ID: 920331378

View in Genome Browser
Species Human (GRCh38)
Location 1:205211071-205211093
Sequence CCTTCTGAGGAGGGGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 495}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920331378_920331386 -9 Left 920331378 1:205211071-205211093 CCCTTCCTCCCCTCCTCAGAAGG 0: 1
1: 0
2: 2
3: 51
4: 495
Right 920331386 1:205211085-205211107 CTCAGAAGGATGCCCTCCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 162
920331378_920331400 28 Left 920331378 1:205211071-205211093 CCCTTCCTCCCCTCCTCAGAAGG 0: 1
1: 0
2: 2
3: 51
4: 495
Right 920331400 1:205211122-205211144 CCGGCCCATGCCCGGGGACCCGG 0: 1
1: 0
2: 2
3: 14
4: 173
920331378_920331389 5 Left 920331378 1:205211071-205211093 CCCTTCCTCCCCTCCTCAGAAGG 0: 1
1: 0
2: 2
3: 51
4: 495
Right 920331389 1:205211099-205211121 CTCCCAAGGTATCCCAGATCCGG 0: 1
1: 0
2: 1
3: 10
4: 86
920331378_920331395 20 Left 920331378 1:205211071-205211093 CCCTTCCTCCCCTCCTCAGAAGG 0: 1
1: 0
2: 2
3: 51
4: 495
Right 920331395 1:205211114-205211136 AGATCCGGCCGGCCCATGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 119
920331378_920331397 22 Left 920331378 1:205211071-205211093 CCCTTCCTCCCCTCCTCAGAAGG 0: 1
1: 0
2: 2
3: 51
4: 495
Right 920331397 1:205211116-205211138 ATCCGGCCGGCCCATGCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 42
920331378_920331396 21 Left 920331378 1:205211071-205211093 CCCTTCCTCCCCTCCTCAGAAGG 0: 1
1: 0
2: 2
3: 51
4: 495
Right 920331396 1:205211115-205211137 GATCCGGCCGGCCCATGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 82
920331378_920331392 9 Left 920331378 1:205211071-205211093 CCCTTCCTCCCCTCCTCAGAAGG 0: 1
1: 0
2: 2
3: 51
4: 495
Right 920331392 1:205211103-205211125 CAAGGTATCCCAGATCCGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920331378 Original CRISPR CCTTCTGAGGAGGGGAGGAA GGG (reversed) Intronic
900161670 1:1227014-1227036 CCATCTGAGGAGAGGTGCAAGGG + Intronic
900255478 1:1696082-1696104 CCTTCTGGGGAGAGGAAGAGAGG - Intronic
900264040 1:1748313-1748335 CCTTCTGGGGAGAGGAAGAGAGG - Intergenic
900684984 1:3942552-3942574 CCTTCTAAGAAGGGGAGGTTTGG + Intergenic
901230946 1:7641473-7641495 CTTTCTGCGGCTGGGAGGAAAGG + Intronic
901640637 1:10691374-10691396 CCTTCTCAGGAGGGGACAGAAGG - Intronic
901775732 1:11559532-11559554 CGTTCTGGGGAGGGGGGGCAAGG - Intergenic
901971891 1:12914696-12914718 CCTTCTGAATTGGGCAGGAAGGG + Intronic
902013277 1:13287044-13287066 CCTTCTGAATTGGGCAGGAAGGG - Intergenic
902109215 1:14064257-14064279 CCTCCTGACGAGGGGAGGCTGGG + Intergenic
903427695 1:23266623-23266645 CCTTCTGATGGGGGAATGAATGG + Intergenic
903674457 1:25055375-25055397 ACTTCTGGGGAGGGCAGGACAGG - Intergenic
904812247 1:33171018-33171040 CCATCTGAGAAGGGAAGGAGGGG - Intronic
904870158 1:33612373-33612395 GCTTCTGTGGAGGGCAGGAAAGG - Intronic
905166092 1:36084225-36084247 CATCCTGCGGAGGGGAAGAAAGG + Intronic
905284985 1:36873494-36873516 TCTTCTTTGGAGGGGAGGAAGGG - Intronic
905335216 1:37240257-37240279 CCCTCTGGGGAGGGGAGAGAGGG + Intergenic
905877536 1:41442643-41442665 GCTTCTGAGGAGGTCAGGGAGGG - Intergenic
905943703 1:41884543-41884565 CCTTCTGAGGCTGGCAGGATGGG - Intronic
906079116 1:43071924-43071946 CCTTCTGGGGATGGGATGACAGG + Intergenic
906152770 1:43597749-43597771 CCTTCTGGGGAGGGGCGGAGGGG - Exonic
906295641 1:44647427-44647449 GCTTGTGAGGAGGGAAGGGATGG + Intronic
906726666 1:48049177-48049199 CTGTCTGAGGAGGGCAGGAGGGG + Intergenic
906948616 1:50316593-50316615 CTTTCTGAGGAGGGGCAGAAAGG + Intergenic
907338459 1:53716114-53716136 CCCACAGAGGAGGGGAGGCAAGG + Intronic
907847132 1:58219190-58219212 CTGTGTGAGGAGGGGAGGAGAGG - Intronic
908166396 1:61463347-61463369 CTTTCTGAGGAGGTGAGGTGTGG + Intergenic
909222283 1:72980622-72980644 TGTTCTGTGGAGGGGAGGAGTGG + Intergenic
912458755 1:109817525-109817547 CCTTCCCATGAGGAGAGGAAAGG - Intergenic
912496709 1:110096475-110096497 ACTTCTGATGAAGGGAGGCAGGG - Intergenic
912543027 1:110431210-110431232 CCCTCAGAGGAGTGGAGGAAAGG + Intergenic
912629632 1:111235503-111235525 CCATGTGGGGTGGGGAGGAAAGG + Intronic
913045983 1:115073818-115073840 CCTTCAGAGTAGGGAAGGAAAGG - Intronic
913117620 1:115711397-115711419 CTTTCAGAGGAGGAGATGAAAGG - Intronic
913610417 1:120504932-120504954 CTTTCTAAGGGTGGGAGGAAGGG - Intergenic
913984387 1:143551901-143551923 CTTTCTAAGGGTGGGAGGAAGGG + Intergenic
914580773 1:149017307-149017329 CTTTCTAAGGGTGGGAGGAAGGG + Intronic
914877140 1:151520492-151520514 CCTTCTCTGGATGGGAGCAAGGG + Intronic
915451587 1:156009160-156009182 TCTTCTGAGAGGGGGAGGCAGGG + Exonic
915839628 1:159203833-159203855 ACAGCTGAGGAGGGGAGGGAGGG + Intronic
915932523 1:160069276-160069298 AGTTCTGATGAGAGGAGGAATGG + Intronic
916658593 1:166900177-166900199 CCTGCTGTGGAGGGCATGAAAGG - Intergenic
916871761 1:168922315-168922337 CCTATTGAGGAGAGGTGGAAAGG - Intergenic
917262334 1:173183649-173183671 TCCTCTGAAGAGGGGAGGACGGG - Intergenic
918387094 1:184020508-184020530 GATGTTGAGGAGGGGAGGAATGG - Intronic
