ID: 920334433

View in Genome Browser
Species Human (GRCh38)
Location 1:205235141-205235163
Sequence CCTTATATGAAGCAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 1, 2: 10, 3: 80, 4: 421}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920334433 Original CRISPR CCTTATATGAAGCAGGCAGA GGG Intronic
900607086 1:3528606-3528628 CCTTATAAGAGGGAGGCAGGAGG + Intronic
900716491 1:4148384-4148406 CCTAATATCAAGCAGAGAGAAGG - Intergenic
901128652 1:6948252-6948274 CCATATATGAAGATGGCAGCTGG - Intronic
901231350 1:7643201-7643223 CCTAAGAAGAAGCAGACAGAAGG - Intronic
902574218 1:17367146-17367168 CCTTATAAGGGGGAGGCAGAGGG - Intergenic
902666180 1:17940259-17940281 CCTTATAAGAAGGAGGCAGGAGG - Intergenic
902753238 1:18532017-18532039 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
903482162 1:23661665-23661687 CCCTCTATGAATCAGGAAGAGGG - Intergenic
903512672 1:23888067-23888089 CATTATGTGAAGCAGGAAGCAGG - Intronic
904968559 1:34400551-34400573 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
905011784 1:34752038-34752060 CATTTTAGGAAGCAGGCAGAGGG + Intronic
905475963 1:38228240-38228262 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
906818828 1:48907545-48907567 CCTTATATCAAGCAGCCTGAGGG + Intronic
907133415 1:52117414-52117436 CCATATATTAAGCATGTAGAAGG + Intergenic
907290907 1:53412357-53412379 CCCTGCATGAAGGAGGCAGAAGG + Intergenic
909142453 1:71885941-71885963 GCTTTTAATAAGCAGGCAGAAGG + Intronic
909771224 1:79424689-79424711 TCTTATAAGAAGGAGCCAGAAGG - Intergenic
910498164 1:87856728-87856750 CCTTATAAGAGGAAAGCAGAGGG - Intergenic
910504320 1:87932428-87932450 CCTTCTAGGAAGAAGCCAGAGGG + Intergenic
910791391 1:91054745-91054767 CCTTACAGGCAGCAGCCAGATGG + Intergenic
912477130 1:109945971-109945993 CCTTATAAGAGGAAGGCAGGGGG - Intergenic
914334424 1:146701531-146701553 CCTTATATGAGGGAGGCAGAGGG - Intergenic
916292760 1:163184649-163184671 CCTTGTAAGAAGAAGGCAGGAGG + Intronic
916298662 1:163248954-163248976 CCCATTATGAAGCAGGCAGAGGG - Intronic
916632888 1:166636002-166636024 CCTTATAAGAAGGAAGCAGGAGG - Intergenic
916757108 1:167782755-167782777 CCTTAGAAGAGGGAGGCAGAAGG + Intronic
916801885 1:168223572-168223594 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
917902322 1:179554907-179554929 CCTTATAAGAGGGAGGCAAATGG + Intronic
918743909 1:188173770-188173792 CCTTATAAGAGGGAGGCAGATGG + Intergenic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
919183684 1:194117787-194117809 CCCTAGAGGGAGCAGGCAGATGG + Intergenic
919388564 1:196953200-196953222 CCTTATATGAATAAAGCAGCTGG + Intronic
920334433 1:205235141-205235163 CCTTATATGAAGCAGGCAGAGGG + Intronic
920949774 1:210561524-210561546 CCTTCTAGGCACCAGGCAGATGG - Intronic
921546206 1:216478009-216478031 CTTTATAAGAAGGAGGCAGAGGG + Intergenic
922391954 1:225153048-225153070 CCTTATATGAAGCTCACATATGG - Intronic
922597148 1:226822914-226822936 CCTTATAAGAGGGAGGCAGGAGG - Intergenic
923123115 1:231012514-231012536 CCTTATAAGAAAGAAGCAGAGGG - Intergenic
923773906 1:236961358-236961380 CCTTATAAGAGGGAGGCTGAGGG - Intergenic
1063020814 10:2125867-2125889 CCTTAGAGGAAAGAGGCAGAGGG - Intergenic
1064160111 10:12938066-12938088 GTTTCAATGAAGCAGGCAGATGG - Intronic
1064333898 10:14420711-14420733 CCTGATATGATGCATGGAGAAGG + Intronic
1065620496 10:27576207-27576229 CCTTATAAGAGGTAGGCAGAGGG - Intergenic
1065694969 10:28371351-28371373 TCTTATAAGAGGGAGGCAGAGGG - Intergenic
1066657313 10:37708285-37708307 CCTTATAAGAAAGAGGCAGAGGG + Intergenic
1068820301 10:61368666-61368688 CCTTATTAGAAGGAGGCAGGAGG - Intergenic
1069062319 10:63906892-63906914 CCTTATAAGAGGAAGGCAGAAGG + Intergenic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1070557743 10:77542131-77542153 CCATGTATGAAGCAGGAAGTGGG + Intronic
1070629443 10:78074475-78074497 CCTTATAAGAAGGAGGCAGGAGG + Intergenic
1073885660 10:108036880-108036902 CCTTATATGAATAAGGCAGAGGG - Intergenic
1073950632 10:108804968-108804990 GCTTCTAAGAAGCAGCCAGATGG + Intergenic
1073956489 10:108877399-108877421 TCTGGTATGAAGGAGGCAGACGG + Intergenic
1074611430 10:115025720-115025742 CCTTATCTGTACCAGGCACATGG - Intergenic
1074848056 10:117416245-117416267 CCTTATAGGAAGCACACAGATGG + Intergenic
1074912827 10:117927247-117927269 CCTTATAAGACGGAGGCAGAGGG - Intergenic
1075512600 10:123084428-123084450 CCTTATAGGAGGGAGGGAGAGGG + Intergenic
1076058554 10:127395288-127395310 ACTTATGTGGAGCAGGCAGAGGG - Intronic
1076074646 10:127523455-127523477 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1076267744 10:129122138-129122160 CATTATATTAAGCAAGCAGGTGG + Intergenic
