ID: 920327747

View in Genome Browser
Species Human (GRCh38)
Location 1:205179877-205179899
Sequence CCTTCTGAGTAGAGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920327747_920327751 14 Left 920327747 1:205179877-205179899 CCATCCATCCTCTACTCAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 253
Right 920327751 1:205179914-205179936 GTGAGATAGTAAAAACAGAAAGG 0: 1
1: 0
2: 3
3: 38
4: 425
920327747_920327752 25 Left 920327747 1:205179877-205179899 CCATCCATCCTCTACTCAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 253
Right 920327752 1:205179925-205179947 AAAACAGAAAGGAAGCCATTTGG 0: 1
1: 1
2: 5
3: 62
4: 768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920327747 Original CRISPR CCTTCTGAGTAGAGGATGGA TGG (reversed) Intronic
900526594 1:3132336-3132358 CCTGCTGGGTGGAGGGTGGATGG + Intronic
900735214 1:4295412-4295434 CCTGCTGATCAGAGGCTGGAAGG - Intergenic
902460229 1:16569381-16569403 CCTTCTAAATACAGGGTGGAGGG + Intronic
904383384 1:30126033-30126055 CCTGCTGAGTAAATGATTGAGGG + Intergenic
905252046 1:36655774-36655796 GCTGCTGGGTGGAGGATGGAGGG + Intergenic
905294807 1:36947422-36947444 GCTTTTGAGCAGAGGACGGATGG - Intronic
905540744 1:38758404-38758426 AATTCTGAGTAAATGATGGAAGG - Intergenic
906199992 1:43953760-43953782 CCTTGGGAGTTGGGGATGGAGGG + Intronic
906694885 1:47817272-47817294 CTTTCTCAAAAGAGGATGGAAGG + Intronic
907729808 1:57054925-57054947 ACTGCTGAGTAGAGGAAGTATGG + Intronic
907892873 1:58651931-58651953 GCTTCAGTGTAGAGGATGGAGGG + Intergenic
908032035 1:60011318-60011340 CCTTTTGAATACAGTATGGATGG + Intronic
908559250 1:65288677-65288699 TATTCTTAGTAGAGGTTGGAGGG - Intronic
908983176 1:69983631-69983653 TGTTCTGAGTAGAGGATGAAGGG - Intronic
913605188 1:120459200-120459222 CCTTCTAAATACAGGGTGGAGGG - Intergenic
913642054 1:120821937-120821959 CCTTCTAAATACAGGGTGGAGGG - Intronic
914083350 1:144430008-144430030 CCTTCTAAATACAGGGTGGAGGG + Intronic
914276426 1:146128427-146128449 CCTTCTAAATACAGGGTGGAGGG + Intronic
914321099 1:146561093-146561115 GCTTCTAGGTGGAGGATGGAGGG - Intergenic
914366391 1:146982761-146982783 CCTTCTAAATACAGGGTGGAGGG - Intronic
914486056 1:148110686-148110708 CCTTCTAAATACAGGGTGGAGGG + Intronic
914537470 1:148579382-148579404 CCTTCTAAATACAGGGTGGAGGG + Intronic
914586388 1:149065834-149065856 CCTTCTAAATACAGGGTGGAGGG + Intronic
914628456 1:149485963-149485985 CCTTCTAAATACAGGGTGGAGGG - Intergenic
917413066 1:174780275-174780297 CCATCTGAGCAGAGTATGGAGGG - Intronic
917670384 1:177268341-177268363 GCTGCTGAGTAGAGGAAGGTAGG - Intronic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
918614932 1:186533074-186533096 CTTTCTGAGTAGAGGAGTGGTGG - Intergenic
920056808 1:203198757-203198779 CCTTATGAGCGGATGATGGAGGG + Intergenic
