ID: 920338485

View in Genome Browser
Species Human (GRCh38)
Location 1:205260336-205260358
Sequence CCCAGCCCAAAGCAGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920338485_920338494 11 Left 920338485 1:205260336-205260358 CCTGTGCCCTGCTTTGGGCTGGG 0: 1
1: 0
2: 3
3: 36
4: 383
Right 920338494 1:205260370-205260392 ATTTCTGCCTGCTACTGACTGGG 0: 1
1: 0
2: 3
3: 15
4: 255
920338485_920338496 26 Left 920338485 1:205260336-205260358 CCTGTGCCCTGCTTTGGGCTGGG 0: 1
1: 0
2: 3
3: 36
4: 383
Right 920338496 1:205260385-205260407 TGACTGGGAGTTGAGTGATCTGG 0: 1
1: 0
2: 3
3: 20
4: 181
920338485_920338493 10 Left 920338485 1:205260336-205260358 CCTGTGCCCTGCTTTGGGCTGGG 0: 1
1: 0
2: 3
3: 36
4: 383
Right 920338493 1:205260369-205260391 CATTTCTGCCTGCTACTGACTGG 0: 1
1: 0
2: 1
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920338485 Original CRISPR CCCAGCCCAAAGCAGGGCAC AGG (reversed) Intronic
900093329 1:930007-930029 CCGAGCCCCAAGCACGGCAGAGG - Intronic
900150830 1:1178772-1178794 CACAGCCCACAGCTGGGCTCCGG + Intronic
900186039 1:1333718-1333740 ACCAGGCCAAAGCAGGCCAGGGG - Exonic
900210178 1:1451748-1451770 CCCAGCCTGAATCAGGGCAGTGG + Intronic
900215728 1:1480569-1480591 CCCAGCCTGAATCAGGGCAGTGG + Intronic
900374526 1:2347395-2347417 CCCATCCCGAAGCAGGGTATGGG + Intronic
900400391 1:2470662-2470684 CCCAGCCCATAGCCAGGCGCGGG - Intronic
900703372 1:4061538-4061560 CACAGCACAGGGCAGGGCACAGG - Intergenic
900964816 1:5950545-5950567 CACTGGCCAAAGCAGGTCACTGG - Intronic
901670077 1:10850856-10850878 CCAGGCACACAGCAGGGCACAGG + Intergenic
902470143 1:16643365-16643387 CCCAGCCCTGTGCTGGGCACAGG - Intergenic
902612238 1:17603965-17603987 CTCAACCCAGAGCAGGGCGCAGG - Intronic
902955569 1:19922477-19922499 CCGAGCCCAAAGCAGCCCAGAGG + Intronic
903030687 1:20462272-20462294 CCCCACCCAAAGCTGGGCAGTGG - Intergenic
903666779 1:25012881-25012903 CCCGGCCCAGAGCAGGCCCCAGG - Intergenic
904046305 1:27610964-27610986 CCCAGCACAGGGCAGGACACAGG + Intergenic
904254347 1:29245100-29245122 CCCAGCCCAGGGCAGGACAGAGG - Intronic
904330727 1:29756234-29756256 CCCAGCCCCAAGCAAGTCCCTGG - Intergenic
904614821 1:31744019-31744041 GCCAGCCCGGTGCAGGGCACTGG - Intronic
905205997 1:36343172-36343194 CCAAGCCCAAGGCAGGCCCCAGG + Intronic
905448622 1:38043567-38043589 CCTAGACCAAACCAGGGCCCGGG - Intergenic
905545950 1:38800936-38800958 CCCAGCCCCAACAAGAGCACAGG - Intergenic
906209877 1:44006828-44006850 CCCAGCCCAGAGGTTGGCACAGG + Intronic
906536255 1:46552450-46552472 CCCACCCCAAGGCTGGGCAGTGG + Intergenic
906541411 1:46589341-46589363 CCCAGACCAAGGAAGGGCACAGG + Intronic
907872533 1:58455946-58455968 GTCAGCCCAGAGCAGGGCCCTGG + Intronic
909490801 1:76224343-76224365 CCCAGCCCAGAGGAAGGTACTGG + Intronic
910949396 1:92629821-92629843 CCCACCCCAAAACAGGCCCCAGG + Intronic
911045815 1:93626597-93626619 CTCAGCACAAAGCAAGGCAGAGG + Intronic
913193656 1:116434259-116434281 CCAAGCCAAAAGCAGGAGACAGG + Intergenic
913243999 1:116855527-116855549 CTCAGACCAAAGCAGGGCGGGGG + Intergenic
915107904 1:153545849-153545871 CCCTGCCCATAGCAGGGGACAGG + Exonic
915585246 1:156840766-156840788 CCCACCCCAACTCAGGGCAAGGG - Exonic
916480751 1:165212249-165212271 CACAGGCCAAAGCAAGGCATGGG - Intronic
916824269 1:168429149-168429171 CCTAGCACAGAGCAGGGTACAGG - Intergenic
916826117 1:168443604-168443626 CCCAGACCAAATCAGGGTCCCGG + Intergenic
917652653 1:177094424-177094446 CTAAGCCCAAAGCAGGGGACTGG - Intronic
919355842 1:196520564-196520586 CTCAACCCAAAGCATGGTACTGG + Intronic
920338485 1:205260336-205260358 CCCAGCCCAAAGCAGGGCACAGG - Intronic
920366816 1:205452285-205452307 CTCAGCCCACATCAGGGCACTGG + Intronic
920508639 1:206534668-206534690 GACAGCCCAAAGCAGGGGCCTGG - Intronic
921650719 1:217674739-217674761 CACAGGCCAGAGCAGGGCAAGGG - Intronic