918525384 1:185458815-185458837 TCTTCTGAGGAATGGAGGGAAGG - Intergenic
919455836 1:197818664-197818686 CCTTTTGTTGAGGAGAGGAAAGG + Intergenic
919942361 1:202297169-202297191 ACATCAGAGGAGTGGAGGAAGGG - Intronic
920180338 1:204128604-204128626 CCTAGTGAGGGGGCGAGGAAGGG - Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920331378 1:205211071-205211093 CCTTCTGAGGAGGGGAGGAAGGG - Intronic
920742898 1:208598234-208598256 CTTGCTGAGGTGGGGAGGGATGG - Intergenic
920760494 1:208779555-208779577 CCAGCTGAGCTGGGGAGGAATGG + Intergenic
921188792 1:212692113-212692135 CCCTCTGTGGAGGGGAGAATGGG - Intronic
921622406 1:217340417-217340439 CCTCCTGAGGAGGGGACTACAGG + Intergenic
922044252 1:221928280-221928302 CCTTCTGCGGAGGAGAGGAGAGG + Intergenic
922377089 1:224979732-224979754 CCTTCTGTTGAGGAGAGGAGAGG + Intronic
922483487 1:225955767-225955789 CCTTGTGGGGAATGGAGGAAAGG + Intergenic
923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG + Intergenic
924010441 1:239659418-239659440 GCATCTGTGAAGGGGAGGAATGG - Intronic
924244747 1:242073258-242073280 CCTCCTGAGGGGAGGAGGACAGG + Intergenic
1062956745 10:1545554-1545576 CCTTAAGGGAAGGGGAGGAAGGG - Intronic
1063677158 10:8150983-8151005 CCCTTTGGTGAGGGGAGGAAGGG + Intergenic
1063918633 10:10909720-10909742 CCTTTTGGGGAGGGCAGGAAGGG - Intergenic
1064420544 10:15186951-15186973 GCTGGTGAGGAGGTGAGGAAGGG + Intergenic
1064760736 10:18617594-18617616 CCTGCCAAGGAGTGGAGGAATGG - Intronic
1065088379 10:22203658-22203680 CCTTCTGAGGGGTTGGGGAAAGG + Intergenic
1066305893 10:34140605-34140627 ACTTATGAGGAATGGAGGAAGGG + Intronic
1066428319 10:35329670-35329692 CATGCAGAGGTGGGGAGGAATGG + Intronic
1067064575 10:43096576-43096598 CATGCTAAGGAGAGGAGGAACGG - Intronic
1067095172 10:43295045-43295067 CCCTGTGAGGAGGAGAGGAGCGG - Intergenic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1068182643 10:53542020-53542042 CTTTTAGAGGAGAGGAGGAAAGG + Intergenic
1068325760 10:55484132-55484154 CCTTCTGAAGAGTGGAGGGTAGG + Intronic
1069298237 10:66873973-66873995 CATTTTGAGCAGGGTAGGAAAGG + Intronic
1069887067 10:71630494-71630516 CAATATGGGGAGGGGAGGAAGGG + Intronic
1070603541 10:77882420-77882442 CCTCCTGAGGAGGTGAAAAATGG - Intronic
1070732686 10:78842224-78842246 TCCTCTGAGCAGGAGAGGAAGGG + Intergenic
1070764416 10:79048293-79048315 CCTTCTGGGGAGGAGGGCAAGGG - Intergenic
1070957459 10:80473877-80473899 CCCTCTGAGGATGGAAGGAGGGG - Intronic
1072528743 10:96298228-96298250 AATTCAGAGGAGGGCAGGAAAGG - Intergenic
1072618452 10:97064659-97064681 ACCTCGGAGGAGGGGAGGACAGG - Intronic
1074035750 10:109736524-109736546 CTTTATGAGGAGGGGAAAAAAGG - Intergenic
1074686255 10:115964907-115964929 CCTTCAGAGGAGGATAGGAGAGG - Intergenic
1074907694 10:117879475-117879497 CCAGCTGGGGAGGGGAGAAAGGG - Intergenic
1075100640 10:119503799-119503821 CCTTGTGAGAAGAGGAGGTAAGG - Intronic
1075225346 10:120624181-120624203 CCTCCTCAGGAGGTGACGAAGGG - Intergenic
1075389914 10:122084600-122084622 CCTTCAGAGCAGGGAAGGATTGG + Exonic
1075511723 10:123077789-123077811 CCATCTAATGAGGGAAGGAAGGG - Intergenic
1075794185 10:125107146-125107168 CCTTCGGAGTAGGGGAGGAGGGG - Intronic
1075822713 10:125328472-125328494 CATTCTCAGGAAGGGAGGATCGG + Intergenic
1075930068 10:126288255-126288277 TCTTCTGAGGAGAGTAGGCAGGG + Intronic
1076345937 10:129779137-129779159 CCTTTTTAGGAAGGGAGGAAGGG - Intergenic
1076531659 10:131149118-131149140 CCTTCAGATGGGGGGTGGAATGG + Intronic
1076755697 10:132570464-132570486 CTGTCTGGGGAGGGGAGAAAGGG + Intronic
1077268183 11:1662379-1662401 ACTGCTGAGGAGGGGAAGGATGG - Intergenic
1077272699 11:1689239-1689261 ACTGCTGAGGAGGGGAAGGATGG + Intergenic
1077526337 11:3067903-3067925 CCTTCTGGGGAGGGGTAGGATGG + Intergenic
1077607491 11:3621922-3621944 CCTGCTGAGCAGGTGAGGAATGG + Intergenic
1078490020 11:11759964-11759986 CCTTCCTAAGAGGGGAGGAGGGG + Intergenic
1078497290 11:11831079-11831101 TTTTCTGAGGAGAGGAGGAAGGG + Intergenic
1080017889 11:27526524-27526546 TTTTCTGGGGAGGGGAGGAGAGG + Intergenic
1080255854 11:30289592-30289614 AGGTCTGAGGTGGGGAGGAAAGG - Intergenic
1080889766 11:36399234-36399256 CATTCTGAGCAGGGGGTGAAGGG + Intronic
1081651940 11:44830034-44830056 CCTTGTGAGGAGGGCAGGGGTGG - Intronic
1081734157 11:45391763-45391785 CCATCTGAGGATGGGAGCAGTGG + Intergenic
1081737572 11:45414717-45414739 CCTTCAGCTGAGGGGAGGAATGG - Intergenic
1082793515 11:57363861-57363883 CCCTCTGAGGAGGGTTGGCAGGG - Intronic
1082856935 11:57816620-57816642 CCTTTTGTGGAGGGGAGGGATGG + Exonic
1083088912 11:60179799-60179821 GTTTCTGAGGAGGGCAGGATGGG - Intronic
1083202090 11:61126763-61126785 CCCTCTGGGGAGGACAGGAAGGG + Exonic
1083261860 11:61527529-61527551 CATCCTGAGGAGGGCAGGGAGGG - Intronic
1083732712 11:64661399-64661421 CTTGCTGAGGTGGGGAGGAGGGG - Intronic
1083859409 11:65411913-65411935 CACTCTGAGGAGGGTAGGAGGGG + Exonic
1084345980 11:68549197-68549219 GCTTCTGAGAAAGGGAAGAAAGG - Intronic
1084438740 11:69158634-69158656 CCTGCTGAGGGAGGGAGGCAGGG - Intergenic
1084926493 11:72517234-72517256 CCCTCTGAAGAGCGGAAGAAGGG + Intergenic