920265084 1:204715642-204715664 CCTTCTGAGTGGAGGCTGTTAGG + Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920331378 1:205211071-205211093 CCTTCTGAGGAGGGGAGGAAGGG - Intronic
920519325 1:206612108-206612130 CATTTTGAGGTGAGGATGGAGGG - Intronic
920560658 1:206936070-206936092 TATTCTGAGCAGAGAATGGAAGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
922033170 1:221824195-221824217 TGCACTGAGTAGAGGATGGAAGG + Intergenic
923378564 1:233391516-233391538 CCCTGTGAGTAGAGCCTGGATGG + Intergenic
1064104151 10:12487165-12487187 CCTTCAGGGTGGAGGATGGGAGG - Intronic
1064705299 10:18066817-18066839 CCTTCTTAGGTGAGGCTGGATGG + Intergenic
1065817227 10:29493174-29493196 CCTTCTCAGTGGAGGAAAGACGG + Intronic
1065955618 10:30691269-30691291 CCTTCTCAGTGGAGGAAAGACGG - Intergenic
1066470395 10:35692185-35692207 ATTTCTGAGAAGCGGATGGAAGG - Intergenic
1066695293 10:38071958-38071980 CCTGCTGAATGGAGGAAGGATGG - Intergenic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1067808228 10:49407880-49407902 CCTGCTGGGTGGAGAATGGATGG + Intergenic
1068628738 10:59277886-59277908 GCTGCTGAGTAGAGGGTGGCTGG - Intronic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1070434016 10:76370839-76370861 CATTATAAGTTGAGGATGGAAGG + Intronic
1070809246 10:79289342-79289364 CCTTCTCAGTACAGGCTGGAAGG - Intronic
1070845121 10:79515597-79515619 GGCTCTGAGTAGAGCATGGATGG - Exonic
1070928679 10:80244712-80244734 GGCTCTGAGTAGAGCATGGATGG + Intergenic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1072715769 10:97751477-97751499 CCTGCTGAGTAGAGGATGCTGGG - Intronic
1075100640 10:119503799-119503821 CCTTGTGAGAAGAGGAGGTAAGG - Intronic
1075918660 10:126191361-126191383 GCTGCTGAGTGGAGGATAGATGG + Intronic
1077260932 11:1619935-1619957 CCTTCTGGGAACAGGTTGGATGG - Intergenic
1078405484 11:11067033-11067055 CCTTCTGAACAAATGATGGAAGG + Intergenic
1078627429 11:12970454-12970476 ACTTGAGAGTGGAGGATGGAAGG + Intergenic
1079134595 11:17769281-17769303 CCTTGTGAGGAATGGATGGATGG + Intronic
1079363003 11:19785221-19785243 ACTTCACAGTAGAGGAAGGAAGG + Intronic
1080242512 11:30142934-30142956 CCTTGTGAGTTGAGAAGGGATGG + Intergenic
1081731665 11:45376100-45376122 GCTGCTGAGTGAAGGATGGATGG + Intergenic
1083956079 11:65983590-65983612 CTTTCTGGGTAGAGGTGGGAAGG - Intergenic
1084449646 11:69228598-69228620 GCTTCTGATTTGTGGATGGAAGG + Intergenic
1084605221 11:70168323-70168345 CATTCTGAGTAGAGCCTGGGAGG - Intronic
1084799165 11:71530506-71530528 CCTTCTGGGAACAGGTTGGATGG + Intronic
1085769722 11:79313951-79313973 GCTGCAGAGTGGAGGATGGATGG - Intronic
1088186339 11:107175884-107175906 CCTCCTGCGTCTAGGATGGATGG - Intergenic
1088504310 11:110513702-110513724 CCTTCAGAGTCGGGGAGGGAAGG + Intergenic
1088940751 11:114453454-114453476 CCTCCTGAGGAGTGGTTGGAAGG - Intergenic
1089288397 11:117422281-117422303 CCTTGTGAGTAGAAGTTGGAGGG + Intergenic
1092056003 12:5508473-5508495 CATTCTGAGTAGTGGGGGGAGGG - Intronic
