATGAAAGG - Intergenic
1087817950 11:102679603-102679625 ATTCCCCTGAGGCAATTGAAAGG - Intergenic
1089798337 11:121002036-121002058 AGTCCTATGTGGCATTTGAAAGG + Intergenic
1090358090 11:126153990-126154012 AGTCTCATGGGGCATCAGAAGGG + Intergenic
1090997030 11:131876052-131876074 ATTTTCTTGTGGCATTTGAAGGG + Intronic
1096595044 12:52689742-52689764 ATTCTCTTGGGGCATTGGATGGG - Exonic
1099131400 12:78836773-78836795 ATTCTAATAGAACATTTGAATGG + Intergenic
1099915688 12:88890031-88890053 TTTCTCTTGGGGCATTTATATGG + Intergenic
1101451951 12:104787809-104787831 CTTCTTATGGTGCATTTCAAAGG + Intergenic
1106214031 13:27678366-27678388 CTTCTCGAGGGGCATCTGAATGG - Intergenic
1108540817 13:51443274-51443296 ATTTTCATAGGGCTTTAGAATGG - Intronic
1109017067 13:57030381-57030403 ATTGTCATGAGACATTTGTAAGG - Intergenic
1110247668 13:73344584-73344606 CTTCTCAAAGGGCATTTCAAAGG + Intergenic
1111564687 13:89999459-89999481 ATTCTCTTGGGGAATTAGGATGG - Intergenic
1114825395 14:26071504-26071526 ATTATCCTGGGGCCCTTGAATGG + Intergenic
1116778667 14:49211754-49211776 ATTCTCTTGGATTATTTGAATGG - Intergenic
1117012312 14:51483416-51483438 ATGGTGATGGGGCATTTGAAGGG + Intergenic
1118459022 14:65971503-65971525 ATTCCCATGGGGCATTGACAGGG + Intronic
1120629270 14:86869794-86869816 ATTGTATTGGGGCATTTGCAAGG - Intergenic
1122052517 14:99069776-99069798 ATTTTCTTGGGGCCTTTCAATGG - Intergenic
1122090356 14:99334437-99334459 TTTCCCATGGAACATTTGAAAGG + Intergenic
1122561878 14:102621308-102621330 CTTCTTAGGAGGCATTTGAATGG + Intronic
1123145350 14:106124497-106124519 TTTATCATGGGGCATTTGCAGGG - Intergenic
1123161065 14:106278318-106278340 CCTCTCATGGGGCATCTGCAGGG - Intergenic
1123482060 15:20641230-20641252 CTTCTCATGGGGCATCTGCAGGG - Intergenic
1123585390 15:21755672-21755694 TTTATCATAGGGCATTTGCAGGG - Intergenic
1123622037 15:22198281-22198303 TTTATCATAGGGCATTTGCAGGG - Intergenic
1123635955 15:22359138-22359160 CTTCTCATGGGGCATCTGCAGGG + Intergenic
1126069215 15:44851098-44851120 CTTCCCATGTGGCATTTGAGGGG + Intergenic
1126089598 15:45039674-45039696 CTTCCCATGTGGCATTTGAGGGG - Intronic
1128899602 15:71408540-71408562 ATTCTTATGAGGAATTTTAAAGG + Intronic
1129003651 15:72354441-72354463 ATTTTCATGGGGCTTCTGCAGGG - Intronic
1130097860 15:80869451-80869473 ATTCTCATATGTCATTTTAAGGG + Intronic
1130567161 15:85006292-85006314 ATTCTCATGGGTCCTTTCAGAGG + Intronic
1132787211 16:1664087-1664109 AGTGTCCTGGGGCATTTCAAAGG + Intronic
1133977942 16:10613315-10613337 ATTATTATGGGGCCTTTGTAGGG - Intergenic
1135868781 16:26129595-26129617 CTTCTCATGGGGAGTTTGAGAGG - Intronic