1076377596 10:130002132-130002154 CTTTATACAAAGGAGGCAGAGGG - Intergenic
1076565267 10:131394249-131394271 CCTCATAAGAGGGAGGCAGAAGG - Intergenic
1079943630 11:26713977-26713999 CCTTATATGAGGGAGGTAGTGGG - Intronic
1080181912 11:29435680-29435702 CCTTATAAAAAGGAGGCAGGAGG - Intergenic
1080687834 11:34530132-34530154 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1080892222 11:36418941-36418963 CTTTATATGAAGCAAAAAGAAGG - Intronic
1080934021 11:36842776-36842798 CCTTATAAGAAAGAGGCAGAGGG - Intergenic
1081003940 11:37710219-37710241 CCTTTTGTGTAGGAGGCAGATGG + Intergenic
1082727384 11:56752418-56752440 CCTTACAAGAGGGAGGCAGAGGG + Intergenic
1082952632 11:58833497-58833519 CCTTCTAAGAGGGAGGCAGAGGG + Intergenic
1084052648 11:66610460-66610482 CCTTGTAAGAGGGAGGCAGAAGG - Intergenic
1084230875 11:67751746-67751768 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1084724167 11:70929636-70929658 CCTTATAAGAGGAAGGCAGAGGG - Intronic
1084885071 11:72198733-72198755 TCTTCTATGAAACAGGAAGAGGG + Intergenic
1085777127 11:79377044-79377066 CCCTATATGAAAGAGGCAGAGGG + Intronic
1086037299 11:82432068-82432090 CCTTATAAGAGAAAGGCAGAGGG + Intergenic
1086926029 11:92641603-92641625 CCTTATAAGAGAAAGGCAGAGGG - Intronic
1088765241 11:112969127-112969149 CATTAGATGGAGCAGGAAGAAGG + Intronic
1088879364 11:113961518-113961540 CCTTATTAGAGGAAGGCAGAAGG - Intergenic
1090384830 11:126351502-126351524 CCTTGTATGAACCAGGAAGCAGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091060556 11:132457518-132457540 CCTTCTATGGAGGAGGCAGGTGG + Intronic
1092519128 12:9248595-9248617 CCTAATATGTAGCAGTGAGAGGG - Intergenic
1092907189 12:13112053-13112075 CCTTATGAGAGGGAGGCAGAGGG + Intronic
1093111555 12:15158761-15158783 CCTGATATGAAGCACTAAGAAGG - Intronic
1093378596 12:18461996-18462018 CCTTATAAGAGGGAGGCAGATGG - Intronic
1094412134 12:30177878-30177900 TCTTACAAGAGGCAGGCAGAGGG - Intergenic
1094637490 12:32240529-32240551 CCTCATGAGAGGCAGGCAGAGGG - Intronic
1095309806 12:40685241-40685263 CCTTATAAGAAGGAGGCAATGGG - Intergenic
1095494733 12:42772499-42772521 CCTTACAAGAAGGAGGCAGAGGG - Intergenic
1095762478 12:45855490-45855512 CCATATATGTAGCAGGCACTGGG - Intronic
1095938085 12:47706186-47706208 TCATATTGGAAGCAGGCAGAAGG - Intergenic
1096453938 12:51769964-51769986 CCTTCTGTGAAGCAGGCATCTGG - Exonic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1098569677 12:71974509-71974531 CCTTATCAGAGGGAGGCAGAAGG - Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098694123 12:73529826-73529848 AAATCTATGAAGCAGGCAGATGG + Intergenic
1098909890 12:76198251-76198273 CCTTACAAGAGGGAGGCAGAGGG - Intergenic
1099360170 12:81690937-81690959 CCTTATAAGAAGGAGGCAAAAGG - Intronic
1099653336 12:85457053-85457075 CCATAAAGGAAGCATGCAGACGG - Intergenic
1099801401 12:87461325-87461347 GCTTTTATGAAGCTTGCAGAGGG + Intergenic
1100930137 12:99599076-99599098 CCTTATAAGAAGGAGACAGAGGG - Intronic
1100939356 12:99708683-99708705 CCTTATAAGAGGGAGGTAGAGGG - Intronic
1101039854 12:100744466-100744488 CCTTATAATAAGAAGCCAGAGGG - Intronic
1101054296 12:100896285-100896307 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1102314118 12:111872799-111872821 CCTTATAAGAGGCAGGCAAGAGG - Intronic
1102919558 12:116781645-116781667 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1103556514 12:121769950-121769972 CCTTATCTGAACCAGCCTGATGG - Intronic
1103707166 12:122882574-122882596 CCTTAAATGCAGCAGGCTTATGG + Intronic
1103951359 12:124553205-124553227 CTTTATAAGAAGGAGGCAGGAGG - Intronic
1104289074 12:127451984-127452006 CATTATAAGAAGGAGGCAGAAGG - Intergenic
1104485490 12:129148416-129148438 CCTTAAAAGAAGGAGGCAGGAGG + Intronic
1105433864 13:20360820-20360842 CCTTATGTTCAGGAGGCAGATGG + Intergenic
1107631829 13:42350621-42350643 CCTTATAAGAGGGAAGCAGAGGG + Intergenic
1107944754 13:45407826-45407848 CCATACATGAAGCGGGTAGAAGG - Intronic
1107950331 13:45455562-45455584 CCTTATAAGACACAGGCAGAGGG - Intergenic
1107990807 13:45817561-45817583 CCTTATACGAGGGAGGCAGAGGG + Intronic
1108121280 13:47189909-47189931 CCTTACAAGAGGTAGGCAGAGGG + Intergenic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1108476053 13:50818858-50818880 GCTTATAAGAAGAAGGCAAAGGG - Intronic
1109753272 13:66724366-66724388 CCTTAGATGAAGCAGGGGTATGG - Intronic
1110830611 13:80026211-80026233 CCTTATAGGAGGAAAGCAGAGGG + Intergenic
1111341385 13:86890875-86890897 CCATTTATGAACCAGGAAGAAGG + Intergenic
1111889111 13:94059694-94059716 CTTTATATAAAGCAAGCAGCGGG - Intronic
1112175848 13:97023216-97023238 CCTTATAAGAGGGAGGCAGCAGG + Intergenic
