ID: 920328126

View in Genome Browser
Species Human (GRCh38)
Location 1:205182927-205182949
Sequence GATCAGAGCAGATCAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920328117_920328126 19 Left 920328117 1:205182885-205182907 CCCAAAGGGCCAAAAGCACCTGG 0: 1
1: 0
2: 1
3: 13
4: 198
Right 920328126 1:205182927-205182949 GATCAGAGCAGATCAACTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 126
920328123_920328126 10 Left 920328123 1:205182894-205182916 CCAAAAGCACCTGGTGGGGATAA 0: 1
1: 0
2: 1
3: 8
4: 105
Right 920328126 1:205182927-205182949 GATCAGAGCAGATCAACTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 126
920328119_920328126 18 Left 920328119 1:205182886-205182908 CCAAAGGGCCAAAAGCACCTGGT 0: 1
1: 0
2: 2
3: 27
4: 283
Right 920328126 1:205182927-205182949 GATCAGAGCAGATCAACTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 126
920328125_920328126 1 Left 920328125 1:205182903-205182925 CCTGGTGGGGATAAACAGGCTAC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 920328126 1:205182927-205182949 GATCAGAGCAGATCAACTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920328126 Original CRISPR GATCAGAGCAGATCAACTGA AGG Intronic
901815044 1:11789053-11789075 ACTCAGAGCAGAGCAAATGAGGG - Exonic
905317624 1:37093673-37093695 GACCAGAGGAGGTCAACTGGAGG - Intergenic
905916486 1:41688205-41688227 GGTCAGAGGAGAACAACAGAAGG - Intronic
910247793 1:85160748-85160770 GATCAGACCAGATAACCTCAAGG - Intronic
911585737 1:99688508-99688530 GATTAGAGAAGATAAGCTGATGG - Intronic
912657690 1:111502596-111502618 CATAAGAGGAGATAAACTGATGG - Intronic
912702324 1:111887663-111887685 AATCAGAGCAGATAAACCAAGGG + Intronic
916521176 1:165564671-165564693 GGTAAGAGCAGAGCAACTGCTGG + Intergenic
916928558 1:169549977-169549999 GATCAGAGCAGTTCAACCAGGGG - Exonic
918966675 1:191359320-191359342 GAAAAGATCAAATCAACTGAGGG - Intergenic
919736963 1:200958713-200958735 GGTCAGAGCAGGTCATTTGAGGG + Intergenic
920328126 1:205182927-205182949 GATCAGAGCAGATCAACTGAAGG + Intronic
923981782 1:239332506-239332528 CATCAAAGGAGATCTACTGAAGG + Intergenic
1071505619 10:86229830-86229852 GTTCAGGGCAGGTCATCTGAAGG - Intronic
1071872628 10:89811912-89811934 GATCAGAGCTGATCATCTGGGGG - Intergenic
1072127988 10:92464577-92464599 GATCAGGGCAGGGCAGCTGAAGG - Intronic
1072204599 10:93191939-93191961 AAGCAAGGCAGATCAACTGATGG + Intergenic
1075415193 10:122257716-122257738 GCCCAGAGCAGATGAACTCAGGG + Intergenic
1079806872 11:24942985-24943007 GAGCTGAGAAGACCAACTGATGG + Intronic
1080193340 11:29577970-29577992 GATCAAAGCAGATAAAATGTGGG + Intergenic
1081650173 11:44818489-44818511 GATCAGGGCAGATGAACAGGTGG + Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082205035 11:49422804-49422826 AATCCAAGCAGTTCAACTGAGGG + Intergenic
1088034422 11:105294778-105294800 GATCAGAGCAGAACTACTGAAGG - Intergenic
1091638502 12:2215960-2215982 CAACAGAGCATGTCAACTGATGG - Intronic
1095521498 12:43072249-43072271 GATCAGAACAGACCACATGAAGG + Intergenic
1097478202 12:60085329-60085351 GCTCAGAGGAAATAAACTGAAGG - Intergenic
1098598228 12:72297749-72297771 GATGAGAGCAGATCTGCTTAAGG + Intronic
1099563606 12:84211300-84211322 GATGAGAGCAGAAGAACTCATGG + Intergenic
1100433029 12:94547273-94547295 GATGAGAGCAGGCCATCTGAAGG + Intergenic
1107892174 13:44923678-44923700 GAGCAAAGCAAATTAACTGAGGG - Intergenic
1108394821 13:49981917-49981939 CATCTGAGCAGAACAACTGAAGG + Intergenic
1111538655 13:89640164-89640186 TATCAGAGCAGATTAAATGATGG + Intergenic
1112002008 13:95219431-95219453 GGTCAGAGAAGATCATCTTAAGG + Intronic