1092960933 12:13596470-13596492 CCTTCTGAGATGAGGATGGAGGG + Intronic
1093116333 12:15216111-15216133 TCCTGTGAGTGGAGGATGGAGGG - Intronic
1096464891 12:51842812-51842834 CCTTCTGCTTAGAGAATGCAGGG + Intergenic
1096599704 12:52720897-52720919 CCCTCTGAGGAGACGAGGGACGG + Intergenic
1096751093 12:53759276-53759298 CCTGCTGGGTAGAGGGTGGGAGG - Intergenic
1101238887 12:102818270-102818292 CCTACTGAGGAGAGGATAGAGGG - Intergenic
1103860997 12:124013802-124013824 CCTTATGAGAAGTGGATGGTAGG + Exonic
1105613916 13:21995154-21995176 CCATTTGAGTTGAGAATGGAAGG - Intergenic
1105631692 13:22175940-22175962 CCTCCAGAGTGGAGGAAGGAGGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105895629 13:24715246-24715268 GCTTCTGTGTAGAGGATGGGAGG + Intergenic
1106171611 13:27293433-27293455 CCTTCCGATGAAAGGATGGAGGG - Intergenic
1107892250 13:44924533-44924555 CTATCTGAGTAGAGGTTGCAGGG - Intergenic
1108340868 13:49496800-49496822 CTTTTTGAGGAGAGGATGGCTGG + Intronic
1108913882 13:55585233-55585255 ACTTCTGAGTTGAGAAAGGAAGG + Intergenic
1109372743 13:61445284-61445306 CCTTCTGGGTAGAGGGTTGGAGG + Intergenic
1109948011 13:69463375-69463397 ACTTCTGTGCAGAGGATGTATGG + Intergenic
1114261497 14:21039997-21040019 CCTTTGGAGTGGAGGCTGGATGG - Intronic
1114695797 14:24626666-24626688 GTATCTGAGTAGAGGTTGGAAGG + Intergenic
1114698856 14:24656708-24656730 TCTTCTTACTAGAGGAGGGATGG - Intergenic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1120643391 14:87042918-87042940 CTCTCTGGCTAGAGGATGGAAGG - Intergenic
1123130542 14:105982135-105982157 CTTGCTGAATAGAGGATGGGAGG - Intergenic
1125060593 15:35417408-35417430 CCTTCTTAATTGAGAATGGAAGG + Intronic
1125956798 15:43796069-43796091 CATTCTGGGTAGAGGTTGGTAGG + Intronic
1127810469 15:62561006-62561028 CCTTCTGTGTAGAGGAAGAATGG - Intronic
1128671213 15:69576025-69576047 CCTTCTGGGAAGTAGATGGAGGG + Intergenic
1135494156 16:22937061-22937083 CCTTCTCAGTAGAGGAATGTTGG - Intergenic
1135817821 16:25652060-25652082 CCATCTGAATGCAGGATGGATGG + Intergenic
1137375142 16:47946048-47946070 CCTTCTGAGTAGATGACACATGG - Intergenic
1138480991 16:57303409-57303431 GCTGCTGTGTGGAGGATGGACGG + Intergenic
1138676135 16:58652879-58652901 GCTTCTGAGTAGAGGCTGATTGG + Intergenic
1140956522 16:79871427-79871449 CCTTCTGAGCAGAGGTTGTGAGG + Intergenic
1141715304 16:85723651-85723673 CCTTCTGAGTGGATGGTAGAAGG + Intronic
1141800842 16:86308145-86308167 GCTTGTGAGCAGTGGATGGAGGG + Intergenic
1143889414 17:10091126-10091148 GCTGCTGGGTAGAGGATGAATGG - Intronic
1146000203 17:29126290-29126312 CCTTGTGAGAGGAGGAGGGACGG + Intronic
1146631921 17:34476275-34476297 GCTTCTGAATAAAGGATGTATGG - Intergenic
1147486050 17:40815620-40815642 TGTTCTGAGTAAATGATGGATGG - Intergenic
1151855899 17:76721649-76721671 CCCTCTGGGTAGAGGAGAGAGGG - Intronic
1153026783 18:679770-679792 CAGTCACAGTAGAGGATGGATGG - Intronic