1085463688 11:76710234-76710256 GCCTCTGAGGAGGGAAGGACTGG - Intergenic
1085654912 11:78305133-78305155 CCTTATGAGTAGGGAAAGAAAGG + Intronic
1085769703 11:79313839-79313861 AGTTCTGGGGAGGGGAGTAAAGG + Intronic
1086535181 11:87835723-87835745 CCTTCTGAGGCTGTGAGGGAAGG - Intergenic
1086700811 11:89898652-89898674 CCTTGTGTGGAGGGCAGGCAAGG - Intergenic
1086705358 11:89945875-89945897 CCTTGTGTGGAGGGCAGGCAAGG + Intergenic
1087018694 11:93580109-93580131 ACATCTAAGGAGGGGAGGAGGGG - Intergenic
1088504310 11:110513702-110513724 CCTTCAGAGTCGGGGAGGGAAGG + Intergenic
1088583290 11:111335499-111335521 CCTTTAGAGGAAGGGAGGACAGG - Intergenic
1088835138 11:113571617-113571639 CTTTCTGAGAAAGGGTGGAAAGG - Intergenic
1088977834 11:114831574-114831596 CTTTCCAAGGATGGGAGGAAAGG - Intergenic
1089253928 11:117183857-117183879 CCTTCTGCGAAGGGGTAGAAAGG - Exonic
1090310993 11:125739345-125739367 CATGCTGAGGAGGAAAGGAATGG + Intergenic
1090844109 11:130516667-130516689 CCTTCTGAGGAGGCAAAGCATGG + Intergenic
1091055640 11:132416321-132416343 CCATGGTAGGAGGGGAGGAATGG - Exonic
1091527998 12:1324882-1324904 CCATGTGAGGTGGGGATGAATGG - Intronic
1091807044 12:3364337-3364359 CCAGCTGAGGAGGGGAGGGGAGG - Intergenic
1091982265 12:4875594-4875616 CTTTCTTATGAGTGGAGGAAAGG + Intergenic
1092071246 12:5633223-5633245 CCTTCCTTGGAGGGGAGCAAAGG + Intronic
1092754844 12:11753596-11753618 CCTTCTGAGGAGGGTGGAACAGG - Intronic
1093235811 12:16607169-16607191 CCATTAGAGGAAGGGAGGAAGGG - Intronic
1093367667 12:18323589-18323611 TGTTCTGAGGAGGGCAGGCAGGG - Intronic
1093367681 12:18323687-18323709 TGTTCTGAGGAGGGCAGGCAGGG - Intronic
1093515066 12:19975842-19975864 GCTCCTGAGGAGGTGAGAAATGG - Intergenic
1094709946 12:32952001-32952023 CTTTCTGCTGAGGGGAGGGAAGG - Intergenic
1095497295 12:42798320-42798342 CCTTCTGGGGATGTGCGGAATGG + Intergenic
1096387459 12:51204283-51204305 CCTGCTGAGGAAGAGAGCAAAGG - Exonic
1096599704 12:52720897-52720919 CCCTCTGAGGAGACGAGGGACGG + Intergenic
1096719558 12:53510978-53511000 CCTCCTGAGGAGAGCAGGAAAGG - Intronic
1097040783 12:56154709-56154731 ACTTCTGAGGAGGGGCCCAAAGG - Intronic
1097688869 12:62715432-62715454 CTATCTGAGGAGAGGGGGAAGGG + Intronic
1100364148 12:93903961-93903983 CCGTCTGTGAAGGGGAAGAAGGG + Intergenic
1102101441 12:110281529-110281551 CCTTCTGGCGAGGGGAGGGAGGG + Intronic
1102588559 12:113940409-113940431 CCTGCTCAGGAGTGGAGGAGGGG - Intronic
1103030394 12:117607635-117607657 CCTCCCGGAGAGGGGAGGAAAGG + Intronic
1103339987 12:120216087-120216109 CCTTCTGAGTGGGGGAAGACCGG + Intronic
1103903574 12:124315850-124315872 CCCTCTGTGGAGGTGAGGAGGGG + Exonic
1104261954 12:127192895-127192917 ACTTCTGAGGACAGCAGGAATGG + Intergenic
1104278886 12:127355520-127355542 CCTTCTGGTGAGGGAAGGCATGG + Intergenic
1104359012 12:128114709-128114731 GCTGGTGAGGATGGGAGGAAAGG - Intergenic
1105501815 13:20979581-20979603 TATTCTGAGTAGGGTAGGAATGG - Intronic
1105757866 13:23486216-23486238 ACTCCTGGGGAGGGGAAGAAAGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106181259 13:27371663-27371685 CCTTCTTGGGTGGGGAGGACTGG - Intergenic
1106574953 13:30966208-30966230 TCTTCTGAGCTGGGGTGGAATGG - Exonic
1107588181 13:41874857-41874879 ACTTCTGAGGAGAGCAGTAATGG - Intronic
1107646872 13:42503343-42503365 GCTTCTTAGGTGGGGAGGAATGG - Intergenic
1107687552 13:42918921-42918943 CCTAGTGAGGAAGGGAAGAAGGG + Intronic
1109196669 13:59385209-59385231 CCATCTTTGCAGGGGAGGAATGG + Intergenic
1110122905 13:71905362-71905384 CCTTAGGAGGAGAGGAAGAAAGG - Intergenic
1110589236 13:77235698-77235720 CATTCTAATGAGGGGAGGGAGGG + Intronic
1112429454 13:99337783-99337805 CTCTCTGTGGAGGGGAGAAAGGG + Intronic
1112739488 13:102457028-102457050 CTGTCTGAGAAGGGGTGGAAGGG + Intergenic
1112966468 13:105202562-105202584 GCTTGTGATAAGGGGAGGAAGGG + Intergenic
1113008489 13:105735779-105735801 CCAGCTGGAGAGGGGAGGAAAGG - Intergenic
1113774602 13:112935964-112935986 CCTTCTGAGGCTGCGAGGGAAGG - Intronic
1113815556 13:113168057-113168079 CCAGGTCAGGAGGGGAGGAATGG - Intronic
1114622951 14:24108960-24108982 GCTGCTGAGGAGAGAAGGAAAGG - Intronic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1114749747 14:25189829-25189851 CCTTCTGTGGAGATGAGGATAGG + Intergenic
1115927218 14:38449111-38449133 CCCTGTGAGGAGGGGTGGATTGG - Intergenic
1116892866 14:50285879-50285901 GCATCTTAGGAGGAGAGGAAAGG - Intronic
1117386373 14:55217928-55217950 TATTCTGGGGAGGGGTGGAAAGG - Intergenic
1119081411 14:71697766-71697788 TCTTCTGAGTAGGGCAGGATGGG - Intronic
1119234103 14:73005267-73005289 CCCTTTGATGAGGGAAGGAAGGG + Intronic
1119696928 14:76720575-76720597 CTTTCAAAGGAGGGAAGGAAGGG + Intergenic
1119771709 14:77224271-77224293 CCTTATGCCGAGGGGAGCAAAGG - Intronic
1121017735 14:90558594-90558616 CCTTCTGATGAAGGGAGGCCTGG + Intronic
1121924364 14:97914516-97914538 TCTTCTCAGGAAGGGAGGATAGG - Intergenic
1122125092 14:99574570-99574592 GCCTGTGAGGAGGGGAGGCAGGG + Intronic
1124170257 15:27366715-27366737 GCTTATGATGAGGGGAGAAAAGG - Intronic
