ID: 920340593

View in Genome Browser
Species Human (GRCh38)
Location 1:205272936-205272958
Sequence GACCTCTCCTGGTACTCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920340593_920340598 4 Left 920340593 1:205272936-205272958 CCTGCTGAGTACCAGGAGAGGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 920340598 1:205272963-205272985 CCCATCCTCTCTCTGAAGCCAGG 0: 1
1: 0
2: 1
3: 37
4: 308
920340593_920340600 5 Left 920340593 1:205272936-205272958 CCTGCTGAGTACCAGGAGAGGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 920340600 1:205272964-205272986 CCATCCTCTCTCTGAAGCCAGGG 0: 1
1: 0
2: 2
3: 39
4: 353
920340593_920340605 30 Left 920340593 1:205272936-205272958 CCTGCTGAGTACCAGGAGAGGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 920340605 1:205272989-205273011 CTTCCATTCCATTTAGCCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920340593 Original CRISPR GACCTCTCCTGGTACTCAGC AGG (reversed) Exonic
900750811 1:4396137-4396159 GTCCACTCCTGTCACTCAGCAGG + Intergenic
900843177 1:5072924-5072946 GAGCTCTCCAGGGACTCACCTGG - Intergenic
901012798 1:6210725-6210747 GCCCTCTTCTGGGACTCACCCGG - Intronic
902864713 1:19270443-19270465 GCCCTCACCTGGTACACAGTGGG + Intergenic
902869983 1:19308150-19308172 GCCCTCACCTGGTACACAGTGGG + Exonic
904456895 1:30653318-30653340 GACCTGTCCTGACACTCAACTGG - Intergenic
905414697 1:37795745-37795767 GTCCTGTCCTGGTACCCACCTGG + Exonic
908141269 1:61187795-61187817 GACCTGCCCTGGTTTTCAGCAGG - Intronic
910100017 1:83565685-83565707 GCCCTCTCCTGGTTCTCTGTGGG + Intergenic
919777551 1:201204095-201204117 TATCTCTCCTGGTGCTGAGCTGG + Intronic
920210896 1:204327500-204327522 GCGCTCTCCTGGGCCTCAGCGGG - Intronic
920340593 1:205272936-205272958 GACCTCTCCTGGTACTCAGCAGG - Exonic
921765550 1:218969210-218969232 GACCTGTGCTGCTCCTCAGCTGG + Intergenic
921964076 1:221069227-221069249 GGCCTCTCCTGGGACACAGAGGG + Intergenic
1067540090 10:47144734-47144756 GACCTCACCAGGGCCTCAGCTGG - Intergenic
1072225821 10:93367904-93367926 TGCCTCTGCTGGTACTCAACAGG + Intronic
1080040550 11:27755090-27755112 GACATCTCCTGGAACTGAGGAGG + Intergenic
1083889741 11:65589817-65589839 CACCACTCCTGCTACTCACCAGG - Exonic
1084544723 11:69809196-69809218 AACCTCTCCTGGCACTTGGCAGG - Intergenic
1085514602 11:77105025-77105047 GGCCTCCCCTCGTGCTCAGCAGG - Intronic
1086071317 11:82803098-82803120 GGTCTCTCCTGGAACTGAGCAGG - Intergenic
1088687096 11:112293723-112293745 GTCCTCTCATGGCACTCAGCTGG - Intergenic
1088986993 11:114917900-114917922 GACCTCTCCTGGAACTTAATAGG - Intergenic
1089094387 11:115906614-115906636 GACTTCTCCTGCTGCTCAGGTGG + Intergenic
1089885311 11:121816003-121816025 GCCATCTCCTGGGAGTCAGCAGG - Intergenic
1091802677 12:3334379-3334401 GCCCTCTCCTGGTGCCCGGCCGG + Intergenic
1093165595 12:15801791-15801813 TACTTCTCCTGGTACTCTTCTGG - Intronic
1106726905 13:32495622-32495644 GAGCTGGCCTGGTACCCAGCAGG + Intronic
1112147521 13:96717722-96717744 GACCTCTCCTGGTGTCAAGCTGG + Intronic
