ID: 920336222

View in Genome Browser
Species Human (GRCh38)
Location 1:205247140-205247162
Sequence CCTCAGCTTTGTTAGGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920336218_920336222 -10 Left 920336218 1:205247127-205247149 CCTTCTTTAGAACCCTCAGCTTT 0: 1
1: 1
2: 1
3: 28
4: 343
Right 920336222 1:205247140-205247162 CCTCAGCTTTGTTAGGTGTATGG 0: 1
1: 0
2: 2
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920336222 Original CRISPR CCTCAGCTTTGTTAGGTGTA TGG Intronic
900622737 1:3594873-3594895 CCTCAGCTTCAGTGGGTGTAAGG - Intronic
906697796 1:47836392-47836414 CCTCAGCCTTCTTAGCTGTGTGG + Intronic
908126838 1:61040560-61040582 CCTCAGTTTGGGTAGATGTATGG - Intronic
914989330 1:152484972-152484994 CCTCTACTTTGTGAGATGTATGG + Intergenic
919269810 1:195325515-195325537 CCCCAGCTTTGTTAGGTTTGGGG + Intergenic
920336222 1:205247140-205247162 CCTCAGCTTTGTTAGGTGTATGG + Intronic
921457469 1:215389518-215389540 CTTCAGCTTTTTCAGGTGCATGG + Intergenic
922345074 1:224689719-224689741 CCTCAGCTTTCTTGGGAGAAAGG + Intronic
1064456040 10:15488333-15488355 CCTCAGTTTTGTCATCTGTAAGG + Intergenic
1069802297 10:71089572-71089594 CCACGGCTTTGCTAGATGTATGG - Intergenic
1070976880 10:80612572-80612594 CCTCAGCTCTGTGAGGTACAAGG - Intronic
1071346276 10:84696901-84696923 CCTCAGCTATGAGAGCTGTAGGG - Intergenic
1077740176 11:4837460-4837482 CCTCAGCTTTCTGAAGTGTTGGG + Intronic
1079689564 11:23404179-23404201 CCTCAGGATTCTTAGGAGTAGGG - Intergenic
1083057845 11:59840243-59840265 CCGCAACTATGTTAGGTTTAGGG + Intronic
1084312722 11:68326222-68326244 CCTCTGCTTTGTCAGAAGTATGG + Intronic
1085318375 11:75559696-75559718 CCTCAGCTTTGCTGTCTGTAAGG + Intergenic
1087389194 11:97513011-97513033 CCTGATCTTTGCTAGATGTATGG - Intergenic
1088617136 11:111642232-111642254 CCTCAGATGTGATAGGTTTAAGG + Intronic
1089740429 11:120578502-120578524 CTTCAGCTGTGTTACGTGTAAGG - Intronic
1091015667 11:132049127-132049149 CCTCAGGTATGTGAGGTGTGTGG - Intronic
1091236475 11:134025541-134025563 CCTCAGCTTTCTTACCTCTAGGG - Intergenic
1091542158 12:1471980-1472002 CCTCAGCTGTCTTACTTGTAAGG + Intronic
1094566627 12:31604472-31604494 CCTCAGCCTTGTGAAGTGTTGGG + Intergenic
1098708867 12:73728101-73728123 CCTCAGTATTCTTAGGTGCAGGG - Intergenic
1100525515 12:95415749-95415771 CATCAGCCTTGTTAGGTGACTGG - Intergenic
1102436620 12:112929210-112929232 CTTCAGCTTTCTTGGGTGTAAGG + Intronic
1102683757 12:114708262-114708284 CCTCAGTTTCTCTAGGTGTAAGG - Intergenic
1108108547 13:47041498-47041520 CCTCAGCTTTCTCATCTGTAAGG - Intergenic
1110635328 13:77760991-77761013 CTGCAGCTTTGTTCGGTGTGGGG - Exonic
1112064470 13:95778258-95778280 CCGTAGCTTTGTTTGGTGTTTGG - Intronic
1112386807 13:98947272-98947294 ACTCAGCTTTGTGAGGTGCTTGG - Intronic
1116050653 14:39798875-39798897 TCTCACATTTGCTAGGTGTATGG + Intergenic
1120219878 14:81719917-81719939 CCTCAGCTTCCTTATCTGTAAGG + Intergenic
1122160189 14:99778033-99778055 CCTCAGCTTCGTGAAGTGTTGGG + Intronic
1123145061 14:106121411-106121433 CCACAGCTTTATTAGGTGCTGGG - Intergenic