1124237857 15:28005179-28005201 CCTTCTGAGGAGGGGAAGTGGGG - Intronic
1125802952 15:42466788-42466810 CCCTCTAAGGATGGGAAGAAGGG - Intronic
1126435833 15:48636652-48636674 CCCACTGAGGAGGGGAATAAAGG - Intronic
1127810469 15:62561006-62561028 CCTTCTGTGTAGAGGAAGAATGG - Intronic
1128234381 15:66057670-66057692 CCTTTATAGGAGGGGTGGAAAGG + Intronic
1128450694 15:67804448-67804470 CCAGCTGAGGAGGGCAGGAGAGG + Intronic
1128815173 15:70602959-70602981 CATTCTCAGGAGGGTGGGAATGG + Intergenic
1129206901 15:74042744-74042766 CCTCATGAGTAGGGGAGGAAGGG - Intronic
1130396777 15:83509220-83509242 CCTGCCGTGGAGGGGAGGAATGG + Intronic
1131402364 15:92135303-92135325 TCTCCTGCTGAGGGGAGGAAGGG - Intronic
1131585219 15:93685175-93685197 CCCTCTGGGGAGAGGGGGAAAGG + Intergenic
1131852289 15:96555837-96555859 CCTACTAAGGAGCAGAGGAAGGG + Intergenic
1131908076 15:97165970-97165992 GCATCTTTGGAGGGGAGGAATGG - Intergenic
1132108609 15:99085504-99085526 CCCTCTGGGGAGGAGAGGAAGGG - Intergenic
1132138262 15:99366211-99366233 CCTTCTGAGGCTGTGAGGGAGGG + Intronic
1132249682 15:100325899-100325921 CCTTCTGAGGCTATGAGGAAAGG - Intronic
1132294772 15:100726875-100726897 CCTTCCCAGGAGGAAAGGAATGG - Intergenic
1132354987 15:101164620-101164642 CCTTCTGAGGCTGTGAGGGAAGG - Intergenic
1132533211 16:463954-463976 CTCTCTGAGGAGGGGTGGAGGGG + Intronic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1132957975 16:2606416-2606438 GAATCTGAGGAGGGGGGGAAGGG + Intergenic
1132970451 16:2685664-2685686 GAATCTGAGGAGGGGGGGAAGGG + Intronic
1133133776 16:3694923-3694945 CCTCCTGAGGCTGGGAGGGAGGG + Intronic
1134060526 16:11197068-11197090 CGTTCTGGGGAGGTGAAGAAAGG + Intergenic
1134086155 16:11358776-11358798 GCTTCTGAGGAGGAGAAGAAAGG + Intergenic
1135130774 16:19852130-19852152 TGTTTTGAGGAGGGGAGGGATGG - Intronic
1135963330 16:27015711-27015733 CATTCTCAGGAGGGAAGGACGGG - Intergenic
1137432552 16:48430042-48430064 GCTTCTGAGGTTGGGAGGCATGG + Intronic
1138523875 16:57590549-57590571 GCCTCTGGGGAGGGGAGGTAGGG + Intronic
1138748276 16:59389150-59389172 TCTTCTGAGGAGGTGAGAATTGG - Intergenic
1138978700 16:62240562-62240584 CTTTCTGAGGAGGCAAAGAAAGG - Intergenic
1139368010 16:66445692-66445714 CCTGAAGAGGAGGAGAGGAAAGG + Intronic
1139834606 16:69828217-69828239 CCTTAGGAGGAGGGAAAGAAAGG - Intronic
1140041382 16:71410488-71410510 CCTCCTGAGGAGCACAGGAAGGG - Intergenic
1141137815 16:81478109-81478131 CTTTCTGGGGTGGGGGGGAAGGG - Intronic
1141896520 16:86962163-86962185 CCTTCTGAGGACATGAAGAAAGG + Intergenic
1142812858 17:2403639-2403661 CCACCTGAGGAGAGCAGGAAGGG - Intergenic
1143903296 17:10190644-10190666 CCTACTGAACAGGAGAGGAAAGG + Intronic
1144187559 17:12810550-12810572 ACTTCTGGGGAGGGGAGAAGTGG + Intronic
1145077566 17:19868052-19868074 GCTCCTGAGGCGGGGACGAAGGG + Intergenic
1145924039 17:28632844-28632866 CCCTCTGGGGAGGGGAGGGGAGG - Intronic
1146204368 17:30889282-30889304 CCTTCTCAGGAGGCTAGGACAGG - Intronic
1146396508 17:32472183-32472205 CCTACTGATGAGGTCAGGAAAGG - Intronic
1147254339 17:39173245-39173267 CCAGCTGGGGATGGGAGGAATGG + Intergenic
1147660962 17:42116894-42116916 CCTTGTGGGGATGTGAGGAACGG + Intronic
1147866337 17:43555162-43555184 CCCCCTGGGGAGGTGAGGAAGGG - Intronic
1147946394 17:44082669-44082691 TCCCCTGAGGAGGGGAGAAAAGG + Exonic
1148090835 17:45021764-45021786 CCTTCTGGGCGGGGGACGAAGGG - Intergenic
1148124041 17:45227944-45227966 CCTCCTGAGGGGGGCAGGGAGGG - Intronic
1149531318 17:57397541-57397563 GCTACTGAGGAGGGCAGGAAGGG - Intronic
1149652568 17:58285276-58285298 GCATCTGAAGAGTGGAGGAAGGG - Intergenic
1149774540 17:59346832-59346854 CCTTGTGAGGAGAGATGGAAAGG + Intronic
1150416909 17:64995410-64995432 CCTCCCGAGGAGGGGAGGCAAGG + Intergenic
1150794759 17:68228515-68228537 CCTCCCAAGGAGGGGAGGCAAGG - Intergenic
1150821336 17:68436575-68436597 CCTACTGGCAAGGGGAGGAATGG + Intronic
1151285436 17:73107669-73107691 CCTTCAGAGGATGGGATGATGGG + Intergenic
1151745695 17:76010540-76010562 CCTTCTGCAGAGAGGAAGAAGGG + Exonic
1152261377 17:79269089-79269111 CCTTCTGAGAAGGGGAGATGCGG + Intronic
1152354861 17:79801801-79801823 CTTCCTGTGGAGGGGAAGAAAGG - Intergenic
1152911616 17:83008528-83008550 CCATGTGAGGAGGGCAGGCAGGG - Intronic
1153823843 18:8856609-8856631 CCATCTGAGGAGGTGAGGCCAGG + Intergenic
1153982414 18:10321678-10321700 CCTGCTGGGGAGGGCAGGACTGG - Intergenic
1154400035 18:14027864-14027886 CCTTCTGAGAAGAGGACCAAAGG - Intergenic
1155327084 18:24675500-24675522 CTGTGTGTGGAGGGGAGGAAGGG + Intergenic
1155602132 18:27561997-27562019 TCTTCTGAGAAGAGGAGGAGTGG + Intergenic
1156223143 18:35074695-35074717 CCTTGTGAGGATGGGAGTCAAGG - Intronic
1156267185 18:35499432-35499454 CGAGCTGAGGAGGTGAGGAATGG - Intergenic
1156281440 18:35643093-35643115 CCTTTTGAGGAGGGGAGGAGAGG + Intronic
1156830370 18:41484439-41484461 CATCCTGAGGAGGGGAGGTGAGG - Intergenic
1156838361 18:41582571-41582593 CCTTCTGAGGCTATGAGGAAAGG - Intergenic
1157075093 18:44457115-44457137 ACATGTGAGGAGGGGAGGGAAGG - Intergenic