1112425411 13:99293998-99294020 GACCTTTCCAGGTAGTCAACTGG - Intronic
1114653800 14:24303843-24303865 TACCTCACCTGGTGCTCTGCAGG - Exonic
1117340156 14:54785356-54785378 GCTCCCTCCTGGTACTAAGCGGG + Intronic
1118473726 14:66098542-66098564 GGCCTAACCTGGTCCTCAGCTGG + Intergenic
1119179320 14:72594280-72594302 GACCTCTCCCAGTTCCCAGCAGG + Intergenic
1121301867 14:92878200-92878222 GACCGCTGCTGACACTCAGCAGG - Intergenic
1122264071 14:100538580-100538602 GGCCTCTCCGGGTCCCCAGCAGG - Exonic
1122988812 14:105226659-105226681 GACCCCCCCTCGTACACAGCTGG - Exonic
1123118444 14:105905307-105905329 AACCTGTCCTGGAACTCACCTGG - Intergenic
1127866233 15:63035481-63035503 GGCCTCTTCTGGAACTCTGCCGG + Intergenic
1129048329 15:72756700-72756722 GGGCTCTCCTGGGACTCAGGGGG - Intronic
1129379581 15:75156663-75156685 GGCCTCTTCTGGTACTCGGGTGG + Intergenic
1129718844 15:77866789-77866811 GAGCTGTCCTGGTGCCCAGCAGG + Intergenic
1130460085 15:84154071-84154093 GAGCTGTCCTGGTGCCCAGCAGG - Intergenic
1130991685 15:88879434-88879456 CCTCTCTCCTGGGACTCAGCTGG + Intronic
1131646281 15:94348530-94348552 AACGTCTCCTGGTTCTCACCTGG - Intronic
1133604839 16:7376576-7376598 GACATCCCCTGGTAGTTAGCTGG - Intronic
1133822414 16:9248444-9248466 CACCTAGCCTGGTCCTCAGCAGG - Intergenic
1142076217 16:88119726-88119748 TGCCTCTCCTGGTTCTCCGCTGG + Intergenic
1142866636 17:2795335-2795357 GACCACACCTGGTACACAGCAGG - Intronic
1144663624 17:17087500-17087522 GACCTCTGCAGGTACTGAGAGGG + Intronic
1144938735 17:18921485-18921507 GCCCTCTCCTGATGCTCACCTGG + Intronic
1148146211 17:45366695-45366717 CGCCTCTCCTGGGGCTCAGCAGG - Intergenic
1148687752 17:49510039-49510061 GGCCTCTCTAGGTACTCAGGAGG + Intronic
1151936015 17:77261735-77261757 CCCCTCTCCAGGTACACAGCTGG + Intergenic
1160583820 18:79901938-79901960 GCCCTCTCCTAGTACCCAGATGG + Intergenic
1160880025 19:1315541-1315563 GACCTGTCCAGGTCCCCAGCAGG + Intergenic
1162819094 19:13212095-13212117 GCCCTCACCTGGTTCTCTGCAGG + Exonic
1164331021 19:24256406-24256428 AACCTTTCTTGTTACTCAGCAGG - Intergenic
1165121640 19:33562823-33562845 CTCCTCTCCTGCCACTCAGCAGG + Intergenic
1166112688 19:40632499-40632521 GACCCCTCCTGACACTCAGCGGG - Intergenic
925057015 2:863870-863892 GTCCTTCCCTGGTACACAGCTGG + Intergenic
925179214 2:1806078-1806100 GACCTTTCCTGCTGCTCATCAGG - Intronic
925497425 2:4468049-4468071 GACCCCTCCTGCTACTCAGGAGG + Intergenic
925636040 2:5942150-5942172 GACTTTTCCTGATATTCAGCTGG + Intergenic
927480328 2:23448676-23448698 CACCTCTCCTGGTCCCCAGAAGG - Intronic
928363487 2:30684263-30684285 GACCTGTCCTGTCATTCAGCTGG - Intergenic
929451562 2:42041651-42041673 GACAGCTCCTGGTGCACAGCAGG + Intergenic
931464054 2:62471600-62471622 GTCCACTCCTGGAATTCAGCAGG + Intergenic
932777788 2:74538823-74538845 GTTGTCTCCTGGAACTCAGCAGG + Intronic
932879085 2:75483591-75483613 TACCTCTCCTCTTACCCAGCTGG + Intronic
940335782 2:152525780-152525802 GCCCTCTGCTGCCACTCAGCCGG + Intronic