1136693755 16:32057286-32057308 TTTATCATGGGGCATTTTCAGGG + Intergenic
1136794243 16:33000521-33000543 TTTATCATGGGGCATTTTCAGGG + Intergenic
1136875664 16:33853858-33853880 TTTATCATGGGGCATTTTCAGGG - Intergenic
1138109875 16:54315292-54315314 TTTCTAATGGGGCTTTTGGAGGG - Intergenic
1139083603 16:63557742-63557764 AATATCATATGGCATTTGAAGGG - Intergenic
1140621481 16:76738883-76738905 ACACTCATGTGGAATTTGAAGGG - Intergenic
1203096507 16_KI270728v1_random:1262202-1262224 TTTATCATGGGGCATTTTCAGGG + Intergenic
1146282098 17:31551273-31551295 CTTCTCATCAGGAATTTGAAGGG - Intergenic
1147567597 17:41547324-41547346 ATTCCAATGGGGCAGTTGGAGGG - Intergenic
1149531840 17:57401921-57401943 AGTCTCCTTGGGCATTTGACAGG - Intronic
1149956215 17:61053559-61053581 AATCTAATGTGACATTTGAAAGG - Intronic
1151308274 17:73277894-73277916 ATTCTCGTGGGACCTTTGAAGGG - Intergenic
1153855740 18:9144359-9144381 ATTCTTCTGGGGTTTTTGAAGGG - Intronic
1160140676 18:76319162-76319184 ATTCTCATTGTGCATTTTATGGG - Intergenic
1160358566 18:78249692-78249714 ATTCTCAAGGTGCTTTTAAATGG - Intergenic
1162161526 19:8721392-8721414 ATGCTCATGGGGCATTGAGAGGG + Intergenic
925229580 2:2221134-2221156 TTTTTCATGGGGGCTTTGAAAGG + Intronic
927208831 2:20626516-20626538 TTCCTCATGGGACATTTGGAGGG - Intronic
927855266 2:26523796-26523818 CTTCTCATGGGGCAGCTGAGTGG - Intronic
928167949 2:28984352-28984374 TTTCTCATGGGCCATTGGGAAGG + Intronic
928700707 2:33895922-33895944 ATTATCCTGGAGCATTTGAGTGG + Intergenic
929118520 2:38465032-38465054 ATTTACATGGGGCATTTACATGG - Intergenic
929685495 2:44030426-44030448 GTTCCCATGAGGCATTTCAATGG + Intergenic
929800456 2:45095955-45095977 ATTCTGAGTGGGAATTTGAAGGG - Intergenic
930885987 2:56327438-56327460 ATTTTATTGGGGCATTTTAAGGG - Intronic
931743693 2:65273030-65273052 ATTTTCATGGACCAGTTGAAAGG + Intergenic
932781867 2:74563856-74563878 ATTTTCATGGCTCATTTAAAAGG - Intronic
933785228 2:85834808-85834830 ATTTTTATGAAGCATTTGAATGG - Intergenic
934512271 2:94954916-94954938 CCTCTCATGGGGCATCTGCAGGG - Intergenic
935644602 2:105323744-105323766 ATTCCCATGGGGGGTTTGATAGG + Intronic
936408849 2:112235862-112235884 ATAGTCATGAGGCATTTCAAAGG - Intronic
936554651 2:113484521-113484543 ATCCTCATGAAGCATTTGATGGG - Intronic
938674145 2:133613952-133613974 AATCTTCTGGGGCATTTGCAGGG + Intergenic
938928225 2:136063658-136063680 ATTTTCTTGGAGCATTTAAAGGG - Intergenic
939399944 2:141679110-141679132 ATTCTCATTGGCTATTGGAAAGG - Intronic
943930217 2:193841138-193841160 ATTCTCATGGGACAACAGAAAGG - Intergenic
944630731 2:201621285-201621307 ATTGTCATGGGAAATTAGAATGG + Exonic