1123196427 14:106621205-106621227 CCACAGCTTTATTAGGTGCTGGG - Intergenic
1123204311 14:106697541-106697563 CCACAGCTTTATTAGGTGCTGGG - Intergenic
1123209320 14:106744014-106744036 CCACAGCTTTATTAGGTGCTGGG - Intergenic
1123584951 15:21751135-21751157 CCACAGCTTTATTAGGTGCTAGG - Intergenic
1123693200 15:22856774-22856796 GCTGATCTTTGTTAGGAGTATGG - Intronic
1125823200 15:42651405-42651427 CCTCAGGTTTGATAGATATAAGG + Intronic
1128371510 15:67043085-67043107 CCTCAGCTTCCTTATCTGTAAGG - Intergenic
1135007604 16:18840942-18840964 CCTCAGCCTTCTTAAGTGTTGGG - Intronic
1136534722 16:30892992-30893014 CCTCAGTTTCCTTAGGTGTATGG - Intronic
1136694038 16:32060352-32060374 CCACAGCTTTATTAGGTGCTGGG + Intergenic
1136794532 16:33003615-33003637 CCACAGCTTTATTAGGTGCTGGG + Intergenic
1136875377 16:33850776-33850798 CCACAGCTTTATTAGGTGCTGGG - Intergenic
1139198474 16:64948900-64948922 CTTCAGCCTTGCTGGGTGTATGG - Intronic
1141194514 16:81850221-81850243 CATCAGTTTTGTTAGGTGTAAGG + Intronic
1142437063 16:90067078-90067100 CCTCAGCCTTGTGAGTTGTTGGG + Intronic
1203096795 16_KI270728v1_random:1265266-1265288 CCACAGCTTTATTAGGTGCTGGG + Intergenic
1142600224 17:1050252-1050274 CCTCAGCTTTGCAAGGAGGAGGG + Intronic
1142910900 17:3089889-3089911 ACTCAGCACTGTTAGGGGTAGGG - Intergenic
1142955534 17:3519039-3519061 TCTGGGCTTTGTTAGGTGGAAGG - Intronic
1143379285 17:6485954-6485976 TTTCAGCTTTGTGAGCTGTAAGG - Intronic
1143576860 17:7798840-7798862 CCTCAGCCCTGTAAGGTGGAAGG + Intronic
1144225286 17:13139213-13139235 CTGCAGCTTTTTTAGGTGCATGG - Intergenic
1145841639 17:28000087-28000109 CCTCAGCTCTGCAAGGTGTTGGG - Intergenic
1147760601 17:42795349-42795371 CCTCAGCTGTGTGGGGTGAAGGG - Exonic
1151640822 17:75392122-75392144 CCTCAGTTTTCATTGGTGTATGG - Intronic
1152009341 17:77701430-77701452 CCTCAGTTTTGCTAAGTGTGTGG + Intergenic
1153621936 18:6987679-6987701 CCTCAGCTTTCACAGGTGTCAGG + Intronic
1155248212 18:23931404-23931426 CCTCAGCCTTCTTAGTTGTTGGG - Intronic
1155841511 18:30650260-30650282 CTTCAGCTGAGTTGGGTGTAGGG - Intergenic
1156333930 18:36151552-36151574 CCTCAGCTTTCCTAAGTGTTAGG - Intronic
1158501769 18:58008698-58008720 CCTAAGCTTTTTCAGGTGTTTGG + Intergenic
1163153876 19:15429676-15429698 CCTCAGGATTCTTAGGGGTAGGG + Intronic
1164769347 19:30796103-30796125 CCTCAGCTTTCCTAAGTGTTGGG - Intergenic
1167767661 19:51495061-51495083 CCTCAACTTTATTAAGTTTATGG - Intronic
1168714084 19:58517100-58517122 CCTCAGCCTTGGCAGGTGTTGGG + Exonic
925453303 2:3990436-3990458 CTGCAGCTTTTTTAGGTGCATGG + Intergenic
925636457 2:5945909-5945931 CCTCAGCTTTGATTGGGGTGTGG + Intergenic
928445957 2:31333362-31333384 CCTCAGCATGGTCAGGGGTAGGG + Intergenic
928847024 2:35688318-35688340 CCTCAGCGTAGTGGGGTGTAGGG - Intergenic
929292478 2:40209352-40209374 CCTCACCTGTGTAAGGTTTAAGG + Intronic
929681065 2:43994497-43994519 CCTCAGCTTCCTTAGCTATAAGG - Intronic
932988023 2:76750361-76750383 CCTCAGCCCTGTAAGTTGTAGGG + Intronic
936147203 2:109987821-109987843 CCTCGGCTTTGGCAGGTGTCGGG + Intergenic