1112240472 13:97676660-97676682 CCTTATAAGAAGAGGCCAGAGGG - Intergenic
1113374444 13:109751071-109751093 CCATCTATGAAGCAGGCAGCAGG + Intergenic
1115936156 14:38555059-38555081 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1116020567 14:39455193-39455215 CCTCATTTGGAACAGGCAGAAGG - Intergenic
1116226530 14:42160740-42160762 CCTTATAAGAGACAAGCAGAGGG - Intergenic
1116632369 14:47352046-47352068 TCTTATATAAAGTAGGCAAAAGG + Intronic
1117410844 14:55449574-55449596 CCTTATATGACAAAGGCAGAGGG + Intronic
1117487999 14:56217817-56217839 CACTGTATGGAGCAGGCAGAAGG - Intronic
1117626861 14:57649456-57649478 CTTTATAAGAAGCAGGCAGGAGG - Intronic
1117873545 14:60225612-60225634 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1117904267 14:60568047-60568069 CCTTACAGAAAACAGGCAGAAGG + Intergenic
1118796434 14:69150010-69150032 CCTTATCTGAAGCAAACAGGAGG + Intronic
1119042305 14:71286050-71286072 TCTTATAAAAAGGAGGCAGAGGG - Intergenic
1119689604 14:76661263-76661285 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
1120039659 14:79738279-79738301 CCTTATAAGAGTGAGGCAGAGGG + Intronic
1121035869 14:90703146-90703168 CGTCTTATGAAGCAGGCTGACGG - Intronic
1121615358 14:95310385-95310407 CCTTATAAGAAGGAAGCAGGAGG - Intronic
1121742653 14:96264945-96264967 CCTTATAGGAGGGAGGCAGGAGG + Intronic
1121794872 14:96726413-96726435 CCTTCTAAGAAGGAGGCAGAGGG + Intergenic
1121870264 14:97400848-97400870 CCTTATGGAAATCAGGCAGAAGG - Intergenic
1121870278 14:97400918-97400940 CCTTATGGAAATCAGGCAGAAGG - Intergenic
1121944070 14:98102544-98102566 CCTTATAAGACAAAGGCAGAGGG - Intergenic
1122483064 14:102060242-102060264 CCTTATAAGAGAAAGGCAGAAGG + Intergenic
1122929142 14:104925505-104925527 CCTTAAATGCTCCAGGCAGACGG - Intronic
1124101824 15:26702970-26702992 CCATTTATGAACCAGGAAGAGGG - Intronic
1125057514 15:35379158-35379180 CCTTAGAAGAAAGAGGCAGAAGG - Intronic
1125214824 15:37259550-37259572 CCTTACAAGAGGGAGGCAGAAGG - Intergenic
1126157628 15:45580262-45580284 CCTTATATAAAGGAGGAAGGAGG + Intergenic
1126210434 15:46095125-46095147 CCTTCCTTGAAGCAGGGAGAAGG - Intergenic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1128179275 15:65587314-65587336 CCATTTATGAAGCAGGAGGATGG + Intronic
1128633532 15:69288284-69288306 CCTTTTAAGAAGGAGGCAGGAGG - Intergenic
1128787006 15:70405045-70405067 CCCTATATAAACCAGGAAGAGGG + Intergenic
1128879277 15:71228182-71228204 CCTTATAAGAGACAAGCAGAGGG + Intronic
1128961738 15:72013528-72013550 ACTTATATGGAGCTGACAGAAGG - Intronic
1129118934 15:73383183-73383205 CCTTATAAGAGGGAGACAGAGGG + Intergenic
1129702934 15:77778239-77778261 CCATATAAGAGGGAGGCAGAGGG - Intronic
1131510324 15:93046212-93046234 CTTTATAAGAAGGAGGCAGAGGG + Intronic
1132248022 15:100312225-100312247 CTTTAGATGAGGGAGGCAGAGGG + Intronic
1132336414 15:101051131-101051153 CCTTGCATGAAGCAGGCAGTTGG + Intronic
1132669398 16:1096483-1096505 CCTGAGGAGAAGCAGGCAGATGG + Intergenic
1134387200 16:13784426-13784448 GCTTATTTTAAGCAGGAAGAAGG + Intergenic
1134675648 16:16088544-16088566 CCATATAAAAAGCAGGCAGTGGG - Intronic
1135085061 16:19468627-19468649 CTTTATAAGAGGCAGGCAGGAGG + Intronic
1135408249 16:22213833-22213855 CCTTATAAAAAGGAGGTAGAAGG - Intronic
1137292770 16:47063150-47063172 CCATCTATGAACCAGGAAGAGGG + Intergenic
1137941911 16:52696198-52696220 CCTTCTAAGAATGAGGCAGAGGG - Intergenic
1138144809 16:54598982-54599004 TCTAATATGAATCAGGCAGGGGG - Intergenic
1138163168 16:54775229-54775251 GCTTTTCTCAAGCAGGCAGATGG + Intergenic
1138197129 16:55059917-55059939 CCTCATACGAGGGAGGCAGAAGG + Intergenic
1138433055 16:56981731-56981753 CCTTAAAGAAAGCAGGCGGAGGG + Intronic
1138624753 16:58241909-58241931 CCTTACAAGAGGGAGGCAGAAGG - Intronic
1139015122 16:62680497-62680519 CTTTATATGGAGCAGGAAGAGGG + Intergenic
1139509656 16:67419876-67419898 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1139999194 16:71009701-71009723 CCTTATATGAGGGAGGCAGAGGG + Intronic
1140422992 16:74836052-74836074 CCTTCTAAGAAGGAGGCAGGAGG - Intergenic
1141070724 16:80952182-80952204 CCTTATCAGAAAGAGGCAGAGGG + Intergenic
1142104956 16:88297698-88297720 CCTCATAAGAGGGAGGCAGAGGG - Intergenic
1143297512 17:5882592-5882614 CCTTATAAGACGGGGGCAGAGGG - Intronic
1143366362 17:6411172-6411194 CCTTATAAGACGGAGGCAGAAGG + Intronic
1143682551 17:8488124-8488146 CCTGCTCTGGAGCAGGCAGATGG + Intronic
1143732831 17:8890662-8890684 GCTGAGATGAAGCAGGGAGAGGG + Intronic
1143748508 17:9011422-9011444 CCTTACAAGAGACAGGCAGAGGG - Intergenic
1143959673 17:10705584-10705606 CCTTTTATTCAGCAGGAAGATGG + Intronic