945110846 2:206357883-206357905 CCTCTCATGGGGAATTTAAAAGG + Intergenic
945178374 2:207066392-207066414 TTTCTCATGGGAAATTGGAATGG + Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
947041917 2:225932236-225932258 ATTCTCATAGGCCATTATAAAGG - Intergenic
1169688804 20:8307241-8307263 ATTCTGAGGGGTCAGTTGAAAGG + Intronic
1173472018 20:43331499-43331521 ATTCTCATGGGGCAATTGTGAGG - Intergenic
1176202401 20:63867656-63867678 AGTCCTATGGGACATTTGAAGGG + Intronic
1177826109 21:26085177-26085199 CTTCCCATGGGACCTTTGAATGG - Intronic
1178118059 21:29437437-29437459 ATCCTCATGAGGAATGTGAAAGG - Intronic
1178271895 21:31198244-31198266 ATTTGCTTGGGGCATTTGAAAGG + Intronic
1181869548 22:25886909-25886931 CTTCTCATAAGGTATTTGAAGGG + Intronic
1184360849 22:44017751-44017773 ATCCTCATGGGGGATGTGAATGG - Intronic
950409366 3:12825289-12825311 ATTCTTATCTGGCCTTTGAAGGG + Intronic
951714053 3:25620149-25620171 ACTCTCATGGGGAATTAAAAAGG + Intronic
956578472 3:70782271-70782293 CTTCTCAAGCAGCATTTGAAAGG - Intergenic
960047699 3:113212878-113212900 ATTTTCATGGGGGTGTTGAAGGG + Intronic
960379005 3:116936967-116936989 AGCATCATGGGGCATTTGCAAGG - Intronic
962727851 3:138251295-138251317 ATTCTAAATGGGCATTTAAAGGG + Intronic
963921883 3:150913595-150913617 ATACTCATGAACCATTTGAAAGG - Intronic
964054154 3:152432181-152432203 AATCTCATGGGGTATGTGAAAGG - Intronic
964908304 3:161745541-161745563 ATTCTCATGGGGCATTTGGAGGG - Intergenic
972656303 4:41066862-41066884 ATTCTCTGGGTGGATTTGAAGGG + Intronic
973304267 4:48627037-48627059 ATCCTCATGTTGCATGTGAATGG - Intronic
973323801 4:48836944-48836966 ATTTTCATGGCTCATTAGAATGG + Intronic
973728269 4:53797642-53797664 ATCCTCATGGGGCATTTTAGAGG - Intronic
976126699 4:81840754-81840776 ATGCTTATGGGACATTTGAATGG - Intronic
977337975 4:95721834-95721856 TTACTCATGGGGCAGTTTAACGG + Intergenic
978833217 4:113114825-113114847 ATTCTAAAGGGGCAGTGGAAAGG + Intronic
980404814 4:132343174-132343196 CTTCTCATGGGGTATTTTACTGG + Intergenic
980798505 4:137716512-137716534 CTTCTCATTGGGCAGTTTAATGG - Intergenic
981779822 4:148415572-148415594 ATTCTCAGGGGGCATGTGCAGGG + Intronic
981936628 4:150246602-150246624 TTTCTCATGGGGCCTTGTAATGG + Intronic
982336181 4:154241165-154241187 ATCTTCATGGGGGATATGAATGG + Intronic
984302886 4:177946365-177946387 ATTCTCATGAGGGATTTTATAGG + Intronic
984381226 4:178995721-178995743 ATTTTCATGGGCCATTTCCAAGG - Intergenic
984476008 4:180236177-180236199 TTTCTCATGGGGCTCTTGTAAGG - Intergenic
985958127 5:3279571-3279593 TTTCTCATGGGGCTTTGAAATGG - Intergenic
986594390 5:9405634-9405656 TGTCTCTTGGGGCATTTGCAAGG + Intronic