1121998894 14:98629731-98629753 GACCAGAGCTGATCATGTGATGG - Intergenic
1123072136 14:105647073-105647095 GACCAGGGCAGAGCAACTGAAGG - Intergenic
1123097548 14:105773641-105773663 GATCAGGGCAGAGCATCAGAAGG - Intergenic
1123180893 14:106469162-106469184 GATCTGAGCAGAGCCACTGCTGG + Intergenic
1202946003 14_KI270726v1_random:27496-27518 GATCTGAGCAGAGCCACTGCTGG - Intergenic
1125867120 15:43062781-43062803 GGTGGGAGTAGATCAACTGAAGG + Intronic
1133843744 16:9435437-9435459 GATCAGGGCAGAGCATCAGAAGG + Intergenic
1133918960 16:10134664-10134686 GAACAGAGAAGATAAAATGAAGG - Intronic
1138448285 16:57078098-57078120 GGGCAGGGCAGCTCAACTGATGG - Intronic
1142298788 16:89244186-89244208 GAGGTGAGCAGATCACCTGAGGG + Intergenic
1142922467 17:3201414-3201436 CAGCAGACTAGATCAACTGAAGG + Intergenic
1143989643 17:10945745-10945767 GAATAGAGCAGAGCAAATGATGG - Intergenic
1151426592 17:74034746-74034768 GAGAAGAGCAGAGCAATTGAAGG - Intergenic
1151993496 17:77593790-77593812 GATCACAGAAGGTCAAGTGAAGG - Intergenic
1153660737 18:7323617-7323639 GACCAGAGCACATCAGCTGGGGG - Intergenic
1153805941 18:8707852-8707874 AATCAGAGCACATTAACTGCTGG + Intronic
1157564848 18:48672916-48672938 GATCAGAACAGATCAGGGGAGGG - Intronic
1159220609 18:65459109-65459131 GAGCAGAGCAGATCCATTTAAGG + Intergenic
1159274228 18:66194285-66194307 GCTCTGAGCAGATCTACAGAAGG - Intergenic
1160232825 18:77061101-77061123 GATCATAGCAGGTCCTCTGATGG + Intronic
926943076 2:18158501-18158523 GTTCAGAGCAGGCCAACTCATGG + Intronic
927448646 2:23187617-23187639 GCTCAGAGCAGAACCACTCAGGG + Intergenic
929162455 2:38846095-38846117 GAGGCGAGCAGATCACCTGAGGG - Intronic
935332171 2:101985296-101985318 GAGCAGAGCAGAGCAGCTGTGGG + Intergenic
935890231 2:107669037-107669059 CATCAGAGAAGATATACTGATGG - Intergenic
937530420 2:122820692-122820714 GATTAAAGCAGATGAACTGCAGG + Intergenic
941288629 2:163646915-163646937 GAAAAGAGCAGATACACTGATGG + Intronic
941518144 2:166505386-166505408 CATCAGAGCAGCTCAAATTAAGG + Intergenic
942322665 2:174749671-174749693 GATCAGAGAAGATGAACAAACGG - Intronic
1170412988 20:16110530-16110552 GACCAGAGCTGGTCATCTGAAGG + Intergenic
1175776248 20:61655664-61655686 TTTCAGAGCTGACCAACTGATGG - Intronic
1184918036 22:47586661-47586683 AATCAGGGGAGATCAGCTGAGGG - Intergenic
950086507 3:10262184-10262206 GACCAGAGCAGGACAACAGAGGG - Intronic
951019629 3:17768138-17768160 GAGCCGGGCAGATCACCTGAGGG - Intronic
951707539 3:25558446-25558468 GATGAAAGCAGATGAACTGTGGG - Intronic
952873905 3:37925687-37925709 GAACAGAGCAGATAAGCAGAAGG + Intronic
954904759 3:54051191-54051213 GAGGAGGGCAGATCACCTGATGG + Intergenic
957809374 3:85199055-85199077 GATCAGTAAAGATCAAATGATGG - Intronic
957965650 3:87320041-87320063 GATCAGAGCAAAACATCTCAGGG - Intergenic
958096762 3:88955657-88955679 GAGAAAAGAAGATCAACTGATGG - Intergenic
959005639 3:101016428-101016450 GATCAGAGCAGAATACCTCACGG + Intergenic
959022651 3:101205322-101205344 GATCAGAACAGAGGAACTGCAGG + Intergenic
960985697 3:123279223-123279245 GAGCAGAGCTGATCCACTGAGGG - Intergenic
961307096 3:125965857-125965879 GATGAGAGCAGACCATCGGAAGG + Intergenic
962705722 3:138042191-138042213 GGGCAGAGCAGAAGAACTGAAGG - Intergenic
966088413 3:176100180-176100202 ATACATAGCAGATCAACTGAAGG + Intergenic
971045187 4:22798139-22798161 TTTCAGAGCACATGAACTGAGGG - Intergenic
972417882 4:38860678-38860700 GAGCAAAGGAGATCAACAGATGG + Intergenic
973598477 4:52516666-52516688 GATCTAATCAGAGCAACTGAAGG + Intergenic
973677239 4:53277685-53277707 AATCTGAGCAGATCCTCTGATGG - Intronic
