ID: 920339184

View in Genome Browser
Species Human (GRCh38)
Location 1:205265069-205265091
Sequence ACACCTCCTTGGTGACATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 218}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920339184_920339195 23 Left 920339184 1:205265069-205265091 CCTTCATGTCACCAAGGAGGTGT 0: 1
1: 0
2: 1
3: 13
4: 218
Right 920339195 1:205265115-205265137 AGGAGCTGGTGTCCTGCTGCAGG 0: 1
1: 1
2: 2
3: 34
4: 302
920339184_920339190 -1 Left 920339184 1:205265069-205265091 CCTTCATGTCACCAAGGAGGTGT 0: 1
1: 0
2: 1
3: 13
4: 218
Right 920339190 1:205265091-205265113 TCCAGGCCTCTGTGGAGGGACGG 0: 1
1: 0
2: 2
3: 46
4: 418
920339184_920339189 -5 Left 920339184 1:205265069-205265091 CCTTCATGTCACCAAGGAGGTGT 0: 1
1: 0
2: 1
3: 13
4: 218
Right 920339189 1:205265087-205265109 GGTGTCCAGGCCTCTGTGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 297
920339184_920339188 -6 Left 920339184 1:205265069-205265091 CCTTCATGTCACCAAGGAGGTGT 0: 1
1: 0
2: 1
3: 13
4: 218
Right 920339188 1:205265086-205265108 AGGTGTCCAGGCCTCTGTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 282
920339184_920339187 -9 Left 920339184 1:205265069-205265091 CCTTCATGTCACCAAGGAGGTGT 0: 1
1: 0
2: 1
3: 13
4: 218
Right 920339187 1:205265083-205265105 AGGAGGTGTCCAGGCCTCTGTGG 0: 1
1: 0
2: 2
3: 28
4: 324
920339184_920339194 9 Left 920339184 1:205265069-205265091 CCTTCATGTCACCAAGGAGGTGT 0: 1
1: 0
2: 1
3: 13
4: 218
Right 920339194 1:205265101-205265123 TGTGGAGGGACGGAAGGAGCTGG 0: 1
1: 0
2: 5
3: 50
4: 557
920339184_920339192 3 Left 920339184 1:205265069-205265091 CCTTCATGTCACCAAGGAGGTGT 0: 1
1: 0
2: 1
3: 13
4: 218
Right 920339192 1:205265095-205265117 GGCCTCTGTGGAGGGACGGAAGG 0: 1
1: 0
2: 3
3: 44
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920339184 Original CRISPR ACACCTCCTTGGTGACATGA AGG (reversed) Intronic