988728113 5:33943581-33943603 CTCATCATGGGGCAGTTGAAGGG + Intergenic
989480947 5:41929397-41929419 TCTCTCATGGAACATTTGAATGG - Intronic
990138915 5:52681161-52681183 CTTCTCATGGAGTATTTTAATGG + Intergenic
993118226 5:83743141-83743163 GTTCTCATGGGGGATATTAATGG + Intergenic
993678864 5:90850344-90850366 CCTCACATGGGGCTTTTGAAAGG + Intronic
993916201 5:93744766-93744788 TTTGTGCTGGGGCATTTGAAAGG + Intronic
999410401 5:151345223-151345245 GTTCTCATGGGGAATTTCCAAGG - Intronic
1000794909 5:165653218-165653240 ATTCTCATGGGATATCTGATAGG - Intergenic
1001399607 5:171438689-171438711 TTTCTAATGTGGCATTTAAATGG - Intronic
1004276517 6:14241200-14241222 TATCTCAAGGGGCGTTTGAATGG - Intergenic
1006238894 6:32660469-32660491 ATTCTTCTGGGGAATATGAAGGG + Intronic
1006940845 6:37751365-37751387 ATTCACATTAGGTATTTGAATGG - Intergenic
1008487724 6:52053620-52053642 ATTCTCATGGGTCTTGTAAATGG - Intronic
1010837571 6:80609087-80609109 ATTCTTATGTGTCATTTAAAAGG - Intergenic
1010934315 6:81843317-81843339 ATTTTCTTGTAGCATTTGAAAGG - Intergenic
1010938918 6:81892727-81892749 AGTCTCATGGGGCTTATAAAAGG - Intergenic
1014307937 6:119765767-119765789 ATTTTCCTAGGCCATTTGAATGG + Intergenic
1014320648 6:119924483-119924505 CTTGTCATGGGGGATATGAATGG + Intergenic
1015360920 6:132338432-132338454 ATTCCCCTGGGGCAGGTGAAAGG + Intronic
1016157807 6:140834612-140834634 ATTCTCATGTGTCAATTCAATGG - Intergenic
1016554944 6:145325998-145326020 ATGATCATGAGGCATTTGCAGGG - Intergenic
1017155501 6:151319624-151319646 ATTATCTTGGAGCATTTCAAAGG + Intronic
1018192781 6:161325228-161325250 ATACATATGGGGAATTTGAAAGG + Intergenic
1019793379 7:3032078-3032100 ATTCTCATGCGTCTTTTGATAGG - Intronic
1021402195 7:20222271-20222293 ATTCTAATGGGGTATTGGATGGG - Intergenic
1021696134 7:23278090-23278112 ATTCTGATGGGGCTTTTGGTGGG + Intergenic
1022804016 7:33803871-33803893 ATTTTCTCAGGGCATTTGAACGG + Intergenic
1023106487 7:36767986-36768008 ATACTCATGGTGCATCTCAAAGG + Intergenic
1023322659 7:39015017-39015039 ATTCTCAGTGGTCATCTGAATGG - Intronic
1023355785 7:39366038-39366060 ATGCTTATGGGGCAATAGAAAGG + Intronic
1023643506 7:42284847-42284869 ATTTTCATGGGCCACTTAAAGGG - Intergenic
1031110327 7:117599847-117599869 ATGCTCATGAGACATTTCAATGG - Intronic
1031289823 7:119919852-119919874 ATAATAATGAGGCATTTGAATGG - Intergenic
1034452718 7:151145930-151145952 ATGCTCATGGTGCTTTAGAAAGG - Intergenic
1035071781 7:156150254-156150276 ATTCTGATGGGCCCCTTGAAAGG - Intergenic
1035303899 7:157917307-157917329 ATTGGCGTGGAGCATTTGAAAGG + Intronic
1035599320 8:887861-887883 CTTCTCATGGAGCATCTTAATGG + Intergenic