1157392701 18:47316285-47316307 CTTTGGGAGAAGGGGAGGAATGG + Intergenic
1157528940 18:48406069-48406091 TCTTCCCAGGAGGGGAGGATGGG + Intronic
1157915109 18:51656644-51656666 GCCTATGAGGAGGGCAGGAAAGG - Intergenic
1158957312 18:62552195-62552217 AGTTCTGAGCTGGGGAGGAAAGG + Intronic
1159899183 18:74027134-74027156 CCTTCTGGCGAGTGGAGGCAAGG + Intergenic
1160593280 18:79956721-79956743 CCTTCAGAGGAGGAGAGGATGGG - Intergenic
1160812728 19:1019978-1020000 CCATCTGAGGAGGGCGGGAGGGG + Intronic
1160865666 19:1254886-1254908 CCATCTGCTGATGGGAGGAAGGG - Exonic
1160895686 19:1400960-1400982 CTGTCTGAGGTCGGGAGGAAGGG - Intronic
1161632678 19:5366672-5366694 CCTTGAGAGGAGGGGTGGAGAGG - Intergenic
1161645997 19:5453827-5453849 CCTTCTAAGAAAGGGAGAAAAGG - Intergenic
1162791077 19:13063301-13063323 GCTTCTGGGGAAGGGAGGGAAGG - Intronic
1163220355 19:15914191-15914213 ACTCCTGAGGAAGGGAGGGAAGG + Intronic
1163449696 19:17369020-17369042 CCTTCTGAGGCTGTGAGGGAAGG - Intronic
1163524782 19:17814118-17814140 GCACTTGAGGAGGGGAGGAAAGG - Intergenic
1163619453 19:18349702-18349724 CCTTCTGGGCAAGGAAGGAATGG - Intronic
1164436452 19:28234434-28234456 CCTGCTGATAAGGGGAGGATCGG - Intergenic
1166082365 19:40452063-40452085 CCTTGGGAGGAGGGAAGGAGGGG - Intronic
1166537274 19:43582181-43582203 CCTTTTGAGGAAGAGAGGGAAGG + Intronic
1167276070 19:48540421-48540443 CCTTTGAAGGAGGTGAGGAAAGG - Intergenic
1167373384 19:49098183-49098205 GCTGCTGAGGAGAGGAGGTAAGG - Intronic
1167786127 19:51637687-51637709 CTTTCTGTGGTGGGGATGAATGG + Intronic
1168274762 19:55271542-55271564 CATTCTGATGAGGCAAGGAAAGG - Intronic
925261699 2:2534998-2535020 ACAGCTGAGGAGGGGAGGAGTGG + Intergenic
927186392 2:20485523-20485545 TCTTCTCAGGAGGGGAGGGAAGG - Intergenic
927554085 2:24020443-24020465 GCCTCTGGGGAGGGGAGGAGAGG - Intronic
928106052 2:28471331-28471353 CCCGGTGATGAGGGGAGGAAGGG + Intronic
928931884 2:36633327-36633349 CCTACTGGAGAGGGGAGGGAGGG - Intronic
929299792 2:40289747-40289769 GCTACTCAGGAGGGGAGGAAGGG + Intronic
930058966 2:47272813-47272835 CCTTCTTTGGAGGGGTGGAGAGG + Intergenic
930315536 2:49792765-49792787 ACCTCTGAAGAGGGGAGGAGTGG - Intergenic
930381500 2:50635513-50635535 CTTTCTGAGGAGGGAAGAAGAGG - Intronic
932285721 2:70530095-70530117 CCATCTGAGGTGGTCAGGAAAGG - Intronic
933384885 2:81597465-81597487 CCTCCTGAGGTCAGGAGGAAGGG + Intergenic
934520366 2:95016566-95016588 CTTTCTGTGTTGGGGAGGAAGGG - Intergenic
934915622 2:98298977-98298999 CCCTCTGAGCCGGGGTGGAAAGG + Intronic
935268559 2:101414640-101414662 CTTCCTGAGGATGGGTGGAAAGG + Intronic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936634173 2:114236362-114236384 TCTCCTGAGGGGGTGAGGAATGG + Intergenic
936958708 2:118050161-118050183 ACTTCTGAGGAGGAGAGAAGGGG - Intergenic
937309851 2:120895332-120895354 CTTTGTTAGAAGGGGAGGAAGGG + Intronic
939466227 2:142561369-142561391 CCATCTGAGATGTGGAGGAAGGG - Intergenic
939882373 2:147644949-147644971 ACTTCTGTGGATGGGAGGACAGG - Intergenic
940014178 2:149086283-149086305 CTTTCTGATCAGGGGAAGAATGG - Intronic
940581246 2:155583965-155583987 CCCTGTGGGGAGGGGAGGGAGGG - Intergenic
940722585 2:157298387-157298409 CCTTCTGAGATGTGGTGGAAGGG - Intronic
940961673 2:159793834-159793856 CCTTCTGAAGAGGGAAGTGATGG - Intronic
944363577 2:198889833-198889855 CCTTCTGAAGATGGCAGAAAGGG + Intergenic
947717128 2:232346572-232346594 GCATCGGAGGAGGGGAGGCAAGG - Intergenic
947735554 2:232452880-232452902 GCATCGGAGGAGGGGAGGCAAGG - Intergenic
948076327 2:235167872-235167894 CCTTCTGAGGCTGTGAGGGAGGG - Intergenic
948285009 2:236777378-236777400 CCTGCTGAGGAGGAGAAGAAAGG - Intergenic
1168846980 20:952001-952023 GCTTCGGAGGAGGGAAGGGAGGG + Intergenic
1169183452 20:3591796-3591818 CCTCCTGATGGGGGGAGGAGGGG - Intronic
1169191792 20:3662674-3662696 CCCTTTGGGGAGGGGAGGAAGGG - Intronic
1171248482 20:23632066-23632088 CCGGCTGCGGAGGGGAGGCAGGG + Intronic
1172029563 20:31972291-31972313 CCCACTGAGGAAGTGAGGAAAGG + Intronic
1172320058 20:33989357-33989379 CCTTGTTAGGAAGGAAGGAAGGG - Intergenic
1172589256 20:36105931-36105953 CCTGGGGAGGAGGGGAGGAGAGG - Intronic
1172986417 20:38994898-38994920 GTTTGTGAGGAGAGGAGGAAAGG - Intronic
1173919143 20:46730996-46731018 CATTCTGGGGTGGGGAGGACTGG - Intronic
1174251745 20:49225178-49225200 CCTTCAGAAGAGGGCGGGAAAGG - Exonic
1175330889 20:58163033-58163055 TCTTCTGAGAAGGGAAGGAGAGG - Intergenic
1175456062 20:59115392-59115414 CTTTCTGAGGAGGGCAGTCAGGG - Intergenic
1175599446 20:60260866-60260888 GCTTCAGAGGATTGGAGGAAAGG + Intergenic
1175763024 20:61573918-61573940 TCTCCTGAGGGAGGGAGGAAGGG - Intronic
1176954846 21:15090264-15090286 CCTTCTCTTGAGGGGAGGGAGGG - Intergenic
1178258525 21:31077338-31077360 ATTGCTGAGGAGGGGAAGAAGGG - Intergenic
1178362224 21:31958182-31958204 CCTCCTGAGGAGGGGAACCATGG - Intronic
1179532321 21:42028453-42028475 TTTTATGAGGAGGGAAGGAAAGG + Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1180975709 22:19846951-19846973 GCTGCTGAGGATGGGAGGATGGG - Exonic