922219890 1:223550419-223550441 CCCAGCCCACAGGAGGACACAGG - Intronic
922774884 1:228210102-228210124 CCCCACCCACAGCAGGGCTCTGG - Intronic
922892766 1:229074291-229074313 CCCAGCCCACAGGAGGGCAGAGG + Intergenic
924796002 1:247292555-247292577 CCCTGGCCAAAGGAGGGCTCTGG + Intergenic
1064012240 10:11743739-11743761 CACAGGCCAGAGCAGGGCCCAGG + Intronic
1064736067 10:18382990-18383012 CCTAGCCCACAGGATGGCACGGG + Intronic
1066054378 10:31666824-31666846 CCCATCAGAAAGCAGGGCAAAGG + Intergenic
1066687247 10:37992886-37992908 CCCAGCACAGAGAGGGGCACTGG + Intergenic
1067174172 10:43930832-43930854 CACAGCCCCAAGCAGGAAACTGG - Intergenic
1067205274 10:44207324-44207346 TTCAGCCCAGCGCAGGGCACAGG + Intergenic
1067237361 10:44462266-44462288 CCCAGCCCTAAGCGGGGAACTGG + Intergenic
1067486515 10:46655656-46655678 CCCACCCCAAAATAGGGCCCAGG + Intergenic
1067608237 10:47686002-47686024 CCCACCCCAAAATAGGGCCCAGG - Intergenic
1067792383 10:49298126-49298148 CCCAGCCCCAAGCTGGGGCCTGG - Intergenic
1069526866 10:69180302-69180324 CCGAGCCCACAATAGGGCACGGG - Exonic
1069661794 10:70127809-70127831 CCCAGACCAGAGCAGGGCCAGGG + Intronic
1069771128 10:70901278-70901300 TCCAGCCCATGGCGGGGCACGGG - Intergenic
1069823752 10:71242850-71242872 CCCTGCCAGCAGCAGGGCACTGG + Intronic
1069862632 10:71481111-71481133 CCCAGGCCACAGCTGGGCAACGG - Intronic
1070155247 10:73829900-73829922 CCCAGGCTAAAGAAGAGCACAGG + Intronic
1070780798 10:79136369-79136391 CCCTGCCCAAGGCAGGGCTGGGG - Intronic
1071623823 10:87147647-87147669 CCCACCCCAAAATAGGGCCCAGG - Intronic
1072520978 10:96229896-96229918 CACAGCCCAGGGCTGGGCACAGG + Intronic
1072680623 10:97503577-97503599 ACCAGCCCCAAACAGGGCCCTGG - Intronic
1074674046 10:115828026-115828048 CCAAGCCTGAAGCCGGGCACGGG + Intronic
1074776274 10:116770445-116770467 CCCAGACCCAAGGAGGGCATCGG - Intergenic
1075057314 10:119229202-119229224 CCCAACCCAGCACAGGGCACTGG - Intronic
1075961228 10:126568985-126569007 CCCTGCCCCCAGCAGGGCTCTGG - Intronic
1076033828 10:127182180-127182202 CCTAGTCCAAAGCAGGGAAAAGG + Intronic
1076414186 10:130273506-130273528 CTCAGCCCACAGCAGTGCCCAGG - Intergenic
1076566096 10:131400571-131400593 CCCAGCAGAAAGCAGGACAATGG + Intergenic
1076715202 10:132360510-132360532 CCCACCATAAAGCAAGGCACAGG - Intronic
1076765552 10:132631088-132631110 CCCAGCCCCACGCAGGGCCAAGG + Intronic
1077494638 11:2880945-2880967 CCCAGCCCAGTCCAGGGGACAGG + Intergenic
1078315165 11:10288775-10288797 CTCAGCCCAGAGCAGAGCAGAGG - Intronic
1078930494 11:15908756-15908778 CCCTGCACAGAGCAGGGAACGGG + Intergenic
1079106046 11:17573149-17573171 CACTGCTCAAAGTAGGGCACGGG - Exonic
1081598129 11:44473366-44473388 CCCAGCTCAAAGGAGGCCTCTGG - Intergenic
1082793468 11:57363624-57363646 CCCAGCTAAATGCAGGGGACTGG + Intronic
1082796426 11:57381278-57381300 CCCAGCAGAGAGCAGGGCACAGG - Intergenic
1083731491 11:64654763-64654785 CGCAGCCCAAGGGAGGGGACTGG + Intronic
1083741955 11:64715948-64715970 CCCAGCCCAGGGCAGGGAAGGGG + Intronic
1083894238 11:65612159-65612181 CCCAGCACACAGCAGGGACCAGG - Intronic
1084518442 11:69648791-69648813 CCCAGCCCCAAGCTGGGGTCAGG - Intronic
1084589921 11:70084641-70084663 GCCAGCCCAGGACAGGGCACTGG - Intronic
1085037382 11:73308530-73308552 CCACGCCGAAAGCAGCGCACGGG - Exonic
1085254734 11:75165988-75166010 CCCAGCGCAAAGCAATGCAGAGG - Intronic
1085308748 11:75503578-75503600 CCCAGCCCACAGCAGGCCTCAGG + Intronic
1085391138 11:76182906-76182928 CCCAGCCCTGAGCAAGCCACTGG - Intergenic
1088848855 11:113689664-113689686 CCCAGTCCCCAGCAGGGCCCGGG + Intronic
1089750458 11:120647893-120647915 CCCAGCTCCATGCTGGGCACTGG - Intronic
1090882760 11:130848788-130848810 CCCAGCCCCAGCCAGGGCAAAGG - Intergenic
1091128048 11:133119507-133119529 CGCAGCCCAGCCCAGGGCACTGG + Intronic
1092162293 12:6322450-6322472 CCGAGCCGGAAGCAGGGGACAGG - Intronic