936197489 2:110383662-110383684 CCTCGGCTTTGGCAGGTGTCGGG - Intergenic
936752442 2:115661450-115661472 TCTAAGTTTTGTTAGGTGAATGG + Intronic
942907435 2:181200631-181200653 TGTCAACTTGGTTAGGTGTAGGG + Intergenic
943641953 2:190369325-190369347 CCTCAGCTTTGCTTGTTGTTAGG + Intronic
945528400 2:210919257-210919279 CCACAGCTTTATTAAGTGTAGGG - Intergenic
1169953551 20:11075520-11075542 CCTCAGCTTTGTTAGCAGCTTGG - Intergenic
1172108820 20:32533364-32533386 CATCAGATTTGGTAGGTTTAAGG - Intronic
1172645454 20:36466356-36466378 CATCAGCTTTGTTTTGTGTGGGG + Intronic
1176911723 21:14573553-14573575 CCTCAGCTGGTTTAGGTTTAGGG - Intronic
1178708533 21:34894134-34894156 GCTCAGCTTTAATAGGTGTTGGG + Intronic
1180636808 22:17268333-17268355 CTTCAGCCTTCTCAGGTGTATGG + Intergenic
1181808820 22:25391305-25391327 CCTCTGCTTTGTTAGAGGTATGG - Intronic
1183988140 22:41580515-41580537 CCTCAGTTTCCTTATGTGTAAGG - Intronic
957177654 3:76832439-76832461 CCTCAGTTTTTTTATGTGTTTGG - Intronic
957304543 3:78440892-78440914 CCAAAGCTGTGGTAGGTGTATGG + Intergenic
958729287 3:97943897-97943919 CCTCAGCTTTGTTAGGAATAAGG + Exonic
959925566 3:111917682-111917704 CCTCAGGTTTGTTAGGACAAAGG - Intronic
961248423 3:125477870-125477892 TTTCAGCTTTGTTAGCTTTATGG - Intronic
961969651 3:130947158-130947180 GCTCTGTTTTGGTAGGTGTAGGG + Intronic
965481045 3:169220074-169220096 CCTCAGCTTTCTTAAGTGTTGGG - Intronic
968113321 3:196068360-196068382 CCTCAGCCTTGCAAGGTGTTGGG - Intronic
971288718 4:25314988-25315010 TTTCAGTTTTGTTAGGTTTATGG + Intronic
974516883 4:62927103-62927125 GCTCTGCTTTATTAGGTGAATGG + Intergenic
978100377 4:104832400-104832422 GCTCTGCTTTTTTATGTGTAAGG - Intergenic
982261392 4:153497110-153497132 CCTCAGCTTCCTGAGGTGTTGGG + Intronic
982696846 4:158611706-158611728 ACCCAGCTTTGCTAGGGGTAGGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
985737042 5:1589684-1589706 CCTCAGCTTTGTAAAGTGCTGGG - Intergenic
985765745 5:1778514-1778536 TCTCAGCTTGGTTGGGGGTATGG + Intergenic
987863987 5:23517669-23517691 CCTCAGCCTTGTGAGTTGTTGGG - Intronic
992008238 5:72500407-72500429 CTTCAGCTTTGTTAGATCTGGGG + Intronic
992773791 5:80072500-80072522 CCTCTGCTTTGTTAGGTAAGTGG - Intronic
992881522 5:81114931-81114953 TCTCAGCTTGGTACGGTGTAGGG + Intronic
994878857 5:105460729-105460751 CTGCAGCTTTTTTAGGTGCATGG + Intergenic
995517434 5:112968059-112968081 CCTCAGCTTCCTTAAATGTAGGG + Intergenic
996842929 5:127868197-127868219 CCTAAGATTTTTTAAGTGTAAGG - Intergenic
997180405 5:131822881-131822903 CCTCAGCTTTTATTTGTGTATGG + Intronic
1001671147 5:173474977-173474999 TCTCAGCCCTGTTAGGAGTATGG + Intergenic
1003526601 6:6903388-6903410 CTTCAGCTTACTGAGGTGTAAGG + Intergenic
1003723096 6:8727478-8727500 CATCAGCTTTGCTGGATGTAGGG + Intergenic
1005435306 6:25803679-25803701 CCTCAGTTTCTTTAGTTGTAAGG + Intronic
1006580789 6:35076573-35076595 CCTCAGCTTCCTCAGTTGTAGGG + Intronic
1006690711 6:35882543-35882565 CCTCAGCTTTGCAAGGTGCTGGG + Intronic
1007063740 6:38968533-38968555 ACTCAGCTTTGTTAGTTATTAGG + Intronic
1007647232 6:43392271-43392293 CCTCTACTTTGTGAGATGTATGG - Intergenic