1181375459 22:22454459-22454481 TCTTTTGAGGAGGAGGGGAAAGG - Intergenic
1182727947 22:32463208-32463230 ACTTATGGGCAGGGGAGGAAAGG + Intronic
1182943493 22:34300522-34300544 CCATCTGAAGAAGGAAGGAAGGG - Intergenic
1183202509 22:36395428-36395450 CATGGTGTGGAGGGGAGGAAAGG - Intergenic
1183357667 22:37368274-37368296 GCTCCTGAGGAAGGGAGGGAGGG + Exonic
1183361123 22:37384073-37384095 CCCTGTGAGCAGGGGAGGCACGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183504409 22:38201417-38201439 AGTCCTGAGGTGGGGAGGAAGGG + Intronic
1183716866 22:39538234-39538256 AGTTCTGAGCTGGGGAGGAAAGG - Intergenic
1183938799 22:41280677-41280699 CTTTCTCAGGAGGGGATGATAGG - Intronic
1184512780 22:44942998-44943020 CCTTCTGAGGATGGGGGGGGGGG - Intronic
1184596445 22:45516978-45517000 CGTTCTCAGCAGGGGAGGAGGGG - Intronic
949347352 3:3089082-3089104 CCTAGGGAGGAGGGGAGGGAGGG + Intronic
950718433 3:14865834-14865856 CCTTCTTGGGAGAGGAGGAGTGG - Intronic
951338168 3:21450173-21450195 CCTCCAGAGGAGAGGAGGAGAGG + Intronic
951770469 3:26250423-26250445 CCTTCTGAGAAAAGGAGGAGAGG + Intergenic
952278086 3:31896842-31896864 CCTTGGAGGGAGGGGAGGAAAGG + Intronic
953078237 3:39591465-39591487 ACATCTGAGGAGGGGTGGGATGG - Intergenic
953217733 3:40936983-40937005 CCTTCTGGGGAGGGTTGGAAAGG + Intergenic
953558047 3:43962570-43962592 CCTTCTGAGGATGGAAGGAAAGG + Intergenic
953960700 3:47263693-47263715 CCTTCAGAGGAGGCCAGGATGGG - Intronic
954463332 3:50640071-50640093 CCATCTGAGAAGGGAAGCAAGGG + Intronic
954586094 3:51738013-51738035 TCTTTTGAGGAGGAGAGGAAAGG - Intergenic
954644728 3:52124208-52124230 CCTGATGAGGAAAGGAGGAAAGG - Intronic
954783432 3:53076271-53076293 CCCTCTGGGGAAGGGAGGCAGGG + Intronic
954793471 3:53149330-53149352 CCTCCTGAGGGGAGGAGGGAAGG - Intergenic
955603525 3:60673808-60673830 GCTGCTGAGGATGGGAGGAGTGG - Intronic
955971553 3:64443111-64443133 GCTGCAGAGTAGGGGAGGAAAGG + Intronic
956114692 3:65906486-65906508 ACTTTTGTGGAGGGCAGGAATGG - Intronic
957784218 3:84860359-84860381 CCTCCTGAGGAGGGGAGAGCTGG - Intergenic
958506400 3:94984255-94984277 ACTTCTGTGGAGTGGGGGAAAGG - Intergenic
960065039 3:113362394-113362416 CTTGATGTGGAGGGGAGGAAGGG + Intronic
960940244 3:122928612-122928634 CCTCCTGAGGCAGGAAGGAAAGG + Exonic
960962795 3:123083917-123083939 GCTTATGGGGAGGGGAGGAAAGG + Intronic
962010398 3:131385536-131385558 CCTTTTGAGGAAGGGAGGGTGGG + Intronic
962250136 3:133830970-133830992 CCCTGTGGGGAGGGGAGGGAAGG + Intronic
962268897 3:133963584-133963606 CCTTCTGAGCAGGGAGGGGATGG - Intronic
962400855 3:135057569-135057591 CCCTCTGAGGAGCGGGGCAAGGG - Intronic
962963586 3:140333563-140333585 TCTACTGAGGGGAGGAGGAAGGG - Intronic
964474146 3:157083692-157083714 TTCTCTGGGGAGGGGAGGAATGG - Intergenic
964743744 3:159992234-159992256 GCTTCTGAGGAGGGGCAGGAAGG - Intronic
966896247 3:184447409-184447431 CCCTCAGGAGAGGGGAGGAAGGG - Intronic
968017971 3:195356584-195356606 CCTTGAGAAGAGGAGAGGAAAGG + Intronic
968133110 3:196203668-196203690 CATTCTGGGCAGGGGAGGGAGGG + Intronic
968286942 3:197514271-197514293 CCTTCGGATGAGGGGGAGAAAGG + Exonic
968384033 4:120861-120883 CCGTCTGAGGAGTGGTGGAACGG - Intergenic
969439155 4:7207263-7207285 CCCTTTGAGGAGGGCTGGAAAGG + Intronic
969517068 4:7653808-7653830 CTGTGTGAGGATGGGAGGAAGGG - Intronic
969532451 4:7737336-7737358 CCATCTGATGAGGGGATGACGGG + Intronic
970466012 4:16323843-16323865 GCTTCAGAGTAGAGGAGGAATGG - Intergenic
976501716 4:85797818-85797840 CATTCTGAGGAGGGCAGGGTTGG - Intronic
976606385 4:86987396-86987418 CCTGCTCAGGAGGGGACAAATGG - Intronic
977022813 4:91777058-91777080 CCTTGTCTGGAAGGGAGGAAAGG - Intergenic
977332796 4:95658916-95658938 CCTTCTGGGGAGGGGGCTAAAGG - Intergenic
977591445 4:98832030-98832052 TTTTCTGAGGAGAGGAGAAAGGG + Intergenic
978187177 4:105870113-105870135 TCCTTTGAGGAGGGGAGTAATGG + Intronic
978236169 4:106463581-106463603 CATTCTGAGGAGCAGAGGATGGG - Intergenic
978841218 4:113215193-113215215 ACTTCTGAACAGGAGAGGAAAGG + Intronic
979962537 4:127037427-127037449 CCCTCTAAGGAGTGGGGGAAAGG + Intergenic
980316126 4:131203069-131203091 TCTTCTGAGGCAGGGAGGAATGG + Intergenic
980333600 4:131440740-131440762 CCCTGTGAGGAGGAGTGGAATGG + Intergenic
980710346 4:136558005-136558027 CATTGTGAGGAAGGGAGGGAGGG + Intergenic
980879354 4:138693870-138693892 TTTTCTGAGGAGTGAAGGAAAGG + Intergenic
980991675 4:139743573-139743595 CTTGCTGAGGAGTGGAGGAGGGG + Intronic
981527463 4:145720664-145720686 CATTCTGCTGAGGGGAGAAAAGG + Intronic
984797933 4:183682847-183682869 CCTTTTGAGGTTGAGAGGAAAGG - Intronic
985207070 4:187550169-187550191 CCTGCTGAGGAGGGGTGTCATGG + Intergenic
985249102 4:188005361-188005383 CCTTCTGAGGCTGGGAGGGAAGG + Intergenic
985324670 4:188754478-188754500 GCTTCTGGGGAGGTGTGGAAGGG + Intergenic
986192651 5:5511426-5511448 CCTTCTGGGGAGTGCAGGATGGG - Intergenic
987795842 5:22625952-22625974 CCATTGGAGGAGGGGAGGCAAGG - Intronic
989126181 5:38054418-38054440 TCCTCTGGGGAGGGGAGAAATGG + Intergenic
990978287 5:61578308-61578330 GACTCTGAGGCGGGGAGGAATGG - Intergenic