1153764711 18:8364623-8364645 CCCGCTGAGAAGAGGGTGGATGG - Intronic
1154400035 18:14027864-14027886 CCTTCTGAGAAGAGGACCAAAGG - Intergenic
1156505954 18:37593028-37593050 CCTTCTGTGTAAAGGCTGAATGG + Intergenic
1157203665 18:45680533-45680555 TCTTCTGAGGAGAGCTTGGATGG - Intronic
1157297528 18:46456964-46456986 CCTTCAGAGGACAGGATTGAGGG - Exonic
1157460142 18:47884116-47884138 CTGTCTGAGTAGAGCATGGCAGG - Intronic
1158579520 18:58669701-58669723 CAGTTTGGGTAGAGGATGGAGGG + Intergenic
1160123545 18:76151017-76151039 CCCTCTGAGTTGACCATGGAGGG + Intergenic
1161062338 19:2221577-2221599 TCTTCTGAGAACAGGAGGGAGGG + Intronic
1161270094 19:3385029-3385051 CCTGCTGAGCAGAGGCGGGAGGG - Intronic
1161766728 19:6212659-6212681 CTTTCTGAGCAGCGGATCGACGG - Intergenic
1162392214 19:10396385-10396407 GGTTCTGAGCAGAGGACGGAGGG - Intronic
1162836014 19:13318475-13318497 GGTTCTGAGTAGAGGAGGGATGG + Intronic
1163364586 19:16868927-16868949 CCTTCCGGGTAGTAGATGGAGGG + Intronic
1163784850 19:19269766-19269788 CTTCCTGAGCAGGGGATGGAGGG + Exonic
1163852952 19:19676521-19676543 CCTTCTGAATAGCAGGTGGATGG - Intronic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1165621744 19:37253869-37253891 CCATCTGAGTAATGGATTGAGGG - Intergenic
1165633278 19:37319692-37319714 CCATCTGAGTAACGGATTGAGGG - Intronic
1165930626 19:39356154-39356176 AATGCTGGGTAGAGGATGGATGG - Intronic
1166274730 19:41745136-41745158 CCCTCTGAAGAGAGGATTGATGG - Intronic
1166416122 19:42595932-42595954 CCCTCTGTGTAGAGAAAGGATGG + Intronic
1168417079 19:56175955-56175977 CCTTCTGAGGAGACAATAGAAGG - Intergenic
1202676661 1_KI270711v1_random:13109-13131 CCTTCTAAATACAGGGTGGAGGG + Intergenic
925746634 2:7049134-7049156 CCCTCTGAGTTGAGGGTTGAAGG + Intronic
926252281 2:11161904-11161926 TCTTCAGAGTGGAGGAAGGAGGG + Intronic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
929114610 2:38433758-38433780 ACTGGTGAGTAGAGGATGAATGG - Intergenic
929546691 2:42860336-42860358 CCATCTGAGTAGAGGAATGAAGG + Intergenic
929819094 2:45259137-45259159 CCTTCTGTGTAAAGGAGGGGCGG + Intergenic
929924536 2:46197471-46197493 TGTCCTGAGCAGAGGATGGAGGG - Intergenic
930365016 2:50428600-50428622 CCTTATGATTAGAGGCGGGACGG + Intronic
930605748 2:53491453-53491475 CCTACTCACTAGAGGACGGACGG - Intergenic
937256233 2:120557776-120557798 GCTTCTGGGTAGAGAATGGATGG - Intergenic
937831065 2:126424200-126424222 ACTTGAGAGTAGAGGATGGGAGG + Intergenic
939330551 2:140753896-140753918 CCCTATGAGTACAGGATGGGTGG - Intronic
939976529 2:148723019-148723041 CCTTCAGGGTGGAGGATGGAAGG + Intronic
940594260 2:155769399-155769421 CCTTCTGAGGTGAGGTAGGAAGG + Intergenic
941003032 2:160221351-160221373 CCCTCTGAGTGCAGGGTGGAAGG + Intronic
941894235 2:170613386-170613408 TGCTCTGGGTAGAGGATGGAAGG - Intronic
942641845 2:178068904-178068926 CATTTTAAGTAGAGAATGGAAGG + Intronic