1144006117 17:11101342-11101364 CATTTTAAGAAGCAGCCAGAAGG + Intergenic
1144119165 17:12133468-12133490 CCTTATCTGAGGAATGCAGAAGG - Intronic
1144335699 17:14267302-14267324 CCTTATATGAGAAAGGTAGAGGG - Intergenic
1145121869 17:20267488-20267510 CTTTATATGACACAGGGAGATGG + Intronic
1145203356 17:20966905-20966927 CTTTATATGACACAGGGAGATGG + Intergenic
1146299551 17:31677584-31677606 CCTTATAAGAAGGAGCCAGGAGG - Intergenic
1146482002 17:33212294-33212316 CCTTGTAAGAGGGAGGCAGAAGG + Intronic
1146510988 17:33448477-33448499 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1146608687 17:34285708-34285730 CCCTATAAAAGGCAGGCAGATGG + Exonic
1147035694 17:37678650-37678672 CCTTATAAGAGGGAGGAAGAGGG + Intergenic
1150050261 17:61955168-61955190 TCTTATAAGAAGGAGGCAGAAGG - Intronic
1150078076 17:62210771-62210793 ACTTATATGATGCAGGCAAGTGG + Intergenic
1150838178 17:68583498-68583520 CCTTATATGAGGAATGCAGAAGG - Intronic
1151074298 17:71253573-71253595 CCTTGCATGAGGCAGGAAGAAGG + Intergenic
1151193771 17:72417181-72417203 TCATATAAGAAGGAGGCAGAGGG + Intergenic
1151271844 17:73002918-73002940 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1151959351 17:77397353-77397375 CCTTATAGGAGAAAGGCAGAAGG - Intronic
1152025857 17:77808822-77808844 CCTTATAAAAGACAGGCAGAGGG + Intergenic
1152432237 17:80254997-80255019 CCTTCCAGGAAGCAGGCACAAGG + Intergenic
1153195403 18:2590568-2590590 CCTTATAAGATAGAGGCAGAGGG - Intronic
1153304577 18:3620169-3620191 CCTTATAAGAGGGAGGCAGGAGG + Intronic
1154088095 18:11327064-11327086 CCTTATAAGAAGGAGGCAAAAGG + Intergenic
1155498372 18:26464351-26464373 CCTTATTTGAGGGAGGCAGGAGG - Intronic
1156093088 18:33494819-33494841 CCTTATAAGAAGCAGGCAGAGGG - Intergenic
1156820368 18:41365076-41365098 CCTTGTATGAAGCATGCCGGTGG + Intergenic
1157932137 18:51834761-51834783 CCCTATATGAAGAGGGCAAAAGG - Intergenic
1158014770 18:52771206-52771228 TGGTACATGAAGCAGGCAGAAGG + Intronic
1158130518 18:54147778-54147800 CCTTCTAAAAAGCAGGCATATGG + Intergenic
1158500613 18:57997448-57997470 CCTTAAATGAGAGAGGCAGAGGG - Intergenic
1159043856 18:63349776-63349798 ACTTATAAAAAACAGGCAGAGGG - Intronic
1160960966 19:1720647-1720669 CCTTCTACAAAACAGGCAGAAGG - Intergenic
1164423189 19:28115902-28115924 CCTTTCATGAACCAGGCACATGG - Intergenic
1164455241 19:28401283-28401305 CCTAATATGAATCAGACTGATGG - Intergenic
1166499741 19:43331665-43331687 CCATATCTGAAGAAGGCAAATGG - Intergenic
1167582756 19:50356126-50356148 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1167800327 19:51736460-51736482 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1168290688 19:55355629-55355651 CCTGATATTAACCAGGCAGGAGG - Intronic
925672600 2:6327259-6327281 CATTCTGTGAAGCAGCCAGAAGG - Intergenic
926228755 2:10986925-10986947 CCATGTAGGAAGAAGGCAGAGGG + Intergenic
926442016 2:12899499-12899521 CCCTATCTGAAGCAGGAGGATGG - Intergenic
926781924 2:16480874-16480896 ACTCATATGAAGAAGGCAAAAGG - Intergenic
926811557 2:16759405-16759427 CCTCATATGGACAAGGCAGATGG - Intergenic
926820996 2:16851735-16851757 CCTTATAAGAGGCAGGCAGAAGG - Intergenic
926839442 2:17062816-17062838 CCTTGTAAGAAGGAGGCAGGAGG - Intergenic
926936608 2:18092196-18092218 CCTTCTATAAACCAGGAAGAGGG - Intronic
927191082 2:20517364-20517386 CCTTTCCTGAAGAAGGCAGAGGG - Intergenic
928600241 2:32897354-32897376 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
928842517 2:35627307-35627329 CCTTCTATGAACCAGGAAGTAGG + Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929593471 2:43161556-43161578 TGTTATATAATGCAGGCAGAGGG + Intergenic
930035438 2:47082479-47082501 CCTTATATAAGGCAGGCAGGAGG + Intronic
930312866 2:49763862-49763884 CCATATATGAACCAGGAAGCAGG + Intergenic
930322462 2:49873853-49873875 CCTTATAAGAAAGAGGCAGAAGG + Intergenic
931621172 2:64211174-64211196 TGATATATGAAGCAGGCAGCTGG - Intergenic
932206682 2:69889573-69889595 CCTTATAAGGGACAGGCAGAGGG - Intergenic
932484074 2:72070632-72070654 CCTTATAAGAGGCAGGCAGAGGG + Intergenic
933391081 2:81667598-81667620 CCTTATATAAAGAACCCAGATGG - Intergenic
933500841 2:83109316-83109338 CCTTATAAGAAGGAGACAGAGGG - Intergenic
934032870 2:88064259-88064281 CCTTATAGGAGGAAGGCAGGAGG - Intergenic
935095631 2:99941708-99941730 CCTGATAGGAAGGAGGAAGAAGG - Intronic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935628956 2:105196288-105196310 CTGTCTATGAACCAGGCAGAGGG - Intergenic
935727709 2:106038087-106038109 CCTTATAACAGGGAGGCAGAGGG + Intergenic
936004056 2:108866236-108866258 CCTTATAAAAGGGAGGCAGAAGG - Intronic
936896367 2:117432473-117432495 CCCTCTATGAAGCAAGAAGAGGG - Intergenic