991302182 5:65139609-65139631 CCTACTGAAGGGTGGAGGAAGGG - Intergenic
991311456 5:65247672-65247694 CCTTTAGAGGAGGAGAGGAAAGG - Intronic
992075594 5:73190107-73190129 CCTTCTGAGGAATGAAGGAGAGG - Intergenic
992534674 5:77687605-77687627 ACTTGTGAGGAGGGGAGAGAAGG - Intergenic
992942016 5:81771989-81772011 AGTTCTGAGGAGGGGAGGCTAGG + Intergenic
993501632 5:88673220-88673242 CCTTCTGGGGAGAGGGAGAAGGG + Intergenic
996154231 5:120078136-120078158 CCTTCTGAGGAATAGAGGGAAGG - Intergenic
998211917 5:140206081-140206103 CCTGGTGAGGAAGGGAGGGAAGG - Intronic
999881016 5:155863987-155864009 ACTGCTAAGGAGAGGAGGAATGG + Intergenic
1000177604 5:158773071-158773093 CCTTAGGAGGGAGGGAGGAAAGG + Intronic
1001120449 5:168975719-168975741 ACTTCTGGGGAGGGAAGCAAAGG - Intronic
1001312998 5:170624672-170624694 TCTTGTGTGGAGGGGAGGAGAGG + Intronic
1001549825 5:172594807-172594829 CCCTCTGAGGAAGGCAGGTATGG - Intergenic
1002603807 5:180370332-180370354 GCTGCTGGGGAGGGGAGGGAGGG + Intergenic
1002776224 6:329869-329891 GCTTCTGATCAGGGGAGGAGTGG + Intronic
1003336363 6:5176540-5176562 GTTCCTGAGGAGGGGAGGAACGG - Intronic
1003435743 6:6086462-6086484 GCAGCTGAGGAGGGGAGGAAAGG - Intergenic
1004226063 6:13785332-13785354 CCTGCTCAGGAGGAGAGGAAAGG - Intergenic
1004245273 6:13969357-13969379 CCTTGTGAGTAGGGGAGTAGTGG + Intronic
1004583845 6:16980245-16980267 CCTTCTACGGTGGGGAGAAAGGG - Intergenic
1004637333 6:17481807-17481829 ACTTTGGAGGAGGGGAGGATGGG - Intronic
1004782947 6:18932395-18932417 CTTCCTGAGGAGGTCAGGAAAGG + Intergenic
1005087959 6:22026097-22026119 ACTTTTGAAGAGGGGAGTAAGGG - Intergenic
1005382517 6:25251231-25251253 CCTTCTGTGGTGAGGAGGAGTGG + Intergenic
1006028580 6:31162798-31162820 CCTCCTGGGGAGGGAAGGGAAGG - Exonic
1006106653 6:31720989-31721011 CCTTCTGAAGAGGGGACAACTGG - Intronic
1006728725 6:36219053-36219075 GGTTCAGAGTAGGGGAGGAAAGG + Intronic
1007594409 6:43042731-43042753 CATTTGGAGGAGGTGAGGAAGGG + Intronic
1007730160 6:43940724-43940746 CCTTCTGTGGCAGGTAGGAAAGG + Intergenic
1009885112 6:69616379-69616401 CCTTCTGATGAGGGTAGGAGAGG - Intergenic
1012044480 6:94252649-94252671 GCTACTGAGGCAGGGAGGAACGG - Intergenic
1013395960 6:109739907-109739929 CCTTCTGTGAGGGGGACGAAAGG + Intronic
1016750725 6:147628690-147628712 CCTTTTTTGGAGGGGAGGATGGG - Intronic
1017344753 6:153368129-153368151 TCTTCTGAGGAGGCAAGGACTGG - Intergenic
1017992192 6:159500676-159500698 GCCTGTGAGGAGGGGAGGGATGG - Intergenic
1018376382 6:163217423-163217445 TCTGCTCAGGAGGGGAGGAGGGG + Intronic
1018491043 6:164293669-164293691 CCTTCTGAGGCTGTGAGGAAAGG - Intergenic
1019255505 7:47150-47172 CCTTCTGAGGACGACAGGAGTGG - Intergenic
1019575517 7:1735759-1735781 CCTCCTCAGTAGGGGAGGGAAGG - Intronic
1019931753 7:4228139-4228161 CCTTCTGAGGTGGACAGGATTGG + Intronic
1020985730 7:15132053-15132075 CCTTCTGAGGCAGAGAGGAGTGG + Intergenic
1022224376 7:28347909-28347931 CCTCCTGAGCTGGGGAGGACTGG + Intronic
1022692535 7:32670888-32670910 GCTGCTGGGGAGAGGAGGAAGGG + Intergenic
1022920209 7:35005433-35005455 GCTGCTGGGGAGAGGAGGAAGGG + Intronic
1023403884 7:39811719-39811741 GCTTCTCAGGAAGGAAGGAAGGG + Intergenic
1024358955 7:48447635-48447657 TTTTCTGAGGAGGGGAAGAATGG + Intronic
1024984565 7:55183838-55183860 CCCTCTGATGAACGGAGGAAGGG - Intronic
1026052491 7:66959071-66959093 CCTGCTGGGGAGGGAAGGGAAGG - Intergenic
1026458056 7:70589957-70589979 CCTCCTGGGGAGGGGAAGAAAGG - Intronic
1026819611 7:73537989-73538011 ACTTCCGAGGAGGGCAGGGAGGG + Exonic
1028069242 7:86430575-86430597 AAATCAGAGGAGGGGAGGAAAGG - Intergenic
1031458031 7:122008636-122008658 TCTGCTGAGAATGGGAGGAAAGG + Intronic
1031513011 7:122671976-122671998 CCATATGAAAAGGGGAGGAAAGG + Intronic
1031581118 7:123476327-123476349 GCTACTGAGGAAGGAAGGAAAGG + Intronic
1031946792 7:127850578-127850600 CCTTCAAAGCAGGGCAGGAAGGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1034535415 7:151723014-151723036 CCTGCGGTGGAGGGGAGGAGTGG - Intronic
1034535670 7:151724432-151724454 CTTCCTCAGGAGGGGAGGACGGG - Intronic
1034652164 7:152700258-152700280 CTTCCAGAGGAGGGGAGAAAAGG - Intergenic
1034800238 7:154051782-154051804 TCTCCGGAGGAGGGCAGGAAAGG - Intronic
1036394889 8:8361215-8361237 ACCTCTTAGTAGGGGAGGAAAGG + Intronic
1036945589 8:13091740-13091762 ACTTCTGAGGAGTGTGGGAAAGG + Intronic
1037918789 8:22789540-22789562 TCTTCAGAGGCTGGGAGGAAGGG - Intronic
1037922272 8:22815819-22815841 CCTTCTGAGTATGGGGGTAAGGG + Intronic
1038240926 8:25807484-25807506 CCAGCTGAGGAGGGCAGGATGGG - Intergenic
1038443845 8:27589439-27589461 CCTTCTGAAGAGGGCTGGATAGG - Intergenic
1038667874 8:29556811-29556833 TCTTCTGTGGTGGAGAGGAAGGG + Intergenic
1038898973 8:31820310-31820332 CTATCTCTGGAGGGGAGGAAGGG - Intronic
1039483451 8:37892893-37892915 TCTAGTGAGGAGTGGAGGAAGGG - Intronic
1039598894 8:38816871-38816893 CCTTCCAGGGAGGGGAGAAAGGG - Intronic
1039799792 8:40944358-40944380 CCTTCTGAGGAGCAGAGAGAAGG - Intergenic
1040560420 8:48518679-48518701 CCTATTGAGGAGTGGAGGTAAGG - Intergenic
1040566189 8:48570009-48570031 GCTTCTGGGAAGGGGAGAAATGG + Intergenic