944415989 2:199480263-199480285 CCTTCAGAGTCCAGGATGAAGGG + Intergenic
946882735 2:224192754-224192776 CCTTCTGAATAGATGATCAATGG - Intergenic
947753217 2:232543483-232543505 CCTCCTGAATTGAGGATGGGGGG - Intronic
948337456 2:237221598-237221620 CCTTCTGAGCAGAGCTTGGGTGG - Intergenic
1170029654 20:11931615-11931637 CCCTCTGAGAAGCAGATGGAAGG - Intergenic
1170560391 20:17552212-17552234 ACATCTGAGTAGAGAACGGAAGG + Intronic
1171171296 20:23017701-23017723 CCTTCTGAGCGAAGGATGGAGGG - Intergenic
1171458056 20:25282983-25283005 CCCTCTCAGAAGAGGAAGGAGGG + Intronic
1173264374 20:41465875-41465897 CCTTTAGAGAACAGGATGGAAGG - Intronic
1173751545 20:45480493-45480515 CCTCCTGAGTAGCGGGTGGGTGG - Intronic
1173961488 20:47075849-47075871 ACTTGAGGGTAGAGGATGGAAGG - Intronic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1175072907 20:56349696-56349718 CATTCTGAGAAGAGTGTGGAAGG - Intergenic
1175520033 20:59596727-59596749 CCTGCTGAGCAGAGCTTGGAAGG - Intronic
1175969555 20:62677559-62677581 CCCACTGAGCAGAGGATGGCAGG + Intronic
1177015712 21:15784195-15784217 CCTTCATATTAGAGGACGGAAGG - Intronic
1179165224 21:38930306-38930328 CCTTCTTGGTAGAGAAAGGAGGG + Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1180853949 22:19035005-19035027 GCTACTGAGGAGAGGATGGGAGG + Intergenic
1181064130 22:20297710-20297732 CCTGATGAGGAGAGGAAGGAGGG + Intergenic
1181929374 22:26387633-26387655 CGTAATGAGTAGAGGCTGGAAGG - Intergenic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1184377856 22:44125794-44125816 GCTTCTGGGTGCAGGATGGATGG + Intronic
953150291 3:40318463-40318485 CTTGCTTAGTGGAGGATGGAGGG - Intergenic
953448090 3:42984478-42984500 CCAGCTGAGTGGAAGATGGAAGG + Intronic
954661144 3:52227555-52227577 CCCTCTGAGAGGTGGATGGAGGG - Intergenic
954727657 3:52628292-52628314 CCTTCTGATTGGAGGAAGCAGGG - Intronic
954793471 3:53149330-53149352 CCTCCTGAGGGGAGGAGGGAAGG - Intergenic
960586380 3:119324070-119324092 CCTTCGGTGTAGAGCAGGGATGG - Intronic
962203812 3:133419140-133419162 CCTTCTGAGAAGAGGAAGTTTGG - Intronic
962732710 3:138298664-138298686 CCTAAGGAGAAGAGGATGGAGGG - Intronic
962794763 3:138840570-138840592 CCTCCTGAGTAGAGGATTACAGG + Intergenic
963730062 3:148962659-148962681 CCTCCTGGGTAGAGGAGGGGAGG - Intergenic
964660370 3:159114126-159114148 TTTTCTGAGTTGAGGAAGGATGG + Intronic
967640334 3:191855165-191855187 CCTTGAGTGTGGAGGATGGAAGG + Intergenic
968856238 4:3125890-3125912 CTTTGTGAGTAGGGGATGGCAGG + Intronic
969200501 4:5600816-5600838 CCTGCTGAGCAAAGGATGGGTGG - Intronic
970129332 4:12849716-12849738 ACTTCTGAGTACAGGAGAGAAGG + Intergenic
970466012 4:16323843-16323865 GCTTCAGAGTAGAGGAGGAATGG - Intergenic
971361282 4:25940778-25940800 TCTTTTGAGTAAAGGAAGGAAGG - Intergenic
971870573 4:32232241-32232263 CCTTTTGAGAACAGGATGGTGGG - Intergenic