1008569760 6:52805097-52805119 CCTCAGTTTTGTAAGGGGTGAGG - Intergenic
1009843206 6:69103131-69103153 ACTCAGTTTTGTAAGGTGGATGG + Intronic
1011620766 6:89240428-89240450 CCTCAGTTTTGTTGCGTTTAAGG - Intergenic
1013719790 6:113010673-113010695 CTTCACCTTTGATAGGTGTCTGG + Intergenic
1014029067 6:116680790-116680812 TCGCAGCCTTGTTAAGTGTACGG - Intergenic
1015259296 6:131216812-131216834 CCTCCTCCTTGTTAGGTTTAAGG + Intronic
1017188045 6:151622495-151622517 CTTCAGCTTTGTTAGATCCAGGG + Intergenic
1023324039 7:39032919-39032941 CCTCAGCGTGGTGAGGAGTATGG + Intronic
1029059761 7:97785455-97785477 CCTCAGCTTTATTAGGCTTATGG - Intergenic
1030129847 7:106189856-106189878 ACTCAGGTTTGTTAGGTTTCTGG + Intergenic
1030187605 7:106778894-106778916 CCTCAGCTCTGTTAGTTTGAGGG + Intergenic
1030381808 7:108820385-108820407 CCTAACCTTTGTTATCTGTAAGG - Intergenic
1033358035 7:140616672-140616694 AGTCAGCTTTGTTTGGTCTAGGG - Intronic
1036166948 8:6444185-6444207 CCTGGGCTTTGATGGGTGTATGG - Intronic
1037303069 8:17473311-17473333 CCTCAGCTTTGAAAGATGTTGGG - Intergenic
1039497978 8:37995642-37995664 CCTCAGCCTCGTTAAGTGTTAGG - Intergenic
1042572678 8:70184025-70184047 CCTCCACTATGTTAGGTATATGG - Intronic
1042806619 8:72777336-72777358 CCTTAGGTTTGTTAGGTATGGGG + Intronic
1044669485 8:94664426-94664448 CCTCAGCTTTGATAGATAGATGG + Intronic
1044684805 8:94816546-94816568 CCTCAGCTTCTTCAGCTGTAAGG + Intronic
1045091857 8:98754121-98754143 ACTCAGCTTTGCTAGGTCTTGGG + Intronic
1045674030 8:104588773-104588795 CCTCAGCTTTGTTCGGTCAGCGG + Intronic
1049304419 8:141893333-141893355 CCTCAGATCTCTTAAGTGTAAGG - Intergenic
1049955477 9:688963-688985 CCTCACCTCTTTTAGGTGTGAGG + Intronic
1051420413 9:16883430-16883452 CCTCAGCCTTCTTAAGTGTTGGG + Intergenic
1051446679 9:17147374-17147396 GCTCAGCTTTTTTTGGTGAATGG + Intronic
1051750865 9:20339694-20339716 CCTCAGAATTGTTAGATGTCGGG - Intergenic
1055802992 9:80060866-80060888 CCTCAGCTTTGCAAAGTGTGAGG + Intergenic
1056349914 9:85739761-85739783 CCTCAGCTTCTTAAGGTGCAGGG - Intronic
1057123017 9:92594229-92594251 CTTCAGCTTTATTAGTTTTAGGG + Intronic
1057420990 9:94912254-94912276 TCTTAGCTTTGTTAGGTGTTTGG + Intronic
1058089309 9:100786200-100786222 CCTCTGGTTTGTAAGGTGTCAGG - Intergenic
1058240539 9:102552495-102552517 CCTCAGCCTTCTTAGGTGCTAGG + Intergenic
1062137727 9:134938524-134938546 CCTCAGCTTTGTCACCTGGAGGG - Intergenic
1188807805 X:34613531-34613553 CTTCAGCTTTTCCAGGTGTACGG + Intergenic
1189329755 X:40136655-40136677 CCAAAGCTTTGGTAGGCGTATGG + Intronic
1192713543 X:73616386-73616408 CTGCAGCTTTTTCAGGTGTATGG + Intronic
1193047639 X:77069336-77069358 CCTCTACTTTGTGAGATGTATGG - Intergenic
1195318457 X:103701177-103701199 CCTCAGCTTTTTCAGGTGCGGGG - Intergenic
1195766276 X:108299309-108299331 CCTGAGCTTTGTGAAGTTTAAGG + Intronic
1196114914 X:111988583-111988605 CCTAAGCATTCTTAGGAGTATGG + Intronic
1197254464 X:124247715-124247737 CCTCAGCCTTGTGAGGTGCTGGG + Intronic
1198912868 X:141633868-141633890 CTGCAGCTTTTTTAGGTGCACGG - Intronic