1044039413 8:87347772-87347794 CCTGCTGAGAAGGGGAGAAAGGG + Intronic
1044924142 8:97195492-97195514 AGTTCTGAGGTGGGGTGGAATGG + Intergenic
1045468698 8:102491844-102491866 CTTTCTGGGGAGGGCAGGCATGG + Intergenic
1045524925 8:102933424-102933446 GCTTCCTGGGAGGGGAGGAATGG - Intronic
1046507322 8:115152764-115152786 CCTTCTGAGGCGATGAGGGAGGG - Intergenic
1046591599 8:116213773-116213795 CCTTTTTATGAAGGGAGGAAGGG + Intergenic
1047807811 8:128377846-128377868 CCTGTTGAGGAGGGGACTAAGGG - Intergenic
1047903995 8:129453450-129453472 CCTTCCCAGGAGGATAGGAAAGG - Intergenic
1048395569 8:134011076-134011098 GCTTCTGAGGAGGGGGGCGAGGG - Intergenic
1048445524 8:134490036-134490058 CCCTCTGGGGAGGGGAGGACTGG - Intronic
1048455107 8:134570686-134570708 GATTATGAGGAGGGGAGAAAGGG - Intronic
1049094153 8:140538595-140538617 GGTGCTGAGGAGGGGAGGAGAGG - Intronic
1049528597 8:143142359-143142381 CCTCCTGGGGAGGGAAGGACAGG - Intergenic
1049528701 8:143142683-143142705 CCTCCTGCGGAGGGAAGGACAGG - Intergenic
1049663152 8:143829415-143829437 GCTTCCGGGGCGGGGAGGAACGG + Exonic
1049735413 8:144202446-144202468 CCCTCTGTGGAGGGGAAGAGAGG + Intronic
1050018451 9:1260081-1260103 CCCTCTGAGGAAAGGAGAAACGG - Intergenic
1050151312 9:2621896-2621918 GCTGCAGAGGAGGGGAGGCAAGG - Exonic
1052354179 9:27487394-27487416 CCGTCTCTGGAGGGGAGGATAGG + Intronic
1053000713 9:34575923-34575945 CACTGTGAGGAGGGGAGGAAAGG - Intronic
1053656585 9:40222914-40222936 CCTTCTGAGGAGGAGCGGGGCGG + Intergenic
1054198941 9:62061958-62061980 TCCTCTGCCGAGGGGAGGAAAGG + Intergenic
1054639413 9:67526409-67526431 TCCTCTGCCGAGGGGAGGAAAGG - Intergenic
1054676318 9:67858888-67858910 CCTTCTGAGGAGGAGCGGGGCGG + Intergenic
1055022777 9:71687966-71687988 CCTACTGAGGAGGCTAGGACAGG - Intronic
1055597079 9:77876245-77876267 CCTGCTCAGTAGAGGAGGAAAGG - Intronic
1057684694 9:97221776-97221798 TCTTCGGAGGAGGAGAGGAGCGG - Intergenic
1057694505 9:97313689-97313711 CCTTCTGATGAAGGGCAGAATGG + Intronic
1057815012 9:98287697-98287719 CTTTCAGAGGAGCGCAGGAAGGG + Intergenic
1059360278 9:113736797-113736819 ACTCCTGAGGAGGGAAGAAAAGG + Intergenic
1059532646 9:115050426-115050448 ACTCCTCAGGAGGGGAGAAATGG - Intronic
1059557958 9:115300418-115300440 CCGTGTGATGAGTGGAGGAAGGG - Intronic
1059896983 9:118877247-118877269 GCTTCTGAGCAAGGGAGGACAGG - Intergenic
1060401815 9:123353977-123353999 CCTTCCCAGGTGGGGAGGACAGG + Intergenic
1060537417 9:124401598-124401620 CCTACTGACGAGGGCAGGAGGGG - Intronic
1061278523 9:129583652-129583674 GCTCCTGAGCAGGGAAGGAAGGG - Intergenic
1061572517 9:131486485-131486507 CCTTCTGATGAAGAGAAGAAAGG + Intronic
1062028899 9:134353086-134353108 CCTTCTGGAGGGGGGAGGAGGGG + Intronic
1062120888 9:134833553-134833575 GCTTCTGGGAAGGGGAGGAGTGG + Intronic
1062221682 9:135419425-135419447 CCTGCTGGGGAAGGGAGGGATGG - Intergenic
1062358667 9:136177198-136177220 CCATCTGAGGAGGGCAAGGATGG + Intergenic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1186108521 X:6230815-6230837 CTTTCTGAGTAGGGAAGAAATGG + Intergenic
1186500615 X:10047511-10047533 CTGCCTGGGGAGGGGAGGAATGG - Intronic
1186765968 X:12771003-12771025 CCTTGAGAGAAGGGGAGAAATGG + Intergenic
1187288073 X:17925381-17925403 CATTCTGAAGAGTGAAGGAAAGG - Intergenic
1187488149 X:19724120-19724142 CCCTCTGAGAGGGGGAGGAAAGG - Intronic
1187819818 X:23275456-23275478 CCTTAGAAGGAGGGCAGGAAAGG + Intergenic
1189237451 X:39498141-39498163 TCTGCTGGGGAGAGGAGGAAAGG + Intergenic
1190302681 X:49065640-49065662 GCTCCTGCGGAGGGGAGGAGGGG - Intronic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1190553779 X:51613121-51613143 CAAACTGAGGAGGGGATGAAGGG + Intergenic
1190598441 X:52067828-52067850 TCTTCCGAGCAGGGGAGGGAAGG + Intronic
1190610383 X:52186245-52186267 TCTTCCGAGCAGGGGAGGGAAGG - Intronic
1190739560 X:53280249-53280271 CCCTCACAGGAAGGGAGGAAGGG + Intronic
1191900656 X:66037958-66037980 CTTTGTGATGATGGGAGGAAGGG - Intronic
1192452163 X:71251368-71251390 CCTTAGGAGGAGGGAAGAAAAGG + Intronic
1192794827 X:74418402-74418424 TCTTCTAAAGAGGGGAGAAATGG + Intergenic
1194491799 X:94560262-94560284 GCTGGTGAGGATGGGAGGAAAGG - Intergenic
1194959969 X:100223903-100223925 CTGTCTGAGGAGGGGAAGACTGG - Intergenic
1195146687 X:102025812-102025834 CCTTCTTTGGAGAGGAGGTAAGG - Intergenic
1195868588 X:109461275-109461297 GCTTCTGATGAAGGGAAGAAAGG + Intronic
1195885212 X:109630361-109630383 CCTTATGAGGTGGGCAGGTATGG + Intronic
1196719317 X:118839277-118839299 CTTTCGGGGGAAGGGAGGAAAGG + Intergenic
1196939977 X:120766121-120766143 ACTTCTGAGGAGGGCAGGCAGGG - Intergenic
1197149251 X:123202566-123202588 CCTTCAGCGGAAGGGTGGAAAGG - Intronic
1199946165 X:152669891-152669913 GGTACTGAGGAGAGGAGGAAAGG - Intergenic
1200933528 Y:8718630-8718652 CATTCTGATGAGGGGTGGATGGG - Intergenic
1201356233 Y:13099523-13099545 CCTGCTGACAAGGGGATGAACGG + Intergenic
1201488893 Y:14520615-14520637 CATTCAGAGTAGGGAAGGAATGG - Intergenic
1201908447 Y:19108518-19108540 CCTGCTGTGGGGTGGAGGAAGGG - Intergenic