ID: 920328536

View in Genome Browser
Species Human (GRCh38)
Location 1:205186657-205186679
Sequence TTTGGTCTAATTAAATAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920328532_920328536 -6 Left 920328532 1:205186640-205186662 CCATAGTCACATCCCCATTTGGT 0: 1
1: 0
2: 0
3: 7
4: 105
Right 920328536 1:205186657-205186679 TTTGGTCTAATTAAATAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 114
920328528_920328536 4 Left 920328528 1:205186630-205186652 CCTGACCCTGCCATAGTCACATC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 920328536 1:205186657-205186679 TTTGGTCTAATTAAATAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 114
920328529_920328536 -1 Left 920328529 1:205186635-205186657 CCCTGCCATAGTCACATCCCCAT 0: 1
1: 0
2: 0
3: 14
4: 189
Right 920328536 1:205186657-205186679 TTTGGTCTAATTAAATAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 114
920328526_920328536 10 Left 920328526 1:205186624-205186646 CCCACTCCTGACCCTGCCATAGT 0: 1
1: 0
2: 1
3: 13
4: 226
Right 920328536 1:205186657-205186679 TTTGGTCTAATTAAATAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 114
920328527_920328536 9 Left 920328527 1:205186625-205186647 CCACTCCTGACCCTGCCATAGTC 0: 1
1: 0
2: 2
3: 22
4: 333
Right 920328536 1:205186657-205186679 TTTGGTCTAATTAAATAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 114
920328525_920328536 14 Left 920328525 1:205186620-205186642 CCTACCCACTCCTGACCCTGCCA 0: 1
1: 0
2: 11
3: 63
4: 581
Right 920328536 1:205186657-205186679 TTTGGTCTAATTAAATAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 114
920328524_920328536 15 Left 920328524 1:205186619-205186641 CCCTACCCACTCCTGACCCTGCC 0: 1
1: 0
2: 5
3: 56
4: 594
Right 920328536 1:205186657-205186679 TTTGGTCTAATTAAATAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 114
920328530_920328536 -2 Left 920328530 1:205186636-205186658 CCTGCCATAGTCACATCCCCATT 0: 1
1: 0
2: 0
3: 12
4: 156
Right 920328536 1:205186657-205186679 TTTGGTCTAATTAAATAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920328536 Original CRISPR TTTGGTCTAATTAAATAGCC TGG Intronic
907512886 1:54975426-54975448 TTTGGTCTAACTAAAAACCCTGG + Intergenic
908447999 1:64220185-64220207 TTAAGTCTAATGAAATGGCCAGG - Intronic
911336104 1:96582363-96582385 GTTGGAATAATTAAATAGCGTGG - Intergenic
916366992 1:164040532-164040554 TTGGGTCTAATTAAGTTTCCAGG - Intergenic
917782036 1:178408494-178408516 TTTAGTTTAATTATATAGCTAGG + Intronic
918596931 1:186305612-186305634 TTCGCTCTAAATAAATAGCCAGG + Intronic
918772241 1:188576075-188576097 TTTTGTCTTATTCAAAAGCCAGG + Intergenic
920328536 1:205186657-205186679 TTTGGTCTAATTAAATAGCCTGG + Intronic
920614770 1:207479544-207479566 TTTGGTCTATTGAAATAGGCAGG + Intronic
920917605 1:210270611-210270633 ATTGGACTAAGTAAATAGCAGGG + Intergenic
921210818 1:212895974-212895996 TATGTTCTAATTAAGGAGCCTGG + Exonic