974642081 4:64644248-64644270 ACTTCAGGGTAGAGGGTGGAAGG - Intergenic
975998157 4:80340338-80340360 AGTTCTGAGTATTGGATGGAAGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
983157219 4:164363836-164363858 CCTATTGAGTAGAGAATGTAGGG + Intronic
985657136 5:1138016-1138038 ACTTCTGAGAAGAGGAGGGGCGG - Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
985993364 5:3581823-3581845 TCATCTGTGTAGAGGAAGGACGG - Intergenic
989720304 5:44520303-44520325 CATTCTGAATAGAGAATAGAAGG - Intergenic
990215008 5:53521168-53521190 ACTTGAGGGTAGAGGATGGAAGG + Intergenic
996193230 5:120571067-120571089 GCATTTGAGCAGAGGATGGAGGG + Intronic
996769288 5:127068958-127068980 TCTTTGGAGTTGAGGATGGAGGG - Intronic
999500614 5:152143116-152143138 CCTTCTGAGTAGAGTACCCAGGG + Intergenic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
999834951 5:155359707-155359729 ACTTGAGGGTAGAGGATGGAAGG + Intergenic
1001225661 5:169942632-169942654 TCTTATGAGTTGAGGATGCAGGG + Intronic
1001242353 5:170080338-170080360 CCTTGTGGGTGGAGGATGGATGG + Intronic
1002906196 6:1451120-1451142 CCTTCTGAGTAGATTAAGGGAGG - Intergenic
1004078274 6:12365460-12365482 CCTTCTGGGTGGGGGCTGGAAGG + Intergenic
1005773846 6:29107463-29107485 CCTTCTGAGTATAGTTTGAATGG + Intergenic
1005965692 6:30724961-30724983 CCTCCAGAGTAGAGCTTGGAGGG - Exonic
1007729733 6:43938692-43938714 GCCACTGAGGAGAGGATGGATGG - Intergenic
1009025747 6:57998455-57998477 GCTGCTGAGTAGAGAATAGATGG - Intergenic
1009201310 6:60749924-60749946 GCTGCTGAGTAGAGAATAGATGG - Intergenic
1011422626 6:87189794-87189816 CCTTCCGAGTACAGTATGGAAGG - Intronic
1012701483 6:102462063-102462085 GCTTCTGACTTGATGATGGATGG + Intergenic
1013099016 6:106972759-106972781 GCTTCTGATTACAGGCTGGAGGG + Intronic
1013626279 6:111940468-111940490 GCTTCTGAGTAGATGACAGAAGG + Intergenic
1015499869 6:133920901-133920923 CCACCTGAGGAGACGATGGATGG + Intergenic
1016673665 6:146738322-146738344 CCTTCAGAGTTGAGAATGAAAGG - Intronic
1017031835 6:150230520-150230542 CCCTCTGCGTAGGGAATGGATGG + Intronic
1017845750 6:158256875-158256897 CCTTCTGTGTAAAGGTGGGAGGG + Intronic
1017883154 6:158575821-158575843 CCTTTTGAGTGGAGGATTGTTGG + Intronic
1019575517 7:1735759-1735781 CCTCCTCAGTAGGGGAGGGAAGG - Intronic
1020410486 7:7886733-7886755 GCTTTAGAGTAGAGGATGGATGG - Intronic
1020416615 7:7953355-7953377 CCTTCTGAGTAGAGGGTTTTAGG + Intronic
1021299595 7:18956577-18956599 CCTTCTGAGTCAAGGATATATGG + Intronic
1023116258 7:36865520-36865542 AATTCAGAGTATAGGATGGATGG - Intronic
1023803325 7:43853606-43853628 CCTTCTAGGTAGAGGAAGGTTGG - Intergenic
1023847360 7:44129940-44129962 CCTTCTGAGTGGAGGGTGCTGGG - Intergenic
1029524165 7:101085221-101085243 TTCTCTGAGTAGAGGGTGGAGGG - Intergenic
1030005254 7:105112271-105112293 CCTGCTGAGTATTGGCTGGAAGG - Exonic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032576312 7:133058999-133059021 GCTTCTGGGTAGGGGTTGGAAGG - Intronic