937080901 2:119139008-119139030 CCTTATAAGAAGGAGGCAGCGGG - Intergenic
937342018 2:121097132-121097154 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
939913357 2:148009860-148009882 TCTTATATGTAGCAGGTAGTAGG - Intronic
939942678 2:148369016-148369038 CCTGATATGATGCATGGAGAAGG + Intronic
940541817 2:155029946-155029968 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
940854836 2:158722076-158722098 CCTTACAGGAAGGAGTCAGAGGG - Intergenic
940974086 2:159924203-159924225 CCTTAAAAGAGGCAGTCAGAGGG - Intergenic
941805556 2:169708560-169708582 CCTTATAAGAAAGGGGCAGAGGG - Intronic
941811781 2:169762572-169762594 CCTTATAAGAGTTAGGCAGAGGG - Intronic
943302145 2:186216613-186216635 CCTAATCTTAAGCAGGCAAATGG + Intergenic
943715773 2:191150906-191150928 CCTTACAAGAGGCAGCCAGAAGG + Intronic
944931908 2:204528512-204528534 CCTTATAAGAGGGAGGCAGGGGG + Intergenic
945445981 2:209939250-209939272 CCTTCTGTAAAGCAGGCAGAAGG + Intronic
946893992 2:224304242-224304264 CCTTTTAAGAGGGAGGCAGAGGG + Intergenic
946991601 2:225337227-225337249 ACTTATAAGAAGCAAGCAGCAGG + Intergenic
947029716 2:225780188-225780210 CCTTATAAGAAAAAGTCAGAAGG - Intergenic
947252301 2:228121597-228121619 CCTTTTAAGATGCATGCAGATGG + Intronic
947295745 2:228628303-228628325 TCTTATAAGAATGAGGCAGAGGG + Intergenic
948115183 2:235490207-235490229 CCTTATACGAGGAAGGCAGGAGG - Intergenic
948254551 2:236556462-236556484 CCTTATATGACGGGGGCAGGGGG + Intergenic
948449761 2:238061578-238061600 CTTTCTAGGAAGCAGCCAGAAGG - Intronic
1168881809 20:1212602-1212624 CCTTATAAGAGGTAGACAGAGGG - Intergenic
1169776584 20:9261920-9261942 CCTTGTCTCAAGGAGGCAGAAGG + Intronic
1169859641 20:10137809-10137831 CAGGATGTGAAGCAGGCAGAGGG - Intergenic
1170354533 20:15477833-15477855 CCTTATATGAGGAAGGCAGGAGG + Intronic
1170742403 20:19069521-19069543 CCATCTATGAACCAGGAAGAGGG + Intergenic
1170822407 20:19765756-19765778 CCTTTTATGAAGTAAGCACAGGG + Intergenic
1172475899 20:35237413-35237435 CCTTATAAGAGGAAGGCAGGGGG - Intronic
1173044215 20:39493916-39493938 CCTTGTAAGAGACAGGCAGAGGG + Intergenic
1173540133 20:43844772-43844794 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1174073662 20:47916677-47916699 CCTTGTAAGAAGGAGGCAGGAGG + Intergenic
1174138028 20:48393853-48393875 CCTTATGGGAAACAGGCAGAGGG + Intergenic
1174376769 20:50131239-50131261 CCTTATATGGGGCAGAGAGAAGG - Intronic
1175507513 20:59496246-59496268 CCTTATCCGAAGGAGGCAGAGGG - Intergenic
1175931112 20:62494170-62494192 CCTTATAAGAGACAGGCAGAGGG - Intergenic
1176513564 21:7766809-7766831 CCTTGTAAGAGGGAGGCAGAGGG + Intronic
1177023208 21:15888706-15888728 CCTAATAAGCAGCAGTCAGAGGG + Intergenic
1177442115 21:21139132-21139154 CTTTATAAGAAAAAGGCAGAGGG + Intronic
1177606265 21:23381468-23381490 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
1178325201 21:31639746-31639768 CCTTATATGAATCTGTGAGAAGG - Intergenic
1178428827 21:32501465-32501487 CCTTCTTTGAAGCAGAAAGATGG + Exonic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1178642357 21:34355349-34355371 CCTTATAAGAAGCAGGCAGGGGG + Intergenic
1178647677 21:34397333-34397355 CCTTGTAAGAGGGAGGCAGAGGG + Intronic
1179438081 21:41375627-41375649 CCTTATCAGAGACAGGCAGAGGG - Intronic
1181119573 22:20656944-20656966 CCCTATATAAAGCCGGCTGAGGG - Intergenic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1181988471 22:26818565-26818587 CTTTATAAGAAGCAGGCAGAGGG + Intergenic
1182096442 22:27629214-27629236 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1182191890 22:28469543-28469565 CCTTATAAGAGGGAGGCAGAGGG + Intronic
1184304530 22:43587603-43587625 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1184364359 22:44040485-44040507 CCTTATGAGAAGGAGGCAGGAGG + Intronic
1184413121 22:44337268-44337290 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1184529254 22:45044040-45044062 CCTTATGAGAGGGAGGCAGAGGG + Intergenic
949140764 3:629996-630018 CATTATTAGAAGCAGTCAGAGGG - Intergenic
949763723 3:7502055-7502077 ATTTATACGCAGCAGGCAGAAGG - Intronic
950211148 3:11124482-11124504 CCTCAAATGGAGCAGGCAGGTGG + Intergenic
952987487 3:38799082-38799104 CCTGATATTAAGAAGGCAAAAGG - Intergenic
954516291 3:51180572-51180594 CCTTATAGGACAAAGGCAGAGGG - Intronic
956892897 3:73629761-73629783 ACTTACATGGAGCAGGAAGAGGG - Intergenic
957107822 3:75913218-75913240 CCTTAGATGAAGTAGAGAGAAGG - Intronic
957245498 3:77711359-77711381 CTTTATAAGAAAAAGGCAGAGGG - Intergenic
957682858 3:83460141-83460163 CCTTATAAGAGACAGGCAGAGGG + Intergenic
957884080 3:86260644-86260666 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