1092173575 12:6388347-6388369 CACAGCCCCAAGAAGGGCAGAGG - Intronic
1095828779 12:46560333-46560355 CCCAGCACAAAGCCTGGCTCAGG - Intergenic
1101445722 12:104735695-104735717 CCCTGTCCCATGCAGGGCACTGG - Intronic
1101921530 12:108937201-108937223 CAAAACCCAAAACAGGGCACAGG + Intronic
1103321256 12:120093913-120093935 CCCAGCCCTGAGCAGGGGAAAGG - Exonic
1103441673 12:120967616-120967638 CCCAGCCCAGAGCTGGGCGGGGG + Intergenic
1103923296 12:124410593-124410615 CCCAGCCCCAAGCAGGCAGCAGG + Intronic
1104667430 12:130657422-130657444 CCCAGCCGGAAGCAGGCCCCGGG + Intronic
1104669249 12:130669136-130669158 AACAGCCCAAACCAGGGCACAGG + Intronic
1104717578 12:131026246-131026268 CCCAGCCCTCTGGAGGGCACCGG - Intronic
1104893658 12:132151775-132151797 CCCAGCCCAGAGCCGGGCCTTGG + Exonic
1105803676 13:23935871-23935893 CACATCCCAAAACTGGGCACAGG - Intergenic
1105825088 13:24115329-24115351 CCCAGCCCACAGACTGGCACTGG + Intronic
1105829616 13:24152340-24152362 CACAGCCCCAAACAAGGCACAGG + Intronic
1106134252 13:26962363-26962385 CCCTGCCCACAGCAGGTCAGGGG + Intergenic
1107793104 13:44022546-44022568 CCCAGAGCCCAGCAGGGCACAGG + Intergenic
1107938229 13:45362934-45362956 CTCAGCTCAAAGCAGTCCACGGG + Intergenic
1108570173 13:51741865-51741887 CCCAGCCCTCAGTAAGGCACTGG + Intronic
1111662744 13:91231640-91231662 CCCACCCCAAAACAGGCCCCAGG - Intergenic
1111936781 13:94566161-94566183 GCCAGCCCTAAGGAAGGCACAGG - Intergenic
1112503143 13:99957324-99957346 CCCAGCCCCAGCCAGTGCACTGG - Intergenic
1113710904 13:112464691-112464713 ACCACCCAACAGCAGGGCACAGG + Intergenic
1113899940 13:113791144-113791166 CCCAGCCCTGGGCAGGACACAGG - Intronic
1114755537 14:25255304-25255326 CCCAGCCCAAATCAGGAAACTGG + Intergenic
1117921267 14:60727254-60727276 GCCATCCCAAACCAGGTCACAGG + Intergenic
1118346578 14:64945591-64945613 GCCAGCCCAATGCAGGGCAACGG + Intronic
1118718940 14:68580136-68580158 CCCAGGACAAAACAGGGCCCGGG + Intronic
1119183021 14:72617057-72617079 CCCAGGCCAAGGCAGGGCACTGG - Intergenic
1120766126 14:88327553-88327575 CCAAGCCAAAAGCAGAGCCCAGG - Intergenic
1121118520 14:91360622-91360644 CCCAGCCCGAGGTGGGGCACAGG + Intronic
1121509678 14:94502975-94502997 CTCAGCCCAAAGAAGGGCACCGG - Intronic
1121629561 14:95412440-95412462 CCCAGCACAAAGCCTGGCACAGG + Intronic
1121975201 14:98397016-98397038 CCCAGCTCACAGCAAGGCAAGGG + Intergenic
1122279097 14:100610707-100610729 CCCACCCCAAGGCAGGGCCCAGG + Intergenic
1123108288 14:105853037-105853059 CCCAACCCACAGCAGGGAGCAGG - Intergenic
1124649645 15:31465337-31465359 CCCAGCACAAAGCAGTCCTCAGG + Intergenic
1125524202 15:40365028-40365050 CCCACCCCAAGGCAGGTCAGAGG + Intronic
1126436582 15:48644574-48644596 CCCACACCAAAGGAGGGAACCGG + Intronic
1127359303 15:58230824-58230846 CCCAGCCCCAGGCAGGGGAGAGG + Intronic
1128327408 15:66734022-66734044 CCCAGTCCAAATCAGGGTGCAGG - Intronic
1128512670 15:68323013-68323035 CACAGCCCAAACCAGGGGAGAGG + Intronic
1129170947 15:73807472-73807494 CCCAGTCCCCAGCAGGGCAGAGG - Intergenic
1129710894 15:77819796-77819818 CCCAGCCCGAACCTGGGCCCAGG + Intronic
1129748139 15:78039253-78039275 CGCAGCCCAAAGCAGGCACCCGG - Intronic
1132073057 15:98796833-98796855 CCTGGCACAAAGCAGGGCTCAGG + Intronic
1132206918 15:99992763-99992785 CGCAGCCCAAGGCAGGACGCGGG - Intronic
1132473077 16:117775-117797 CCAAGCCCTGAGCAGGGCCCAGG + Intronic
1132600071 16:769262-769284 CCCAGCCCTCCGCAGGGCCCGGG + Intergenic
1132616377 16:842901-842923 CACAGCCCACAGCTGTGCACAGG - Intergenic
1132854480 16:2038698-2038720 CCAGGCCCCCAGCAGGGCACAGG - Exonic
1132904220 16:2273926-2273948 CCCAGCCCACGGGAGGGCAGGGG - Intergenic
1132936084 16:2482026-2482048 CTCAGCCTGAAGCAGAGCACAGG - Intronic
1132975966 16:2711400-2711422 CACAGCCCAGAGCAGGGTGCAGG + Intergenic
1133564274 16:6978326-6978348 ACCAGCCCAAAATAGAGCACCGG - Intronic