921507502 1:215990353-215990375 CTTGGTATCATTAAAGAGCCAGG + Intronic
1064312196 10:14221361-14221383 TGTGGCCTAATTTCATAGCCTGG + Intronic
1068272608 10:54748364-54748386 CTTGGTCTCATTAAATATTCAGG - Intronic
1070079675 10:73173257-73173279 TGTGGTATAATTTAAAAGCCAGG + Intronic
1074256216 10:111805216-111805238 CTTGGACTAATTGATTAGCCTGG - Intergenic
1078256392 11:9662858-9662880 TAAGGTCTGATTAAATCGCCAGG - Intergenic
1081686532 11:45047014-45047036 TGTGGTCTAGTTAATCAGCCCGG + Intergenic
1088194396 11:107259085-107259107 TTTCATCTACTTAAAAAGCCTGG - Intergenic
1092302837 12:7268566-7268588 TTTGCTTTAATCAAATTGCCTGG + Intergenic
1092952571 12:13521054-13521076 TTTGTTCTCATTAAATCCCCTGG + Intergenic
1093644587 12:21570251-21570273 TTTGGTTTCATTAATTAGGCTGG - Intronic
1094268082 12:28581193-28581215 TTTGGTGTAAGTAAATAACTGGG - Intergenic
1095672678 12:44878293-44878315 TTTGACCTAATTAAATAGTATGG + Intronic
1097728216 12:63098888-63098910 GTTGGGCTAACTAAATAGCTGGG + Intergenic
1098319646 12:69230561-69230583 TTTTATTTAATTAAATACCCAGG - Intergenic
1099404732 12:82246218-82246240 TTTAGTAAAATTAAATGGCCTGG + Intronic
1100518475 12:95350924-95350946 ATTGGTCTATTTAACTAGCCTGG + Intergenic
1101493727 12:105234750-105234772 TTTAGTCTGATTAAAATGCCAGG + Intronic
1106294261 13:28395989-28396011 TTTGGACTAATTAAATACAAAGG - Intronic
1107131747 13:36903800-36903822 TTTAGTCAAATTAAATAACCTGG + Intronic
1108112783 13:47094421-47094443 CTTGGTGTAAATAAACAGCCTGG - Intergenic
1110339519 13:74372809-74372831 TGTAGTCCATTTAAATAGCCAGG + Intergenic
1110718795 13:78738266-78738288 TTTAGTCTAATTAATGACCCTGG + Intergenic
1112104435 13:96225222-96225244 TTTGGCCTAATTAAATTATCTGG + Intronic
1112215928 13:97432334-97432356 TTTGGTCTGAGTTAAAAGCCAGG - Intergenic
1113259262 13:108543674-108543696 TTTGGTCAAATAAAATATTCTGG - Intergenic
1115084940 14:29503484-29503506 ATTGGTCTAAGTAAATAGGTAGG - Intergenic
1116372263 14:44151161-44151183 TTTGGTTCAATTAAGTATCCAGG - Intergenic
1122828505 14:104383825-104383847 TCTGTCCTAATTAAATAGCCAGG - Intergenic
1128986183 15:72223275-72223297 TCTGCCCTAATAAAATAGCCTGG + Intronic
1130906677 15:88245525-88245547 ATTGGTCTAACCAAATACCCTGG + Intronic
1134159757 16:11878063-11878085 TTTGGTGTAATGAAATGGTCTGG + Intronic
1135348507 16:21709490-21709512 TTTCCTTTCATTAAATAGCCAGG - Intronic
1139056690 16:63194355-63194377 TTTTGTACATTTAAATAGCCGGG + Intergenic
1140151041 16:72366108-72366130 TTTGATCTAATTAAATAGCTGGG + Intergenic
1144273664 17:13644086-13644108 TTTGGACTAATTTTATACCCAGG + Intergenic
1145178273 17:20720999-20721021 TGTGGTCTGATTATATAGTCAGG + Intergenic
1147224011 17:38961058-38961080 TTTGGTCTTATTAAATAAACAGG + Intronic
1150118270 17:62574971-62574993 ATTGGTCAGATTAATTAGCCTGG - Intronic
1150622946 17:66822174-66822196 TTTAGTCTAATAAAATTTCCCGG - Intergenic