973755513 4:54069604-54069626 GATGAGAGCTGATCACCAGAAGG - Intronic
975177100 4:71300953-71300975 GATCAGGGCTGATCATGTGAAGG + Intronic
978876566 4:113646655-113646677 GGTTGGAGCAGAGCAACTGAGGG + Intronic
982605342 4:157509356-157509378 GAGAAGAACAGATGAACTGAAGG - Intergenic
982614201 4:157619857-157619879 GATGAGAAAAGATCAAATGATGG - Intergenic
983133415 4:164050484-164050506 GATCAGAGCATAGCAATGGAAGG - Intronic
986215041 5:5712358-5712380 GCTGAGAGCTGAACAACTGAAGG - Intergenic
986981278 5:13450458-13450480 GAGCAGAGGAGGTGAACTGATGG - Intergenic
987215818 5:15735716-15735738 GCTTAGAGCAGATGACCTGAGGG + Intronic
990962370 5:61408274-61408296 GATGAGAACAGGGCAACTGAGGG + Intronic
991333625 5:65521831-65521853 GATGTGGGCAGATCACCTGAGGG - Intronic
992581752 5:78185054-78185076 GAACACAGTAGACCAACTGATGG + Intronic
993541347 5:89156497-89156519 CATCAGAGCAGATTCACTAAAGG + Intergenic
996588192 5:125115287-125115309 GATCAGAGAACAGCAGCTGAGGG - Intergenic
997926676 5:138036507-138036529 GCTCTGAGCAGATCCATTGAAGG + Intronic
1003368501 6:5500564-5500586 CATCAGAGCAGGTAAACTGCAGG + Intronic
1003809664 6:9766183-9766205 CATCAGAGGACACCAACTGAAGG + Intronic
1007071323 6:39040433-39040455 GGTCAGACCAGAACAACAGAGGG + Intergenic
1007991545 6:46261062-46261084 GATCAGAGAAGAGGAATTGATGG - Intronic
1012261902 6:97097201-97097223 AATCAGAGCAGATGAAAGGAAGG - Intronic
1014253470 6:119138856-119138878 GAAGAGGGCAGATCACCTGAGGG - Intronic
1015012538 6:128368227-128368249 GAGCAGAGAATATAAACTGAAGG + Intronic
1021474245 7:21042749-21042771 GCTCAGAGCGGGTGAACTGAGGG + Intergenic
1022262343 7:28718635-28718657 CAGCAGATCAGATCCACTGATGG - Intronic
1023670260 7:42568984-42569006 GATCAGATCAAATCATCAGATGG - Intergenic
1027795031 7:82681888-82681910 GATGAGAGCAGAAAAACTGACGG - Intergenic
1028087777 7:86657571-86657593 TCTCAGAGCAGATAAAATGATGG + Intronic
1033729083 7:144156686-144156708 GATCAGAATAGATTAACTGTGGG + Intergenic
1033803087 7:144923827-144923849 GATCAGAGCAGACCAGGTAAGGG + Intergenic
1037568446 8:20137683-20137705 GATCATAGCAGGTCATCTGTCGG - Intergenic
1038027013 8:23600318-23600340 GTTTAGAGCAGATCATCTGGTGG + Intergenic
1039906495 8:41790376-41790398 GAGCTGAGCGGATCACCTGAGGG - Intronic
1040423993 8:47265979-47266001 GATGCGGGCAGATCACCTGATGG - Intronic
1041733175 8:61083446-61083468 GAGAAGAGCAGCCCAACTGAGGG + Intronic
1043137533 8:76547252-76547274 GAACAGATAAGATCCACTGATGG - Intergenic
1045299093 8:100895466-100895488 CATCAGAGCAAATCAAGGGAGGG - Intergenic
1045730845 8:105239095-105239117 GATGAGAGCTGCTCAACTGAAGG - Intronic
1046745788 8:117874652-117874674 TAGCAGAGTAGATCAATTGAGGG - Intronic
1050642292 9:7681006-7681028 TCTCAGAGGAGATCAACTGGGGG - Intergenic
1051758597 9:20434799-20434821 GTTGAGAGGAGATGAACTGAAGG - Intronic
1052161612 9:25267996-25268018 AATGGGAGCAGATCTACTGAAGG + Intergenic
1052525628 9:29615309-29615331 GATCAGAGCTGAGCAGCGGATGG + Intergenic
1053131608 9:35618652-35618674 GATCAGGGCAGATAACCAGAAGG - Intronic
1057692257 9:97295588-97295610 AATCAGAGCAGACAGACTGAAGG - Intergenic
1059884385 9:118728857-118728879 ACTCAGAACAGATCATCTGAAGG - Intergenic
1061494878 9:130967171-130967193 GAGTCGAGCAGATCACCTGAGGG + Intergenic
1186209035 X:7230665-7230687 GATGAGAGAAGAGCAAGTGAAGG + Intronic
1187091081 X:16097519-16097541 GATCATAGCATATTAACAGAAGG - Intergenic
1189479106 X:41379635-41379657 GATCAAAGGAGATCATGTGAAGG - Intergenic
1191639896 X:63418759-63418781 AATCAGAGCAGACTAATTGAAGG - Intergenic
1199071700 X:143483286-143483308 TAGCAGAGTAGACCAACTGAAGG - Intergenic