1134209921 16:12267566-12267588 CCAAGACCATGGCAGGGCACTGG + Intronic
1136538259 16:30913249-30913271 GCCAGCCCCAAGCTGGGGACAGG - Intergenic
1137716190 16:50599764-50599786 CCCAGAGCCAGGCAGGGCACGGG - Intronic
1137729061 16:50676800-50676822 CCTGGCCCTATGCAGGGCACTGG - Intronic
1138145849 16:54611252-54611274 CCCAGCTCAAGGCTGGCCACGGG + Intergenic
1138187084 16:54985078-54985100 GCCAGCCCCAGGCAGGGCCCAGG - Intergenic
1138205556 16:55121827-55121849 CCCAGCTCAAGGCAGGTCCCTGG - Intergenic
1139365396 16:66429391-66429413 CCCAGAGCAGAGCAGGGCATAGG + Intronic
1140051942 16:71489167-71489189 CGCAGCTCAAAGAAGGGGACGGG - Exonic
1141148721 16:81549728-81549750 CCGAGCCCAGAGCAGGGCCTGGG + Intronic
1141429969 16:83966376-83966398 CCCAGCCCAGTGCAGGGTTCCGG - Intergenic
1141660737 16:85440105-85440127 CCCAGCCCCATGCTTGGCACTGG - Intergenic
1142123341 16:88397965-88397987 CCCTGCCCAGAGCCGGGCACAGG + Intergenic
1143515866 17:7418923-7418945 CCCAGTCCCAGGCAGGGCAGGGG + Exonic
1144202046 17:12950399-12950421 CGCAGCCCAAAGCCAGGCGCAGG + Intronic
1145265880 17:21379413-21379435 CCCAGCCCAGAGCTGGGCCTGGG - Intronic
1145796051 17:27655827-27655849 TTCCGCACAAAGCAGGGCACTGG + Intergenic
1145810496 17:27761144-27761166 TTCCGCACAAAGCAGGGCACTGG + Exonic
1146181806 17:30703245-30703267 CCCAGCCCAAATCCGGGACCCGG + Intergenic
1146903456 17:36602518-36602540 CCCAGCCTAATGCGGGGAACGGG + Intronic
1147421951 17:40326253-40326275 CCCAGACCAGAGCTTGGCACAGG - Intronic
1147596817 17:41723141-41723163 CTCAGCCCTGAGCAGGGAACAGG - Exonic
1147674005 17:42192626-42192648 CCCAGGCCAAGGCAGGGGTCGGG + Exonic
1147880785 17:43652032-43652054 CAGAGCCCAAAGCAGGACCCAGG - Intronic
1148202450 17:45758274-45758296 CCCAGCCAGGAGCAGGGCTCTGG + Intergenic
1148214725 17:45828236-45828258 CCCAGCCCATAATAGGGGACTGG - Intronic
1149326107 17:55531276-55531298 CCAAGCCAAAAGGAGGGCAAGGG - Intergenic
1149571422 17:57675085-57675107 GCCAGCCCACAGCCGGGCTCGGG + Exonic
1151212059 17:72551889-72551911 CCCACCCCACAGCAGGCCCCAGG + Intergenic
1151719008 17:75845157-75845179 CCCAGCCCAGCACTGGGCACAGG - Intergenic
1152258884 17:79255887-79255909 CCCAGCCCCAAGCAGAAGACAGG - Intronic
1152811578 17:82385186-82385208 CCCAGCCCCATGCAGGGGTCAGG + Intergenic
1153959114 18:10125092-10125114 CCCAGGCCAAGGCAGGGTCCTGG - Intergenic
1154156441 18:11947828-11947850 CCTGGCCCAAAGCAGGGCGCCGG - Intergenic
1154309312 18:13255147-13255169 CCCAGCACACAGCAGGGCTCTGG - Intronic
1154374981 18:13801471-13801493 CCCAGCCCCTAGCTGTGCACGGG + Intergenic
1155904231 18:31429808-31429830 CCCAGCCCAAGGCAGAGCAGAGG + Intergenic
1157452198 18:47797181-47797203 TCCAGCCAGAAGCAGGCCACAGG - Intergenic
1157790491 18:50526817-50526839 CTCAGCCTAAAGCATGGAACAGG + Intergenic
1158328642 18:56337572-56337594 CCCATCCTAAAGATGGGCACAGG - Intergenic
1160773929 19:846227-846249 CCCAGCCCATGGCCAGGCACTGG - Exonic
1162818774 19:13210578-13210600 CCCAGCGCCCAGCAGGGCTCCGG - Intronic
1162977027 19:14212558-14212580 CCCAGCCCAAATCTGGGACCCGG - Intergenic
1163079795 19:14930541-14930563 CCCAGACCAAAGCAAGGGTCAGG + Intergenic
1163271834 19:16259076-16259098 CCCAATGCAAAGCAGGGCCCAGG + Intergenic
1163382557 19:16978499-16978521 CCATGCCCAAAGCAGGACTCTGG + Intronic
1163667616 19:18610643-18610665 CCCACCTCCAAGCAGGGTACAGG - Intronic
1164126771 19:22325572-22325594 CCCACCTGAAAGCAGGGCACAGG - Intergenic
1164227665 19:23260249-23260271 CCCTCCTGAAAGCAGGGCACAGG + Intergenic
1165913422 19:39243878-39243900 CTCAGCCCACGGCAGGGCCCAGG - Exonic
1165916503 19:39264310-39264332 CCTAACCCAAGGCAGGGGACTGG + Intergenic
1165917533 19:39269745-39269767 CTCAGCCCACGGCAGGGCCCAGG + Exonic
1165921086 19:39298220-39298242 CTCAGCCCACAGCAGGGCCCAGG + Exonic
1166034297 19:40156197-40156219 AGCATCACAAAGCAGGGCACAGG + Intergenic
1166198686 19:41222442-41222464 CCTTGACCCAAGCAGGGCACCGG + Intronic