1036217308 8:6891424-6891446 GTTCTCATGGGGCTTAGGAAAGG + Intergenic
1036219163 8:6906450-6906472 ATTCTCATGGCACATCTGAGAGG + Intergenic
1038132942 8:24753714-24753736 ATTATTATGTGGCACTTGAATGG - Intergenic
1040881922 8:52214728-52214750 ATTTTCTGGGGGCATTTGAGGGG - Intronic
1041423664 8:57696151-57696173 CTTCTGATGGGGCCTTTGAGTGG - Intergenic
1042480275 8:69294962-69294984 ATTTTCATGGTGCATTTGCATGG - Intergenic
1043014848 8:74925270-74925292 ATTTTAATGTGGAATTTGAAGGG - Intergenic
1043233502 8:77831555-77831577 CTTCTCATGGGGTATTTTAGTGG - Intergenic
1045980968 8:108187030-108187052 ATTCTGAAGGGGGATTTGGAGGG + Intergenic
1046363886 8:113200042-113200064 ATTCCCATGAGGCATCTAAATGG - Intronic
1049269271 8:141685566-141685588 CTTCTCTTGGAGCCTTTGAAGGG - Intergenic
1049898361 9:132664-132686 ATCCTCATGAAGCATTTGATGGG + Intronic
1049926615 9:414993-415015 ATTCGGATGGGGCATTTGGCAGG - Intronic
1050116364 9:2267647-2267669 ATTCTCCTGGGGCCTTGAAATGG - Intergenic
1052225118 9:26076619-26076641 CTTCTCATGGAGCATCTTAATGG + Intergenic
1053741424 9:41142965-41142987 ATCCTCATGAAGCATTTGATGGG + Intronic
1054346637 9:63972452-63972474 ATCCTCATGAAGCATTTGATGGG + Intergenic
1054444414 9:65299112-65299134 ATCCTCATGAAGCATTTGATGGG + Intergenic
1054485858 9:65722389-65722411 ATCCTCATGAAGCATTTGATGGG - Intronic
1054686924 9:68288336-68288358 ATCCTCATGAAGCATTTGATGGG - Intronic
1056652435 9:88478118-88478140 AATGTCATGCAGCATTTGAAGGG + Exonic
1058942817 9:109829964-109829986 ATTCTCCTGGGGCATATGGATGG - Intronic
1185907247 X:3946870-3946892 ATTCTCAAAGGGCAATTGAAAGG - Intergenic
1189741411 X:44120779-44120801 ATGGTCATGGTGGATTTGAAAGG - Intergenic
1190688197 X:52892567-52892589 ATTCTCCTGGAGCATTTCTAAGG + Intronic
1190697785 X:52963225-52963247 ATTCTCCTGGAGCATTTCTAAGG - Intronic
1191155860 X:57271720-57271742 CTTCAGATGGGGCATTTGAGTGG - Intergenic
1191737200 X:64399377-64399399 ATTATTAAGGGGCATTTAAAAGG - Intergenic
1196456445 X:115894593-115894615 ATTCTCATGGGTCACTCCAAGGG + Intergenic
1197009018 X:121537853-121537875 ATTCTCATTGAGCCTTTAAATGG - Intergenic
1200686189 Y:6262510-6262532 ATTCTTATGGGAGACTTGAAGGG - Intergenic
1200991726 Y:9353756-9353778 ATTCTTATGGGAGACTTGAAGGG - Intergenic
1200994380 Y:9374036-9374058 ATTCTTATGGGAGACTTGAAGGG - Intronic
1200999560 Y:9462920-9462942 ATTCTTATGGGAGACTTGAAGGG - Intergenic
1201002217 Y:9483228-9483250 ATTCTTATGGGAGACTTGAAGGG - Intronic
1201007534 Y:9523842-9523864 ATTCTTATGGGAGACTTGAAGGG - Intergenic
1201685501 Y:16697429-16697451 ATGCTCATGGGGCCATTAAATGG - Intergenic
1201935704 Y:19408517-19408539 ATACACATGGGGCATTTCAGGGG + Intergenic