1155728833 18:29126327-29126349 ATTGGACTAATTAATTAGCTTGG - Intergenic
1156080833 18:33332921-33332943 TTTGGTCATTTAAAATAGCCAGG - Intronic
1156249926 18:35343598-35343620 ACTGGTTTAATTAAATACCCTGG + Intronic
1157232711 18:45933987-45934009 TTTGTTATAAGTAAATATCCTGG + Intronic
1159905119 18:74082919-74082941 TTTTGTCTCATGAAATAACCAGG - Intronic
1162507623 19:11095869-11095891 GTTGTTCTAGTTAAATGGCCTGG + Intronic
1164378840 19:27714129-27714151 TTTGCTTTAATTAAATAGGTTGG - Intergenic
928785486 2:34880817-34880839 GTTGGTCTCATTAAATGACCTGG + Intergenic
929452296 2:42046257-42046279 TTTGGTCTAATTAACTGTGCTGG - Intergenic
932557921 2:72841956-72841978 TTTGCTCTACTCAAATGGCCTGG + Intergenic
934633168 2:95953393-95953415 TTTAGTCTAATTACAGAGCCAGG + Intronic
934800331 2:97149882-97149904 TTTAGTCTAATTACAGAGCCAGG - Intronic
935847195 2:107178710-107178732 TTTGTTTTAATTGAATGGCCTGG - Intergenic
936865123 2:117068818-117068840 TTTCGTTAAATTAAATAGGCAGG - Intergenic
938385805 2:130866222-130866244 TTTGTTTTAATAAAATAGCTAGG + Intronic
939711349 2:145524153-145524175 TTTGTTTTAATAAAATAGCCAGG - Intergenic
947013634 2:225592944-225592966 CTTGGTTTAAATAAATAGACTGG - Intronic
947237526 2:227958319-227958341 TGTGGTCTAATTAAATTGATTGG - Intergenic
947334896 2:229071639-229071661 TTTGGTGTAATTAAAACCCCAGG + Intronic
1177016252 21:15791783-15791805 TTTTGTCTAATAAACTAGCTTGG + Intronic
1179554603 21:42164188-42164210 TTTGACCTAATTAGAAAGCCTGG + Intergenic
1185387436 22:50541610-50541632 TTTAGTTTACTTAAACAGCCCGG - Intergenic
951938695 3:28053015-28053037 TTTTATCTCATTAAATATCCGGG - Intergenic
953974259 3:47370703-47370725 TTTGCTATAATGAAGTAGCCAGG + Intergenic
954241248 3:49295328-49295350 TTTGGTCTTATTAAAGGGCAGGG - Intronic
955068467 3:55552581-55552603 TTTGTTCTATTAAAACAGCCGGG + Intronic
959234465 3:103701279-103701301 TTTGAATTAGTTAAATAGCCTGG - Intergenic
959843549 3:111006461-111006483 TTTGGTTTAATTAAATATTCAGG - Intergenic
966237637 3:177720217-177720239 ATTGGTATCATTAAATTGCCAGG + Intergenic
966258942 3:177952193-177952215 TTTGGTCTAATGTTGTAGCCAGG + Intergenic
967947026 3:194812158-194812180 TTTGGGCTATTTAAATAGGCTGG - Intergenic
971520448 4:27543435-27543457 TTGGGTCAAATTAAATAGGTAGG - Intergenic
971999860 4:34017590-34017612 ATTGGTCTAAGTAAATAGAGAGG + Intergenic
976510879 4:85908743-85908765 TTTGGTCAAAATACAGAGCCAGG + Intronic
977807497 4:101319502-101319524 TTTGCTTTAATTAAGTAGCATGG - Intronic
981221374 4:142240533-142240555 TTTTGTATGATTAAATTGCCTGG - Intronic
981972520 4:150681909-150681931 TTTGGTGTAATAAAATATCTTGG - Intronic
983703166 4:170623490-170623512 TTTGGTCTCATTTCATTGCCAGG - Intergenic
983850272 4:172571251-172571273 AATGTTCTAATAAAATAGCCTGG - Intronic
988266852 5:28962760-28962782 TCTGGTCTGATTATATTGCCAGG - Intergenic
989399216 5:40991331-40991353 TTTGCTCTAATTTTAGAGCCTGG + Intergenic