1166213179 19:41320236-41320258 CCCAGCGCAAGGCTGGGCACAGG + Intronic
1166254197 19:41590617-41590639 ACCAGCCCACAGCCTGGCACAGG + Intronic
1166360921 19:42252713-42252735 CCCCCCCCAAAGCCGGGAACAGG - Intronic
1166687235 19:44802682-44802704 CTCAGCCCAGCGCTGGGCACAGG - Intergenic
1166996598 19:46722514-46722536 CCCGCCCCAAAACAGGGCCCAGG - Intronic
1167079683 19:47270658-47270680 CCCAGGCCAAGGCAGCGCCCAGG + Exonic
1167524099 19:49972953-49972975 CCAACCCCTTAGCAGGGCACAGG + Intergenic
1167719948 19:51172420-51172442 TCCAGCCTCTAGCAGGGCACAGG + Intergenic
1168103723 19:54154233-54154255 CCCAGCACTCAGCAGGGCAGGGG + Intronic
1168249782 19:55135140-55135162 CTCAGACGAAAGCAGGTCACTGG + Intronic
1168444816 19:56402992-56403014 CCCAACCCTAAGGAGGGGACGGG + Intronic
1168559607 19:57371928-57371950 CACAGCCCAACCCAGGACACTGG - Intronic
925235651 2:2275056-2275078 CCCACCCCAAACCAGCACACTGG - Intronic
925404088 2:3594901-3594923 CCCACCCCAAAGCCGGCCTCAGG + Intronic
926109598 2:10173519-10173541 CCCAGCCCAATGCAGGCCCGTGG + Intronic
926118595 2:10228773-10228795 CACTGCCCAAAGCAGGGCTGGGG + Intergenic
926621250 2:15048951-15048973 CCCAGTCCAGAGCAGGGGCCAGG + Intergenic
926791142 2:16573171-16573193 CCCAGCCCTAGGCTGGACACTGG + Intronic
928299294 2:30111320-30111342 CCCAGCCTAACGCAGGGCTCCGG + Intergenic
929377726 2:41310061-41310083 CCCAACCCAAAACTGGGAACGGG + Intergenic
931721182 2:65068909-65068931 CCCAGGCCTCAGCTGGGCACTGG - Intronic
932506983 2:72243579-72243601 CCCACCCCACAGCAGGCCCCAGG - Intronic
932682304 2:73836554-73836576 CCCAGCCCTGAGCAGGGGAAAGG + Intronic
935190785 2:100777350-100777372 CCAAGCCCAAAGCAGAGCTAAGG + Intergenic
935719905 2:105970769-105970791 TCCAGCCTAATGCAGGGCAGAGG - Intergenic
937638435 2:124184296-124184318 CCCACCCCAAAGCTGGGGAGGGG - Intronic
938121731 2:128638858-128638880 CTCAGCCCACACCAGGGCCCTGG - Intergenic
939014105 2:136881251-136881273 ACAAGTCCAAAGCAGGGCAAGGG - Intronic
940984310 2:160037468-160037490 CCCAGCCCTCAGCATGTCACTGG - Intronic
942556650 2:177178431-177178453 TCCAGCCCAGAACAGGGGACGGG - Intergenic
944170742 2:196773927-196773949 CCCAGTCCCTAGCAGGCCACGGG + Intronic
946185309 2:217977589-217977611 CCCAGCCCAGTGCCTGGCACAGG - Intronic
946366658 2:219253120-219253142 CCCAGCCCAAAGCGGGGATTGGG + Intronic
947645050 2:231732709-231732731 CCCAGACCAGGGCAGGGGACAGG - Exonic
948082867 2:235220647-235220669 CCCAGCCCAGAGCAGGGGCAGGG + Intergenic
948132114 2:235608502-235608524 CCCAGCCCAACGCTGGGCCAGGG - Intronic
948293900 2:236847060-236847082 CCCAGCACAGAGCAGGGTAGAGG - Intergenic
948577436 2:238963851-238963873 CCCAGCCCCAAGCTGTGGACGGG + Intergenic
948640449 2:239372454-239372476 CCCAGCCCAAGGAAGGACCCTGG - Intronic
948756800 2:240164816-240164838 CCCAGCACAGGGCTGGGCACAGG + Intergenic
948757905 2:240169832-240169854 CCCAGGCCCCAGGAGGGCACAGG - Intergenic
948809465 2:240467311-240467333 CCCAGCCAGCTGCAGGGCACGGG + Exonic
1171053725 20:21885661-21885683 CCAAACCAGAAGCAGGGCACTGG + Intergenic
1172426276 20:34858414-34858436 CCAAGCCCTATGCTGGGCACTGG - Intronic
1172781333 20:37438512-37438534 CCCAGCCCAGAGCAGGGAGGAGG + Intergenic
1172948813 20:38708688-38708710 CCCAGCACAAAGCAGGAGATTGG + Intergenic
1174396478 20:50250091-50250113 CCCAGCACAGAGCCTGGCACAGG - Intergenic
1175123482 20:56734831-56734853 CCCAGCCCCTAGCAGGGTGCAGG - Intergenic
1175279026 20:57790389-57790411 CAAAGCCCACTGCAGGGCACTGG - Intergenic
1175529749 20:59666327-59666349 CCCTGCCTAAACCAGGCCACTGG + Intronic
1175660993 20:60812087-60812109 TCCAGAGCAAAGCACGGCACTGG + Intergenic
1175800791 20:61800071-61800093 CCCAGCCCACAGCATGGTCCAGG + Intronic
1176124222 20:63468336-63468358 CCCAGCACAGAGCGGGGCCCTGG - Intronic
1176216752 20:63951684-63951706 CCCAGGGCTCAGCAGGGCACAGG + Intronic