958186024 3:90120144-90120166 CTTTATAAGAGGGAGGCAGAGGG - Intergenic
959872574 3:111345336-111345358 CCTTATGAGAAGCAGGCAAAGGG + Intronic
961879505 3:130050925-130050947 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
962647319 3:137453302-137453324 CCTGATATGATGCAATCAGAGGG - Intergenic
963235804 3:142954438-142954460 CATAAAATGCAGCAGGCAGAAGG - Intronic
963311686 3:143716771-143716793 GCAAATATGGAGCAGGCAGAGGG + Intronic
963823502 3:149926031-149926053 CCATATATGAAACAGACACACGG - Intronic
964298037 3:155255420-155255442 TATTCTATGAAGCAGACAGAGGG - Intergenic
964670387 3:159219006-159219028 CCTTCTAAGAGGAAGGCAGAGGG - Intronic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
965933868 3:174081413-174081435 CCTTATATGTAACAGGAAGTGGG - Intronic
966212843 3:177470705-177470727 CCAGATATGAAGAAGCCAGAGGG + Intergenic
966508863 3:180737770-180737792 GCTTATGTGAATCAGGCAGTGGG + Intronic
966990442 3:185224836-185224858 CCTTATAAGAGGGAAGCAGAAGG - Intronic
967744012 3:193034551-193034573 CCTTATATGAATTATGCACATGG - Intergenic
967954365 3:194867016-194867038 CTTTATTTGAAGCAGGAAAAGGG + Intergenic
968991717 4:3917829-3917851 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
969252526 4:5977780-5977802 CCTAAACTGAAGCAGACAGAAGG - Intronic
969823626 4:9739659-9739681 CCTTCTTTGAAGCAGAAAGATGG + Intergenic
970580033 4:17466689-17466711 CCTTATAAAAGGGAGGCAGAAGG + Intronic
970926019 4:21453313-21453335 CTTTATATGAAAGAGGTAGAAGG + Intronic
971370227 4:26013086-26013108 TTTTTTATGAAGCAGGGAGAGGG - Intergenic
971390439 4:26180506-26180528 CCATCTATGAAGCAGGAAGTGGG - Intronic
971596170 4:28531736-28531758 CCTTATAAGAGACAGGCAGGAGG + Intergenic
972247930 4:37265726-37265748 CCTTATAAGAGGGAGGCATAAGG - Intronic
973208604 4:47589044-47589066 CCTTATAAGAAAGAGGCAGAGGG + Intronic
974093285 4:57334916-57334938 CCTTATGAGAGGGAGGCAGAAGG + Intergenic
977114785 4:93010048-93010070 CAGTATTTGAAGCAGTCAGATGG + Intronic
977437873 4:97022919-97022941 CCATCTATGAAGCAGGAAGTGGG + Intergenic
978312139 4:107396376-107396398 ACTTATATGAAGCAAGAAGCTGG + Intergenic
978806212 4:112803371-112803393 CTTTATAGGAGGCAGGCAGAAGG + Intergenic
980797601 4:137704614-137704636 CCATCTATGAAGCAGGAAGCAGG + Intergenic
980869515 4:138594799-138594821 CCTTTAATGAGGGAGGCAGAGGG - Intergenic
981940682 4:150278720-150278742 AATTATATGAAACAGGCAGTGGG - Intronic
982512086 4:156295476-156295498 CATTATTTGAAGCACGAAGAAGG - Intergenic
983150148 4:164268391-164268413 CTTTATATAAAGCAGGCTTAAGG + Intronic
983268096 4:165528987-165529009 CCATATATGAACCAGGAAGTGGG + Intergenic
983432951 4:167674432-167674454 CCTTCTATGAACCAGGAAGCAGG - Intergenic
984365963 4:178800602-178800624 CATAATATGAAGAAGACAGATGG - Intergenic
984461852 4:180047281-180047303 CCTTATATGAAGGATGCAGGAGG + Intergenic
985018043 4:185657799-185657821 CATTTTATGAAGAAGGCTGAGGG + Intronic
986231582 5:5869101-5869123 CTTTATAAGAGGAAGGCAGAGGG - Intergenic
986304362 5:6504534-6504556 CCTTATAAGAGGAAGGCAGAGGG - Intergenic
986367145 5:7043731-7043753 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
986704483 5:10443856-10443878 CCTTGGAAGAAGGAGGCAGAGGG - Intronic
986864536 5:11970825-11970847 CCATCTATGAAGCAGGAAGTGGG + Intergenic
987083536 5:14447748-14447770 TCTTACATGAAGAAGGCATATGG - Intronic
988593549 5:32569891-32569913 CCTTATAAAAAGGAGGAAGAGGG + Intronic
988787551 5:34578745-34578767 CTTTATAAGAGGGAGGCAGATGG - Intergenic
990220191 5:53579814-53579836 CCTTATAAGAAGGATGCAGGTGG + Intronic
990232232 5:53725851-53725873 CCTTATAAGAGGGAAGCAGACGG - Intergenic
990412487 5:55554655-55554677 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
991039883 5:62164114-62164136 CCTTATAAAAGGAAGGCAGAGGG + Intergenic
991433218 5:66569466-66569488 CCTTATAAGAGGGAGGCAGAAGG + Intergenic
991494309 5:67212551-67212573 CCTTATAAAAAAGAGGCAGAAGG - Intergenic
992154652 5:73943090-73943112 CCTTCTATGAACCAGGAAGTTGG + Intergenic
992212875 5:74497521-74497543 CCATCTATGAACCAGGAAGAGGG + Intergenic
992318750 5:75588820-75588842 CCTTATAAGAAGGAGGCAGGAGG - Intronic
992591827 5:78303533-78303555 CCTTAAAAGAGGAAGGCAGAAGG - Intergenic
993150559 5:84156207-84156229 CTTTATATGAAGGAGGAATAGGG + Intronic
993157560 5:84244801-84244823 CCTGTTATGAACCAGGCAGTAGG + Intronic
993482325 5:88439044-88439066 CCATCTATGAAGCAGGAAGCAGG - Intergenic
993558225 5:89368272-89368294 CCTTATAAGATGGAGGCAGAAGG - Intergenic
994902997 5:105800912-105800934 CTTTATATCAAGGAGGCAGATGG - Intergenic
995495931 5:112743218-112743240 TCTTTTAAGAAGGAGGCAGAAGG - Intronic