990227736 5:53674900-53674922 TTTGGTTTAATAAAACAGCAAGG - Intronic
991320116 5:65363940-65363962 TTAGATCAAATTAAATATCCTGG - Intronic
997031693 5:130137236-130137258 TTTGGTTGTATTAAATAGCATGG - Intronic
999033832 5:148324879-148324901 TTTGGTATAATGAAATGTCCTGG - Intronic
1002573243 5:180155940-180155962 TTTGCTCTAATTGGATAACCTGG - Intronic
1002929994 6:1627023-1627045 CTTGGTCTAATTAAATTTCAGGG - Intronic
1004366432 6:15017142-15017164 TTTTGACTAATTGAATTGCCGGG - Intergenic
1004722114 6:18276978-18277000 TTTGGACAAATTAAAATGCCTGG + Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1007496372 6:42262771-42262793 TTTTGTCTGCTTAAATACCCTGG - Intronic
1012069445 6:94594095-94594117 TTTGGTCTAATCTAATAGCTTGG + Intergenic
1012731594 6:102889014-102889036 GTTGGTCAAATTAAGTAGCATGG + Intergenic
1015458168 6:133453931-133453953 TTTGGTCTAATTCATTATACTGG - Intronic
1021176085 7:17450756-17450778 TATGGTCTAATTAAATTAACGGG + Intergenic
1023663061 7:42490360-42490382 TTTAGTCTGAGTAAATAGGCAGG + Intergenic
1027336743 7:77158865-77158887 ATTAATCTAATTAAATAGGCAGG - Intronic
1027985272 7:85279441-85279463 ATGGGACTAATTATATAGCCTGG + Intergenic
1029779046 7:102712246-102712268 ATTAATCTAATTAAATAGGCAGG + Intergenic
1034326592 7:150240288-150240310 TTTGGTATCATTAAAAAGCTCGG - Intergenic
1035816515 8:2547162-2547184 TTTGCTCTTATTACATAGGCTGG + Intergenic
1037113227 8:15191808-15191830 TTTTGTATAATTAAATAGGTAGG - Intronic
1039497427 8:37991437-37991459 TTTGGTCTCATAAAATTGGCCGG + Intergenic
1039877522 8:41599799-41599821 TTTGGTATAATTCAACAGTCAGG - Intronic
1040606483 8:48938046-48938068 TTTTATCTAATTAAATTGCTTGG - Intergenic
1043582510 8:81730539-81730561 ATTTGTTTAATTAAATAGCATGG - Intronic
1043886858 8:85610928-85610950 TTGGCCCTAATTAAATAGCCTGG - Intergenic
1047490171 8:125368107-125368129 TTTGGTTTAATTAAATAGTAAGG - Intergenic
1050881524 9:10705875-10705897 TTTTGAATAATAAAATAGCCAGG - Intergenic
1051385089 9:16499404-16499426 TGTGGTATAATTAAAATGCCAGG - Intronic
1052495352 9:29216937-29216959 TTTGCTCTGTTCAAATAGCCAGG + Intergenic
1060754859 9:126205510-126205532 TTTGGTTTAATTAAGTATCAGGG - Intergenic
1186391131 X:9160535-9160557 TTTGATCTGATTAAATAACTTGG - Intronic
1186687642 X:11942044-11942066 TTTGATGTAATGAAATAGCAAGG + Intergenic
1187121743 X:16415363-16415385 TTTGGTCAAAATGAATAGCCTGG + Intergenic
1196749546 X:119102755-119102777 TTTGGGCTGATTAAATTCCCTGG - Intronic
1197005290 X:121489216-121489238 TTTGGCCTAGTTCAACAGCCTGG + Intergenic
1198488677 X:137115634-137115656 TTTGATATAATTGAATAGCCAGG + Intergenic
1199742543 X:150749238-150749260 ATTGTTCTAATTGAAAAGCCTGG + Intronic
1201060769 Y:10044204-10044226 TTTGATGTAAATAAAAAGCCAGG + Intergenic
1202106625 Y:21376116-21376138 TTTGATGTAAATAAAAAGCCAGG + Intergenic
1202201002 Y:22347855-22347877 TTTGATGTAAATAAAAAGCCAGG - Intronic