1176216766 20:63951726-63951748 CCCAGGGCTCAGCAGGGCACAGG + Intronic
1176216780 20:63951768-63951790 CCCAGGGCTCAGCAGGGCACAGG + Intronic
1178882554 21:36460934-36460956 CCCAGCCCACAGCAGCCCAGGGG + Exonic
1179397261 21:41052620-41052642 CCCTGCACAAACCAGGGCAGGGG - Intergenic
1179556667 21:42182951-42182973 CCCTGCTTAAAGCAGGGCAGGGG - Intergenic
1179720220 21:43312204-43312226 CACAGCTCAAAGCAGGGAGCAGG + Intergenic
1180990245 22:19931462-19931484 CCCTCCCCCAAGCAGGGCAGTGG - Intronic
1181265411 22:21628328-21628350 CCCAGCCCAGAGCTGGGACCTGG - Exonic
1181513308 22:23398427-23398449 CCCAGTGCAGAGCAGGGCAGGGG - Intergenic
1181604075 22:23969523-23969545 CCCAACCCCCAGCAGGGCAGTGG - Intronic
1181604428 22:23971777-23971799 CCCAACCCCCAGCAGGGCAGTGG + Exonic
1181635377 22:24172007-24172029 CCCAGTCCAGAGCTGGGCCCAGG + Intronic
1181747571 22:24966440-24966462 CCCAGCCCTGCCCAGGGCACTGG - Intronic
1182347715 22:29678335-29678357 AGCTGCCCACAGCAGGGCACAGG - Intronic
1183226391 22:36553117-36553139 CCCAGCCAGAACCAGGGCTCAGG - Intergenic
1183508634 22:38222679-38222701 CCCGGGCAAAAGCAGGGCAAGGG + Intronic
1184091806 22:42296753-42296775 GCCAGCCCCAAGCAGGGCTCAGG + Intronic
1184158348 22:42683630-42683652 CCCAGCCCACAGCAGCTCCCAGG - Intergenic
1184260596 22:43313185-43313207 CCCAGCACAAGGCTGGGCATAGG + Intronic
1184378220 22:44128518-44128540 CCCAGCCTAAGGCAGCACACAGG + Intronic
1184501776 22:44878941-44878963 CCCAACCAAGAGCAGGGCTCAGG - Intergenic
1184723230 22:46328233-46328255 CTCAGCCCTGATCAGGGCACTGG + Intronic
1184864507 22:47194828-47194850 CCCAGCCCAGAGCTGGGCTATGG + Intergenic
1185170572 22:49291408-49291430 TCCAGGCCAAAGCATGGCAGGGG - Intergenic
949596464 3:5553087-5553109 TCCAGCCAGTAGCAGGGCACTGG + Intergenic
950091901 3:10301683-10301705 CCCAGACCAGAGCAGAGCATCGG + Intronic
950257962 3:11521440-11521462 CGCATCGCACAGCAGGGCACGGG + Intronic
950404767 3:12797389-12797411 CCCAGCCTAAAGGAGGGGGCTGG + Intronic
950620432 3:14201263-14201285 ACCAGCCCACAGATGGGCACAGG - Intergenic
950705016 3:14774050-14774072 CCCAGCCCAGAGCAGAGCTCAGG + Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954299285 3:49690888-49690910 CCCAGCCCTGTGCTGGGCACAGG + Intronic
954388142 3:50255133-50255155 CCCAGGCCAAACCAGGCCAGAGG - Intronic
954686234 3:52371766-52371788 CCATGCAGAAAGCAGGGCACAGG + Intronic
956113723 3:65897454-65897476 CCCACCCCACAGCAGGCCCCAGG - Intronic
956289423 3:67646181-67646203 CCCTGCCTGAAGCAGGGCTCAGG - Intronic
960867781 3:122219437-122219459 CCCAGCCCAGATCAGGGTTCAGG + Intronic
961217163 3:125168568-125168590 CCCTGCCCACATCAGGGAACAGG + Intronic
962299824 3:134229359-134229381 TCCAGCCCAAAGGAGAGCAAGGG - Intronic
962350093 3:134650426-134650448 CACAGCACACTGCAGGGCACAGG - Intronic
965587536 3:170332014-170332036 CCCAGCCCACAACAGGCCCCGGG + Intergenic
966086209 3:176069235-176069257 CCTAGCCCAGAGAAGGGCCCAGG + Intergenic
966302461 3:178494920-178494942 TCCTGGCCAAAGCAGGCCACAGG + Intronic
967305365 3:188053740-188053762 CTCTGCCCTAAGCAGGGCAATGG - Intergenic
967894436 3:194384809-194384831 CCCAGCGCAATCCAGGGCAGGGG + Intergenic
968130223 3:196188851-196188873 CCCAGCCCCAAGCTTGGGACGGG + Intergenic
968382487 4:108127-108149 TCCAGCGCAAAGCAGGGGACAGG + Intergenic
968505703 4:970407-970429 CCCAGGTCACTGCAGGGCACAGG - Intronic
968549299 4:1214104-1214126 CCCTGCCCAAAGAAGGGCTGAGG + Intronic
969330177 4:6470358-6470380 ACCAGCCCTCAGCAGGGCACAGG - Intronic
969351966 4:6603330-6603352 CCCAGCCCAGGGCTGGGCCCAGG - Intronic
969433148 4:7167716-7167738 CCAAGCACCAAGCTGGGCACTGG - Intergenic
969435779 4:7188582-7188604 CCCAGCTCCAGGCTGGGCACTGG - Intergenic
971186058 4:24377272-24377294 CCCAGCCCAGAGTGGGGCAGCGG + Intergenic
971938948 4:33189307-33189329 CCAAGCCCAAAGCAAGGAGCTGG - Intergenic
978948263 4:114525248-114525270 CCCAGCCCACAACAGGCCCCTGG - Intergenic