944423786 2:199558079-199558101 GACCTCTGCAGTTACTCAGGAGG - Intergenic
946311795 2:218886137-218886159 CACCTCTCTGGGTACACAGCGGG - Intronic
948829199 2:240589533-240589555 AAGGCCTCCTGGTACTCAGCAGG - Intronic
948983238 2:241505651-241505673 GACCTCTACTGCTTCACAGCAGG + Intronic
1170441610 20:16385291-16385313 GCTCTCTCCTGACACTCAGCAGG + Intronic
1171065039 20:22007216-22007238 GACCACCCCTGGTAGGCAGCTGG + Intergenic
1172018824 20:31898152-31898174 GCCCTCTCCTGGCAATCATCTGG - Intronic
1173229533 20:41183470-41183492 GACCTCTCCTGGAAGGCAGAAGG + Exonic
1173258877 20:41415451-41415473 GACCTCTCCTGCTCATCAGAGGG - Exonic
1173378110 20:42508266-42508288 CACCTTTCCTGCTATTCAGCAGG - Intronic
1173748218 20:45454512-45454534 GAGCTGTCCTGACACTCAGCGGG - Intergenic
1173866268 20:46314322-46314344 CAGCCCTCCTGGTGCTCAGCAGG - Intergenic
1175368506 20:58471255-58471277 GGCCTCTCCCGGCACACAGCAGG + Intronic
1175814414 20:61876116-61876138 GTCCTCTCCTTGGACACAGCCGG - Intronic
1176371644 21:6065950-6065972 CACCTCTCATGGTACAAAGCTGG + Intergenic
1176384827 21:6134096-6134118 GGCCTTTTCTGGCACTCAGCTGG + Intergenic
1178568863 21:33716073-33716095 GACCTCTGCAGGTACTTAGGTGG - Intronic
1179738645 21:43404156-43404178 GGCCTTTTCTGGCACTCAGCTGG - Intergenic
1179751875 21:43472589-43472611 CACCTCTCATGGTACAAAGCTGG - Intergenic
1180108665 21:45637396-45637418 GCTCTCTCCTGGAGCTCAGCAGG - Intergenic
1180798430 22:18619487-18619509 GAACTCCACTGGAACTCAGCGGG - Intergenic
1180965252 22:19784774-19784796 GACAGCTCCTGGTAATCAGAGGG + Exonic
1181223288 22:21375778-21375800 GAACTCCACTGGAACTCAGCGGG + Intergenic
1181255452 22:21559848-21559870 GAACTCCACTGGAACTCAGCGGG - Intronic
1183058860 22:35323174-35323196 GCCCTGTCCTGGCACTCACCTGG - Exonic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1185401801 22:50622790-50622812 GAGCTCTCCAGGTAGGCAGCTGG + Intronic
949223871 3:1670321-1670343 TACTTCTCTTGGTACTCTGCTGG - Intergenic
950026527 3:9824041-9824063 CACCACACCTGGCACTCAGCAGG - Intronic
950483835 3:13261210-13261232 GTCCTCAAGTGGTACTCAGCTGG - Intergenic
950681523 3:14588497-14588519 GGCCTCTCCTGGGACCCAGGTGG + Intergenic
952749645 3:36814951-36814973 GGCCTGTCCTGGTATTAAGCAGG - Intergenic
954049646 3:47963401-47963423 GAGCTCTCCTTTTACACAGCAGG + Intronic
954638974 3:52086878-52086900 GACAGCACCTGGTACACAGCAGG + Intronic
960025873 3:113008773-113008795 GACCTGTCCTGGTACAGAGGGGG - Intronic
966971258 3:185047643-185047665 GCCCTCGCCTGGTACTAGGCAGG + Intronic
969933554 4:10658448-10658470 TATCTCTCCTGGTTCTCAGCTGG + Intronic
976217789 4:82731195-82731217 GACTTCTCCTGGTAGCCAGCTGG + Intronic
980801927 4:137762843-137762865 GATGAGTCCTGGTACTCAGCAGG - Intergenic
984855791 4:184194920-184194942 GACCTTTCCTAGACCTCAGCAGG + Intronic
985881475 5:2641829-2641851 GACCTCTCCAGGTGGTCTGCTGG - Intergenic
987345060 5:16971831-16971853 AGCCTGTCCTGGCACTCAGCGGG - Intergenic
990266338 5:54080917-54080939 GACCTCTCCTGGCATGCAGATGG + Intronic
