ID: 920340593

View in Genome Browser
Species Human (GRCh38)
Location 1:205272936-205272958
Sequence GACCTCTCCTGGTACTCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920340593_920340598 4 Left 920340593 1:205272936-205272958 CCTGCTGAGTACCAGGAGAGGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 920340598 1:205272963-205272985 CCCATCCTCTCTCTGAAGCCAGG 0: 1
1: 0
2: 1
3: 37
4: 308
920340593_920340605 30 Left 920340593 1:205272936-205272958 CCTGCTGAGTACCAGGAGAGGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 920340605 1:205272989-205273011 CTTCCATTCCATTTAGCCTTTGG 0: 1
1: 0
2: 1
3: 22
4: 169
920340593_920340600 5 Left 920340593 1:205272936-205272958 CCTGCTGAGTACCAGGAGAGGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 920340600 1:205272964-205272986 CCATCCTCTCTCTGAAGCCAGGG 0: 1
1: 0
2: 2
3: 39
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920340593 Original CRISPR GACCTCTCCTGGTACTCAGC AGG (reversed) Exonic