979646777 4:123078953-123078975 CAGAGCACAAAGGAGGGCACTGG - Intronic
984620013 4:181942041-181942063 CACGGCCGAAAGCAGGTCACCGG - Intergenic
985808929 5:2069016-2069038 CCAAGCCCGAAGCAGGGGACGGG - Intergenic
986327176 5:6684963-6684985 CCCACCCCAACACATGGCACAGG - Intergenic
994099351 5:95877163-95877185 CCCAGAGCAGAGCAGGGCAATGG + Intergenic
996685277 5:126273305-126273327 CCCACCCCACAACAGGGCCCTGG + Intergenic
997986508 5:138505502-138505524 CCCACCCAAAAGCAGGTCAGGGG - Intergenic
999378116 5:151101142-151101164 CATAGCCCAAACCAGGGCAGAGG + Exonic
999843034 5:155449541-155449563 CCCAGCCAAAAGCCTGCCACAGG - Intergenic
1001595378 5:172895522-172895544 CCCAGCCCCAGGCCAGGCACTGG + Intronic
1001639311 5:173233942-173233964 CCCAGCCCAAGGCAGGAGCCCGG - Intronic
1001877269 5:175212539-175212561 CCCTGCTCAAAGCTGGGCAGTGG + Intergenic
1002176612 5:177404479-177404501 CCCAGCCCCACGCGGCGCACCGG + Exonic
1002542806 5:179917332-179917354 CCCAGCTCACAGCAGTCCACTGG + Intronic
1002969025 6:1995353-1995375 CCCAGCCCTAACCAGTGCACGGG + Intronic
1003415918 6:5907767-5907789 CACAACCCAAAGCAGGCCATAGG + Intergenic
1004288661 6:14346549-14346571 CTCAGCCCCAGGCAGGGCACAGG + Intergenic
1005707589 6:28470645-28470667 CCCACACCATGGCAGGGCACAGG + Intergenic
1006389266 6:33748965-33748987 CCCAGCACACAGCTGGGCAGGGG - Intergenic
1006410604 6:33871201-33871223 CCCAGCCTAGAGCTGAGCACGGG + Intergenic
1007581092 6:42960638-42960660 CCCGGCCCAAAGCCCGGCAGGGG + Intergenic
1011018500 6:82784771-82784793 CCCAGCACAATGCTAGGCACTGG + Intergenic
1013447528 6:110245828-110245850 CCCTGCCTCAAGCAGGGCACAGG + Intronic
1015067251 6:129045837-129045859 GGCAGACCAAAGCAGGGCACAGG + Intronic
1017719067 6:157232446-157232468 CCCAGCCCAAGGCAGGATGCTGG + Intergenic
1018272379 6:162094159-162094181 CCCAGCTCACAGATGGGCACTGG - Intronic
1018913388 6:168117323-168117345 CCCAGCCCTAAACAGGCCACTGG - Intergenic
1019024901 6:168951221-168951243 CCCATCCCGAAGCAGGGCTGTGG + Intergenic
1019316483 7:389304-389326 CCCAGCCCCAGGCAGAGAACTGG - Intergenic
1019434758 7:1016978-1017000 ACCAGCGCACAGCAGCGCACAGG + Intronic
1019481442 7:1268683-1268705 TCCAGCCCAAAGAGGGCCACTGG - Intergenic
1019913825 7:4117954-4117976 CCCAGTCCTGAGCTGGGCACAGG - Intronic
1021566776 7:22024048-22024070 CCCAGCCCACAGCAGAGGCCTGG + Intergenic
1022271140 7:28809236-28809258 CCCAGCCCACAGGGGGGCGCCGG + Exonic
1023834123 7:44058554-44058576 CCCAGCCCAGACCTGGGCAGAGG + Intronic
1026899025 7:74027204-74027226 CCCAGCCCCATGCAGGCCGCAGG - Intergenic
1026904995 7:74057744-74057766 CAGACCCCAGAGCAGGGCACAGG - Intronic
1026973506 7:74481916-74481938 CCCACCCCACAGAAGGGCCCTGG - Intronic
1027048501 7:75007031-75007053 TCCAGCACAAAGCCGGGCATGGG - Intronic
1028998780 7:97130554-97130576 CACAGGCCAGAGCAGGGCAGTGG - Intronic
1029104759 7:98166002-98166024 CCCAGCACAGGGCCGGGCACTGG - Intronic
1029604063 7:101588023-101588045 CCCAGCCCAGAGCAGGTCACAGG - Intergenic
1030057532 7:105596519-105596541 CCCAGTCCCTAGCAGGGAACTGG - Intronic
1032383523 7:131506351-131506373 CCCAGCCCAGAGCGAGGCAGTGG + Intronic
1032745126 7:134778752-134778774 CCCAGCCCAAAGCAGGTGGTGGG + Intronic
1032940933 7:136790606-136790628 CCAAGCCCAAATCAAGGAACAGG - Intergenic
1035464317 7:159064778-159064800 CCCAGCACACAGCTGTGCACAGG - Intronic
1035829291 8:2676902-2676924 CGTAGCCCACAGCAGGCCACAGG + Intergenic
1035889722 8:3330090-3330112 CCCAGGTCAAAGCAGGGTAGTGG + Intronic
1036650215 8:10637282-10637304 CTCACCCCAGAGCAGAGCACAGG + Intronic
1037548522 8:19947588-19947610 CCCAGGCCAAAGGAGTGCAGTGG - Intronic
1039484693 8:37901217-37901239 CCCTGCCCTCAGCAGGGCATAGG - Intergenic
1040051785 8:43022175-43022197 CCCTGTCCAAAGCTGGACACCGG - Exonic
1040065128 8:43139335-43139357 TCCACCCCAGAGCAGTGCACAGG - Intergenic