995820045 5:116219466-116219488 CCTTATAAGAGAGAGGCAGAGGG + Intronic
997053669 5:130413777-130413799 CCTTATAAAAGGGAGGCAGAGGG - Intergenic
997254453 5:132417711-132417733 CCTTATAAGAGGGAGGCAGGGGG - Intronic
997343061 5:133161689-133161711 CCTCATGAGAAGGAGGCAGAGGG + Intergenic
998671454 5:144358746-144358768 CCTTCTATGAACCAGTCAGTAGG - Intronic
999447862 5:151655116-151655138 CCTAAAAAGAAGCAGCCAGAGGG + Intergenic
999660977 5:153862563-153862585 CCTTATAAGACAGAGGCAGAGGG - Intergenic
999704451 5:154259348-154259370 CCTGATATGATGCAAGGAGAAGG - Intronic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1000397926 5:160795687-160795709 CCTTATAAGAGAAAGGCAGAGGG + Intronic
1000954204 5:167523084-167523106 CCTTACATGAGAAAGGCAGAGGG - Intronic
1000964467 5:167639503-167639525 CTTTTTGTGAAGCAGGAAGAAGG - Intronic
1001123614 5:168999514-168999536 ACCCATGTGAAGCAGGCAGATGG + Intronic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1002458809 5:179362224-179362246 CCTTATGAGGAGGAGGCAGAGGG - Intergenic
1002939018 6:1699651-1699673 CCTTATAGGAGGAAGGCAGGAGG - Intronic
1002981157 6:2140216-2140238 CCTTATAAGAAACAGGCAGTGGG + Intronic
1003487631 6:6593325-6593347 CCTTACAGGAAGGAGGCAGAGGG - Intronic
1003754617 6:9102845-9102867 CCTTATATGATGCAATGAGAGGG - Intergenic
1003773359 6:9332588-9332610 CCTTAAATGAAACTGACAGAGGG - Intergenic
1004218371 6:13723303-13723325 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1004602267 6:17161823-17161845 CCTTCTATAAAGAAGGCAGGTGG - Intergenic
1004925432 6:20411461-20411483 CCTTCTAAGAGCCAGGCAGAGGG - Intronic
1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG + Intergenic
1005901092 6:30216794-30216816 CCTCAGATGAAGGAGGGAGAAGG - Intergenic
1006402230 6:33824635-33824657 CCTCCTATGAAACAGGAAGAGGG + Intergenic
1009197057 6:60699422-60699444 CCTTATAAGGAGGAGGCAAAGGG - Intergenic
1010009828 6:71037070-71037092 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1010029389 6:71257361-71257383 CCGCATCTGCAGCAGGCAGAAGG + Intergenic
1010503944 6:76633447-76633469 CCCTAGAGGGAGCAGGCAGATGG + Intergenic
1010623138 6:78101514-78101536 CCTTTTAAGAAAAAGGCAGATGG + Intergenic
1010943693 6:81950131-81950153 CCATATATGAACCAGACAGTGGG - Intergenic
1011083812 6:83516820-83516842 TCATATAAGAAGGAGGCAGACGG - Intronic
1011476673 6:87755444-87755466 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1012205745 6:96458354-96458376 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1013993586 6:116281085-116281107 TCTTATAAGAAGGAGGCAGGAGG + Intronic
1014425212 6:121296009-121296031 CCTGGTATGTACCAGGCAGAGGG + Intronic
1014742146 6:125158071-125158093 CCTTATAAGAGAGAGGCAGAGGG - Intronic
1015719714 6:136228476-136228498 CCTTCTATGAACCAGGAAGCAGG + Intergenic
1016062691 6:139646786-139646808 CCTTCTATGAAACAGGAAGAGGG + Intergenic
1016283814 6:142450446-142450468 CCCTATATGATACAGGCAAATGG + Intergenic
1018484075 6:164222576-164222598 CCGTCTATGAAACAGGCAGTAGG + Intergenic
1018830478 6:167438725-167438747 CCTTAGAAGAGGGAGGCAGAGGG - Intergenic
1020314523 7:6895611-6895633 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1020535478 7:9391065-9391087 TCTTATAGGAGGCAGGCAGGAGG - Intergenic
1020935135 7:14453835-14453857 CCTTTTATAAAGTAAGCAGAGGG + Intronic
1021897734 7:25253002-25253024 TCTTATAAGAGGAAGGCAGAAGG + Intergenic
1021969806 7:25954398-25954420 CTTTAAAAGAAGCAGGCAGGAGG - Intergenic
1024540035 7:50468610-50468632 CATTCTATGAAGCTTGCAGATGG + Intronic
1024868273 7:53930022-53930044 CCTTACCTGAGACAGGCAGAAGG + Intergenic
1026884977 7:73935484-73935506 CCTTATAAGAAATAGGCAGAGGG + Intergenic
1028505206 7:91562824-91562846 CCTGCTATTAAGCAGTCAGATGG - Intergenic
1029874877 7:103739809-103739831 CTGCATATGAAGGAGGCAGAAGG + Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1031587241 7:123546977-123546999 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1032134701 7:129265252-129265274 CATTATATGAAGCAAGAAGGAGG + Intronic
1033969306 7:147019630-147019652 CCTTACATGCAATAGGCAGAAGG - Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1037641578 8:20748953-20748975 CCTTATAAGAAAGAGACAGAGGG - Intergenic
1037944905 8:22982886-22982908 CCTGAGAGGAAGCAGCCAGAAGG - Intronic
1038701828 8:29856109-29856131 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1039719612 8:40149291-40149313 TCTTATAAGAAGGAGTCAGAAGG - Intergenic
1041330568 8:56719548-56719570 CCTTTTTTGAAGCGGGCAAAGGG + Intergenic
1041570998 8:59336804-59336826 TCTTATAAGAAAGAGGCAGAGGG + Intergenic
1042216723 8:66435518-66435540 CCTTATAAAAGGGAGGCAGAGGG - Intronic