991943614 5:71879113-71879135 GAACTTTCCTGTTCCTCAGCTGG - Intergenic
992598188 5:78367434-78367456 GACATCTCCAGGTAACCAGCAGG - Intronic
995587222 5:113660516-113660538 AACCTCTCCTGGTACTTGACTGG + Intergenic
995970532 5:117964714-117964736 GACATACCCTGGTTCTCAGCTGG + Intergenic
997643694 5:135466438-135466460 GACAGACCCTGGTACTCAGCAGG - Intergenic
1007104376 6:39273488-39273510 GGCCTGTGCTGGTACCCAGCAGG + Intergenic
1008422281 6:51315729-51315751 GACCTCACCTGGTACATAGTGGG + Intergenic
1011718505 6:90131458-90131480 GGCCTCCCCTGGTTCTCAGCAGG - Intronic
1013342378 6:109227635-109227657 CACCTCACCTTGTGCTCAGCAGG - Intergenic
1013389694 6:109671423-109671445 AACCTCTCCTGGTACTCAAATGG - Intronic
1018680432 6:166259785-166259807 GACCTCTGCTGGGAGGCAGCAGG - Intergenic
1018936263 6:168275885-168275907 GAGCTCTCCTGGCTCTCAGAGGG - Intergenic
1024830675 7:53451685-53451707 GACCTCTCCTGGTTTGCAGATGG + Intergenic
1029793137 7:102866416-102866438 GACCTCTCCTAGTCCTCCTCAGG - Intronic
1030225558 7:107146434-107146456 TACCTCTCCTGGTGCTCTGTGGG + Exonic
1035967549 8:4210082-4210104 GAGCTCTCCTGGTACAGGGCTGG - Intronic
1036668817 8:10766145-10766167 CACCCCACCTGGTACCCAGCCGG - Intronic
1048025846 8:130586035-130586057 GACCACTCCTGGTATCCACCAGG + Intergenic
1051804889 9:20981422-20981444 GATATCTCTTGGTATTCAGCTGG - Exonic
1052852837 9:33388181-33388203 GAACTCTCCTGGTGTTCCGCGGG + Intronic
1053458456 9:38250134-38250156 TTCCTCTCCTGGTAGGCAGCGGG + Intergenic
1053691159 9:40588182-40588204 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1054273645 9:63049309-63049331 GCCCTCTCCTGGCACTGACCTGG - Intergenic
1054302419 9:63389153-63389175 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1054401189 9:64715647-64715669 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1054434800 9:65199973-65199995 GCCCTCTCCTGGCACTGACCTGG + Intergenic
1054495589 9:65821708-65821730 GCCCTCTCCTGGCACTGACCTGG - Intergenic
1056287867 9:85109469-85109491 GACCTCCCCTGATCCTCACCAGG - Intergenic
1061406822 9:130396886-130396908 GACCTCTCCTGAGACGCAGAAGG - Intronic
1062326298 9:136014126-136014148 GGCCTCTCCTGGTGACCAGCAGG - Intronic
1062476519 9:136730381-136730403 GTCCTCTCCTGGGTCTCAGCAGG - Intergenic
1185445083 X:253668-253690 GCCTGCTCCTGGCACTCAGCAGG + Intergenic
1187882714 X:23861631-23861653 CAGCTCTCTTGGTTCTCAGCAGG - Intronic
1187959680 X:24556789-24556811 AACTTCTCCAGGTATTCAGCAGG - Intergenic
1188138095 X:26514580-26514602 GACCTCTCTTGGCACTGTGCAGG - Intergenic
1192716394 X:73647335-73647357 CATCTCTCCAGGAACTCAGCAGG - Intronic
1193151876 X:78133972-78133994 GACATCTTCTGATTCTCAGCAGG - Intronic
1199746008 X:150772316-150772338 GACCTCACCTGGTGCTCATGGGG - Intronic
1201077165 Y:10196856-10196878 GACCACTCCTGGTACCGCGCAGG + Intergenic
1201177878 Y:11321182-11321204 GACCTCTCCAGGAATCCAGCAGG - Intergenic
1202379165 Y:24261102-24261124 GAGCTGTCCTGGTGCCCAGCAGG + Intergenic
1202491617 Y:25409019-25409041 GAGCTGTCCTGGTGCCCAGCAGG - Intergenic