1032636987 7:133719892-133719914 ACTTCTCAGGAAAGGATGGATGG + Intronic
1033040668 7:137914775-137914797 CCATCTGTGTAGATGATGAAGGG - Intronic
1034964556 7:155383152-155383174 CCTGCAGGGTAGAGGCTGGAGGG - Intronic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1035675559 8:1453180-1453202 CCTACTGAGCCCAGGATGGAAGG + Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037524863 8:19714914-19714936 ACTTGAGGGTAGAGGATGGAAGG - Intronic
1037639360 8:20728801-20728823 GCCTCTGGGTAGAGGAAGGATGG - Intergenic
1038892754 8:31745201-31745223 CCTGCTGAGTAGCTGGTGGAAGG + Intronic
1038969420 8:32615832-32615854 TCTTCTGAGGAAAGGAAGGAAGG + Intronic
1043143863 8:76625842-76625864 CCTTGTGACTGCAGGATGGAGGG - Intergenic
1043745218 8:83866869-83866891 TTTTCTGAGTAGGGGATGGATGG + Intergenic
1046507322 8:115152764-115152786 CCTTCTGAGGCGATGAGGGAGGG - Intergenic
1047338295 8:123956517-123956539 CCTACTGCGAAGATGATGGAGGG - Intronic
1048314573 8:133352565-133352587 CCTGCTGACAAGTGGATGGATGG + Intergenic
1049015414 8:139916503-139916525 CGTTCCGAGGAGTGGATGGAGGG - Intronic
1050213829 9:3298285-3298307 CCATCTGAGTAAAGAATGTATGG - Intronic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1051263057 9:15284724-15284746 TCTTCTGAGGAGAGGAAGGGAGG + Intronic
1051420573 9:16885270-16885292 CATTCGTAGTAAAGGATGGAGGG - Intergenic
1052502934 9:29316321-29316343 CCTTCTGACTAGAGAAAGAAAGG + Intergenic
1053070271 9:35097007-35097029 CCTTCGGAGTGGAGGAGGGGAGG + Intergenic
1054835344 9:69671097-69671119 CCTTATGGCTAGAGGATGGATGG - Intronic
1055597079 9:77876245-77876267 CCTGCTCAGTAGAGGAGGAAAGG - Intronic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1058149278 9:101446350-101446372 TCTGCTGAGTAGAGGCTGAATGG + Intergenic
1058601356 9:106674241-106674263 CCATCTGAACAGAGGAGGGAAGG - Intergenic
1059745488 9:117196356-117196378 AATCCTGAGTAGAAGATGGATGG - Intronic
1188146406 X:26619015-26619037 CATTCTAAGTAGGGGATGGAGGG + Intergenic
1189065708 X:37806065-37806087 CTTTCTGAGAAGAGGTTCGAAGG + Intronic
1189172732 X:38925238-38925260 CCTTCTCAGTAGCTGATGAAGGG - Intergenic
1189867154 X:45342801-45342823 CCTTCTGGCTATAGGATTGAGGG - Intergenic
1190051395 X:47152374-47152396 AATTCTGAGTAGAGGATATATGG - Intronic
1190683632 X:52851390-52851412 CCTCATGGGTAGTGGATGGAGGG + Intergenic
1190999537 X:55645857-55645879 CCTCATGGGTAGTGGATGGAGGG + Intergenic
1191665442 X:63697540-63697562 TCTTCTTCATAGAGGATGGAGGG - Intronic
1193381347 X:80819925-80819947 CCTCCTGAGTACAGGATGCTGGG - Intergenic
1198895187 X:141446297-141446319 ACTTGAGGGTAGAGGATGGAAGG - Intergenic
1199899864 X:152162393-152162415 TCTTCTGACTACAGCATGGAGGG + Intergenic
1201758185 Y:17512913-17512935 ATTTCTGAGTAGGGGATGGGAGG - Intergenic
1201843370 Y:18393077-18393099 ATTTCTGAGTAGGGGATGGGAGG + Intergenic