1042411606 8:68473027-68473049 CATTGTATGAAGGAGGAAGAAGG - Intronic
1043213243 8:77551515-77551537 CCGTATATGAAAGAGGCAGAGGG - Intergenic
1043525839 8:81095712-81095734 CCTAGTATGTAGCAGGCACAGGG - Intronic
1043624753 8:82242973-82242995 CATTGGATGAAGCAGGAAGAAGG + Intergenic
1045478508 8:102574293-102574315 CCTTAGAAGAGGGAGGCAGAAGG + Intergenic
1046221568 8:111223536-111223558 GCTTATCTGAAACAGGGAGAGGG - Intergenic
1046414771 8:113898585-113898607 CCTTATATGAGGGAGGGAGGAGG - Intergenic
1046886675 8:119375181-119375203 CCTAATAAGAAGGAGGCAGGAGG + Intergenic
1047002440 8:120586540-120586562 CCTTATAAGAGGGAGGCAGGAGG - Intronic
1047063252 8:121251219-121251241 CCATCTATGAACCAGGAAGAAGG + Intergenic
1047541572 8:125771627-125771649 CCTTATGAAAAGGAGGCAGAGGG + Intergenic
1047771786 8:128035744-128035766 CCTTATTAGAGGGAGGCAGAGGG + Intergenic
1048356228 8:133656230-133656252 CCTTATAAGAAGGAAGCAGGAGG - Intergenic
1048917817 8:139201420-139201442 CCTTATAAGAGAGAGGCAGAAGG - Intergenic
1050208723 9:3228656-3228678 CCTCATATGTAGAAGGCATAGGG + Intronic
1050315146 9:4393741-4393763 CCTGATATGATGTACGCAGAAGG - Intergenic
1050984186 9:12061105-12061127 CCTTATAAGAAAAAAGCAGAAGG - Intergenic
1051551008 9:18329195-18329217 CCATCTATGAAGCAGGAAGTAGG + Intergenic
1051734966 9:20188631-20188653 CCTTACAAGAGGGAGGCAGAAGG + Intergenic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1052643965 9:31208158-31208180 CCTTACAAGAGGCAGGTAGAAGG - Intergenic
1053446598 9:38157959-38157981 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1055163741 9:73165117-73165139 CCTTGTATGAAGCAGGAGAAAGG + Exonic
1055618217 9:78095146-78095168 CCATCTATGAACCAGGAAGAGGG + Intergenic
1055648541 9:78384250-78384272 GCTTTTCTGATGCAGGCAGATGG - Intergenic
1055827926 9:80349041-80349063 CCTTATAAAAGGGAGGCAGAAGG + Intergenic
1056233339 9:84568915-84568937 CCTTCTAAGAAGGAAGCAGAGGG + Intergenic
1057415580 9:94859400-94859422 CCTTGTAAGAGGCAGGCAAAGGG - Intronic
1057863424 9:98660828-98660850 TCTTATAAGAAGGAGGCAGGAGG - Intronic
1058136007 9:101308235-101308257 CCTTATAAGAGACAGGCAGGAGG + Intronic
1058651726 9:107181241-107181263 CTTTATAAGAGTCAGGCAGAGGG - Intergenic
1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG + Exonic
1059561285 9:115337059-115337081 CCTTATAAGAAGGAGGCAAAGGG - Intronic
1059871563 9:118584027-118584049 GCTTATCTCCAGCAGGCAGATGG - Intergenic
1060541399 9:124432963-124432985 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1061200121 9:129133178-129133200 CCTTCCCTGAGGCAGGCAGATGG + Intronic
1061389600 9:130310111-130310133 CCTACTCAGAAGCAGGCAGAGGG - Intronic
1185687392 X:1940574-1940596 CTTTCTAAGAAGGAGGCAGAGGG - Intergenic
1187295870 X:17999981-18000003 CCTTATAAGAGGAAGACAGAGGG - Intergenic
1188152485 X:26695197-26695219 TCTTATAAGAGGGAGGCAGAAGG + Intergenic
1188347125 X:29080537-29080559 CCTTATCTGAAGCAGGAAAGAGG + Intronic
1189395092 X:40614173-40614195 ACTTTGCTGAAGCAGGCAGATGG + Intergenic
1189532674 X:41902464-41902486 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1190597886 X:52065248-52065270 CCTTCAGTGAAGCAGGAAGACGG - Intronic
1190610938 X:52188825-52188847 CCTTCAGTGAAGCAGGAAGACGG + Intronic
1191755536 X:64588524-64588546 CCTTATAAAAAGAAGGCAGGAGG - Intergenic
1191801936 X:65091165-65091187 CCTTATAAGAGGGAGACAGAAGG + Intergenic
1192093608 X:68186800-68186822 CCTTATAAGAAGGTGCCAGAGGG - Intronic
1195272462 X:103245400-103245422 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
1195509098 X:105693715-105693737 CCTTATAAGAGAGAGGCAGAAGG + Intronic
1195664559 X:107416982-107417004 CCTTATAAGAGGGATGCAGAGGG + Intergenic
1195706671 X:107742630-107742652 CCTTTTATGAAGGAGGGTGAAGG - Intronic
1196249032 X:113436385-113436407 CCTTATAAAAAGGAAGCAGAAGG + Intergenic
1196281552 X:113828774-113828796 CCTTAGAGGGTGCAGGCAGATGG - Intergenic
1196391061 X:115207881-115207903 CCTTATAAGAGGAAAGCAGAGGG + Intronic
1196391151 X:115208905-115208927 CCTTATAAGAGGAAAGCAGAGGG + Intronic
1196559986 X:117134691-117134713 CCTTATGGGAAGAAAGCAGAGGG - Intergenic
1196804992 X:119575309-119575331 TCTCAGATGAAGCAGGGAGAAGG + Intronic
1197263777 X:124344889-124344911 CCATATATTGAGCAGGCAAATGG - Intronic
1197985603 X:132263640-132263662 CCTTATAAAAGGGAGGCAGAAGG + Intergenic
1199524343 X:148775772-148775794 CCTTATAAGAGAGAGGCAGAGGG - Intronic
1199681636 X:150228714-150228736 CCTTATAAGAGGAAGGCAGAAGG - Intergenic
1199902968 X:152195705-152195727 CCTTATAAGAATCAGGCAGAAGG - Intronic
1201625064 Y:16005829-16005851 CCTTATAAGAGGAAGGCAGTAGG + Intergenic