1043444723 8:80308009-80308031 CCCAGCACAAAGGAGAGTACAGG - Intergenic
1045582676 8:103498850-103498872 CCCAGCCCCGAGCAGAGCAAAGG + Intergenic
1047362913 8:124185311-124185333 CCCAGCCCAAGTCTGGGAACTGG + Intergenic
1048486021 8:134848165-134848187 CCCAGAGCCAAGCATGGCACTGG + Intergenic
1048942919 8:139417994-139418016 CCCAGAACAGAGCAGGCCACAGG + Intergenic
1048970705 8:139643593-139643615 GCCGGCCCTCAGCAGGGCACAGG + Intronic
1049220275 8:141425781-141425803 CCCAGCCAAAAGCAGAGTCCTGG - Intronic
1049383691 8:142330362-142330384 CCCAACCCAGGGCAGGCCACTGG + Intronic
1049596212 8:143484681-143484703 CCCAGCCCAAAGGGTGGCACAGG - Intronic
1049766628 8:144358190-144358212 CCAAGCCCAAGGCCGGGCTCAGG - Exonic
1053306075 9:36985771-36985793 CCCAAGCCACAGCAGGTCACTGG + Intronic
1053375771 9:37605151-37605173 CCCAGCCCCAGGCTGGGTACTGG - Intronic
1056214402 9:84393829-84393851 CCCCACCCAAAGCAGGGAGCAGG - Intergenic
1056513509 9:87328434-87328456 CCCAGGCCAAAGCAAGAGACAGG + Intergenic
1056735700 9:89207875-89207897 CCCATTCCAGAGCAGGGCATGGG - Intergenic
1057279003 9:93697269-93697291 CCCCGCGCAAAGAGGGGCACAGG - Intergenic
1057290496 9:93803080-93803102 CCCAGCCCCAGGCATGGCAAGGG - Intergenic
1057969970 9:99545404-99545426 CCCTACCCCAAGAAGGGCACAGG - Intergenic
1058793572 9:108474741-108474763 CACATCCCAAAGCAAGGTACTGG - Intergenic
1058879428 9:109273673-109273695 CCCAGCCCACCTCAGAGCACGGG + Intronic
1059064304 9:111066432-111066454 GCCAGGCCAAGGCAGGGCAGGGG - Intergenic
1059395892 9:114033823-114033845 CCCAGCCCAGTGCCTGGCACAGG - Intronic
1059639787 9:116205229-116205251 CCTAGCCCAAAGCAGAGAAGTGG - Intronic
1060453337 9:123764813-123764835 CACAGCACAGAGCAGGGCAGTGG + Intronic
1060697503 9:125721949-125721971 CCCAACCAAAAGAAGGGAACAGG - Intergenic
1060793807 9:126501890-126501912 CCCAGCCCCAGGGAGGGCCCTGG - Intronic
1060883587 9:127135446-127135468 ACCAGCCCAGAGCAGGGGCCAGG + Intronic
1061188595 9:129069329-129069351 CCCAGCACAGAGCAGGCCACTGG + Intronic
1061527556 9:131179389-131179411 TGCAGGGCAAAGCAGGGCACAGG - Intronic
1061861029 9:133468946-133468968 CCCAGGTCACAGCAGGTCACAGG - Exonic
1062021706 9:134322653-134322675 CCAAACCCAAAGCAGTGCAGGGG - Intronic
1062040282 9:134401397-134401419 CCCAGCCTAAAGCCGGGGTCAGG + Intronic
1062196180 9:135275462-135275484 CCCGGCCCAGAGGAGGACACAGG - Intergenic
1062328357 9:136023466-136023488 CTCAGCTCTAAGGAGGGCACTGG - Intronic
1062561112 9:137142415-137142437 CCCAGCCCAGAGCAGGCCAAAGG + Intronic
1185593075 X:1291478-1291500 GCCAGCCAGGAGCAGGGCACTGG - Intronic
1186680680 X:11870541-11870563 CCCAGACAAAAGCAGGAGACTGG + Intergenic
1187268284 X:17757085-17757107 TCCTCCCCAAATCAGGGCACAGG - Intergenic
1187320954 X:18237188-18237210 TCCTCCCCAAATCAGGGCACAGG + Intergenic
1188015669 X:25105185-25105207 CCCAGCCCTATGCAAAGCACTGG + Intergenic
1189201881 X:39203544-39203566 TCCAGCTCAAAGAAGGGCACGGG + Intergenic
1190875760 X:54459073-54459095 CCCACCCCAAGGCAGGGGGCAGG + Intronic
1192639359 X:72847628-72847650 CCCAGACCACAGTAGGCCACAGG - Intronic
1192642352 X:72873177-72873199 CCCAGACCACAGTAGGCCACAGG + Intronic
1196745968 X:119071987-119072009 TCCACCCCAAAGAGGGGCACAGG + Intergenic
1199601085 X:149541415-149541437 CCCTGCCGACAGCAGGGGACAGG - Exonic
1200044392 X:153393339-153393361 CCCACCCCATAGCTGGGCCCAGG + Intergenic
1200081026 X:153576428-153576450 CCCATCCCAGTGCAGGGCTCTGG - Intronic
1200182669 X:154160246-154160268 CCCAAACCAAAGCAAGACACGGG - Intergenic
1200188323 X:154197360-154197382 CCCAAACCAAAGCAAGACACGGG - Intergenic
1200193973 X:154234500-154234522 CCCAAACCAAAGCAAGACACGGG - Intergenic
1200199728 X:154272304-154272326 CCCAAACCAAAGCAAGACACGGG - Intronic
1200249210 X:154543311-154543333 CCCAACCCGAAGCTGGCCACAGG + Intronic
1200845536 Y:7828785-7828807 CACAGCCCAAATCAGAGAACTGG - Intergenic