ID: 920341640

View in Genome Browser
Species Human (GRCh38)
Location 1:205278843-205278865
Sequence AGTGAGAAGGAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920341630_920341640 22 Left 920341630 1:205278798-205278820 CCCAGAGGGCAAGATACCTGAGG No data
Right 920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG No data
920341629_920341640 28 Left 920341629 1:205278792-205278814 CCACAACCCAGAGGGCAAGATAC No data
Right 920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG No data
920341632_920341640 21 Left 920341632 1:205278799-205278821 CCAGAGGGCAAGATACCTGAGGA No data
Right 920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG No data
920341636_920341640 6 Left 920341636 1:205278814-205278836 CCTGAGGAAGGGGCTTCTAAGTC No data
Right 920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG No data
920341628_920341640 29 Left 920341628 1:205278791-205278813 CCCACAACCCAGAGGGCAAGATA No data
Right 920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920341640 Original CRISPR AGTGAGAAGGAGAATGAGGA TGG Intergenic
No off target data available for this crispr